"This spreadsheet contains many data drawn from the publicly available databases, particularly the YPD and SGD databases.  It is intended for non-commercial use only."																																																																									
																																																																									
				Number		Name			Hyperlinks			Gal-Cln3		Gal-Cln3		Gal-Clb2		Gal-Clb2																	Promoter Elements																																						
Process	Function		Peak	Phase Order	Cluster Order	ORF	YPD 	SGD 	YPD	SGD	MIPS	#1	#2	Geomean	Absolute	#1	#2	Geomean	Absolute	Deletion	Known?	Description	Aggregate Score	Phase	No. Elements	Most Relevant Promoter Elements								Number	SCB	SCB	SCB	SCB		Number	SCB_d	SCB_d	SCB_d	SCB_d	Number	MCB	MCB	MCB	MCB	Number	MCB_d	MCB_d	MCB_d	MCB_d		Number	SFF	Number	Swi5	Swi5	Swi5	Swi5	Number	Swi5e	Swi5e	Swi5e	Swi5e	Number	ECB	Number	STE12	MIG1 sites	
unknown	unknown		G2/M	778	205	YAL022C	YAL022C	FUN26	YPD	SGD	MIPS	1.46	1.16	1.30	0.77	1.42	1.85	1.14	1.14	viable	New	"weak similarity to Na+/H+ antiporter, has 11 potential transmembrane domains "	3.795	0.843																																																	
cell cycle	G1/S cyclin		G2/M	747	256	YAL040C	CLN3	CLN3	YPD	SGD	MIPS	7.55	10.78	9.02	9.02	1.03	1.65	1.26	1.26	viable	Known	"G1/S-specific cyclin, interacts with Cdc28p protein kinase to control events at START "	2.422	1.249	4	w 542 acgCGCGAAAaag	c 566 ttcCGCGAAAaaa	w 545 gcaACGCGcgaaa	c 475 aaaACGCGgttgg											2	w 542 acgCGCGAAAaag	c 566 ttcCGCGAAAaaa								2	w 545 gcaACGCGcgaaa	c 475 aaaACGCGgttgg						1	w 225 GAAGCCAGCCAG														
unknown	unknown		G1	331	432	YAL053W	YAL053W	YAL053W	YPD	SGD	MIPS	2.41	1.27	1.75	1.75	1.72	1.89	1.80	0.56	undocumented	New	Protein of unknown function 	1.580	-1.591	1	c254 tcgCGCGAAAaaa														1	c254 tcgCGCGAAAaaa																																
drug resistance	suppressor of sulfoxyde ethionine		S	445	629	YAL067C	SEO1	SEO1	YPD	SGD	MIPS	1.47	1.11	1.28	0.78	2.19	1.05	1.44	0.69	undocumented	New	Protein with similarity to Dal5p and members of the allantoate permease family of the major facilitator superfamily (MFS) 	1.648	-2.587																																																	
unknown	unknown		G1	212	464	YAR003W	YAR003W	YAR003W	YPD	SGD	MIPS	2.12	1.33	1.68	1.68	1.28	1.22	1.25	0.80	undocumented	New	contains WD40 repeat; similarity to human RB protein binding protein	2.121	-1.099	1	w 170 attACGCGattcg																								1	w 170 attACGCGattcg							4	w 635 TCAACCAGCCAC	w 478 CGCACCAGCGTC	c 19 AGAACCAGCTGA	c 336 TTTACCAGCTCA											
DNA replication	"replication factor A, 69 kD subunit"		G1	262	527	YAR007C	RFA1	RFA1	YPD	SGD	MIPS	1.94	1.71	1.82	1.82	2.57	1.33	1.85	0.54	lethal	Known	DNA replication Factor A; promoter has Mlu1 cell cycle box (MCB) elements	8.339	-1.305	5	c118 tcaCGCGAAAaat	c326 cctCGCGAAAgaa	w410 caaACGCGTgtt	w128 gtgACGCGTtat	c 117 gtcACGCGaaaaa										2	c118 tcaCGCGAAAaat	c326 cctCGCGAAAgaa			2	w410 caaACGCGTgtt	w128 gtgACGCGTtat			1	c 117 gtcACGCGaaaaa																						
tRNA splicing	splicing endonuclease subunit		G1	215	417	YAR008W	SEN34	SEN34	YPD	SGD	MIPS	1.64	1.04	1.26	0.80	1.78	1.33	1.54	0.65	lethal	New	"tRNA splicing endonuclease, gamma subunit, has active site for 3' slice site cleavage "	3.660	-1.113	5	w219 ttcACGCGTctt	w189 tttACGCGTgac	w 675 agcACGCGactgg	w 593 atcACGCGaatga	w 59 ggtACGCGcatag															2	w219 ttcACGCGTctt	w189 tttACGCGTgac			3	w 675 agcACGCGactgg	w 593 atcACGCGaatga	w 59 ggtACGCGcatag					1	c 321 GAAACCAGCAAG				1	c 321 GAAACCAGCAAG						1			
unknown	protein kinase		G2/M	767	88	YAR018C	KIN3	KIN3	YPD	SGD	MIPS	1.30	1.19	1.25	0.80	3.39	3.52	3.45	3.45	viable	Known	similar to Pho85; null has no phenotype	6.090	0.995																																		1	w 487 AATACCAGCAAA														
phosphate metabolism	secreted acid phosphatase		G2/M	780	94	YAR071W	PHO11	PHO11	YPD	SGD	MIPS	1.48	1.82	1.64	0.61	12.87	6.90	9.42	9.42	viable	New	acid phosphatase	8.047	0.813																																																w 427 AGAAAAGCGGGG	
chromatin structure	histone H2B		S	424	789	YBL002W	HTB2	HTB2	YPD	SGD	MIPS	3.46	2.57	2.99	2.99	1.73	1.46	1.59	0.63	viable	Known	Histone H2B (HTB1 and HTB2 code for nearly identical proteins)	8.477	-2.428	2	w543 gaaCGCGAAAaca	w 544 agaACGCGaaaac													1	w543 gaaCGCGAAAaca									1	w 544 agaACGCGaaaac							4	w 567 CTCACCAGCAAC	w 490 CTGGCCAGCTAG	c 320 ACCACCAGCTTA	c 494 CTGGCCAGCAAG	1	c 494 CTGGCCAGCAAG									
chromatin structure	histone H2A		S	441	790	YBL003C	HTA2	HTA2	YPD	SGD	MIPS	3.50	2.35	2.87	2.87	1.46	1.10	1.27	0.79	viable	Known	Histone H2A (HTA1 and HTA2 code for identical proteins)	10.320	-2.579	3	w 366 cttACGCGTgag	c 240 attACGCGatgtt	c 439 taaACGCGacgtg																	1	w 366 cttACGCGTgag				2	c 240 attACGCGatgtt	c 439 taaACGCGacgtg																					
unknown	unknown		G1	401	738	YBL009W	YBL009W	YBL009W	YPD	SGD	MIPS	1.91	1.47	1.68	1.68	1.42	1.30	1.04	0.96	undocumented	New	similar to ALK1	2.060	-2.228	1	w144 attCGCGAAActt														1	w144 attCGCGAAActt																																
DNA replication	MCM initiator complex		G2/M	790	97	YBL023C	MCM2	MCM2	YPD	SGD	MIPS	1.11	1.22	1.16	1.16	1.37	2.26	1.76	1.76	lethal	New	Member of the MCM/P1 family that acts as a complex at ARS's to initiate replication 	4.274	0.688																										1	c 215 tacACGCGattcc																						
transport	mitochondrial ADP/ATP translocator		G2/M	703	151	YBL030C	PET9	PET9	YPD	SGD	MIPS	1.06	1.05	1.05	1.05	1.39	1.04	1.15	0.87	viable	New	ADP/ATP carrier protein of the mitochondrial carrier (MCF) family 	1.391	1.611																																																	
DNA replication	"DNA polymerase alpha, 70 kD subunit"		G1	216	494	YBL035C	POL12	POL12	YPD	SGD	MIPS	1.18	1.37	1.27	1.27	1.77	1.09	1.39	0.72	lethal	Known	"DNA polymerase alpha 86 kDa subunit, B subunit of polymerase alpha-primase complex; promoter has Mlu1 cell cycle box (MCB) elements"	6.918	-1.123	2	w609 gagACGCGTtca	c 560 ctaACGCGgtgcg																		1	w609 gagACGCGTtca				1	c 560 ctaACGCGgtgcg																						
silencing	unknown		S/G2	565	677	YBL052C	SAS3	SAS3	YPD	SGD	MIPS	1.01	1.27	1.12	1.12	1.76	1.05	1.30	0.77	viable	New	Protein that influences silencing at HMR 	1.936	2.674																																																	
cell wall biogenesis	chitin synthase regulator		M/G1	104	293	YBL061C	SKT5	SKT5	YPD	SGD	MIPS	1.60	1.06	1.23	1.23	1.65	1.15	1.38	0.73	viable	New	"Protoplast regeneration and killer toxin resistance protein, required for chitin synthase III activity "	2.287	-0.480																										1	c 197 aaaACGCGaagtg																						
"mitosis, spindle assembly"	kinesin related protein		S	467	731	YBL063W	KIP1	KIP1	YPD	SGD	MIPS	1.90	1.40	1.63	1.63	1.63	1.09	1.33	0.75	viable	New	Kinesin-related protein involved in establishment and maintenance of mitotic spindle 	2.574	-2.836																																																	
unknown	similar to Tsa1p		M/G1	93	321	YBL064C	YBL064C	YBL064C	YPD	SGD	MIPS	1.59	1.92	1.75	0.57	1.16	1.17	1.00	1.00	viable	New	Protein with similarity to Tsa1p 	1.895	-0.347																																																	
unknown	similar to bacterial NADP/NAD-dependent		G2/M	706	197	YBL098W	YBL098W	YBL098W	YPD	SGD	MIPS	1.58	1.32	1.44	0.69	1.11	1.03	1.07	0.94	undocumented	New	"Protein with similarity to bacterial NADP/NAD-dependent oxidoreductases involved in metabolism of aromatic compounds; member of unknown family 1 of proteins of unknown function, a subfamily of the major facilitator superfamily (MFS), which includes Ybl098p, Yel064p, Yer119p, Yil088p, Yjr001p, Ykl146p, and Ynl101p."	2.044	1.601																																																	
unknown	unknown		G2/M	711	152	YBL100C	YBL100C	YBL100C	YPD	SGD	MIPS	1.13	1.12	1.13	0.89	1.15	1.01	1.08	0.93	undocumented	New	Protein of unknown function 	1.486	1.571																																																	
unknown	unknown		G1	123	583	YBL111C	YBL111C	YBL111C		SGD	MIPS	1.30	2.06	1.26	1.26	1.16	1.36	1.08	1.08	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.980	-0.571	1	w 573 ctgACGCGccata																								1	w 573 ctgACGCGccata																						
unknown	unknown		G1	137	590	YBL112C		YBL112C		SGD	MIPS	2.01	2.74	2.35	2.35	1.20	1.04	1.07	0.93	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.112	-0.646																																																	
unknown	unknown		G1	127	582	YBL113C	YBL113C	YBL113C		SGD	MIPS	1.32	1.41	1.03	1.03	1.39	1.48	1.03	1.03	undocumented	New	Y' short ORF no intron	3.692	-0.596	1	w 14 ggtACGCGagttc																								1	w 14 ggtACGCGagttc																						w 296 TATTCGGCGGGG
unknown	unknown		G1	351	434	YBR007C	YBR007C	YBR007C	YPD	SGD	MIPS	2.18	1.18	1.60	1.60	1.64	1.75	1.70	0.59	undocumented	New	novel	1.383	-1.701	3	w14 tcaCACGAAAagt	w428 tgaACGCGTctc	c 310 ttaACGCGcagaa						1	w14 tcaCACGAAAagt										1	w428 tgaACGCGTctc				1	c 310 ttaACGCGcagaa							1	w 503 AATACCAGCCAG														
fluconazole resistance	"transporter, major facilitator superfamily"		S	473	704	YBR008C	FLR1	FLR1	YPD	SGD	MIPS	1.65	1.82	1.05	0.95	1.05	1.04	1.05	0.96	viable	New	Protein with similarity to members of the major facilitator superfamily (MFS) multidrug-resistance proteins family 	2.806	-2.897	2	c 676 acaCACGAAAatc	c 453 tatACGCGgtagc							1	c 676 acaCACGAAAatc															1	c 453 tatACGCGgtagc																						
chromatin structure	histone H4		S	417	791	YBR009C	HHF1	HHF1	YPD	SGD	MIPS	2.51	1.01	1.58	1.58	1.57	1.02	1.24	0.80	viable	Known	Histone H4 (HHF1 and HHF2 code for identical proteins)	7.635	-2.399	3	w 345 ctcACGCGTaag	w 472 attACGCGatgtt	w 273 taaACGCGacgtg																	1	w 345 ctcACGCGTaag				2	w 472 attACGCGatgtt	w 273 taaACGCGacgtg																					
chromatin structure	histone H3		S	420	795	YBR010W	HHT1	HHT1	YPD	SGD	MIPS	2.49	1.87	2.16	2.16	2.04	1.26	1.27	0.79	viable	Known	Histone H3 (HHT1 and HHT2 code for identical proteins)	9.399	-2.413																																																	
cell wall biogenesis	chitin synthase II		G2/M	709	224	YBR038W	CHS2	CHS2	YPD	SGD	MIPS	1.10	1.19	1.04	1.04	1.02	2.53	1.57	1.57	viable	New	Chitin synthase II	9.593	1.591										1	c 77 agtCACGAAAtca															1	c 563 gtaACGCGcttat							1	c 498 ATTGCCAGCCGC													
unknown	similar to rat calcium-binding protein regucalcin		M/G1	41	336	YBR053C	YBR053C	YBR053C	YPD	SGD	MIPS	1.08	1.92	1.44	0.69	1.19	1.41	1.29	1.29	undocumented	New	Protein with similarity to rat calcium-binding protein regucalcin and rat senescence marker protein 30 	1.362	0.099																																																
unknown	putative heat shock protein		G2/M	785	91	YBR054W	YRO2	YRO2	YPD	SGD	MIPS	4.06	5.88	4.88	0.20	3.74	10.44	6.25	6.25	undocumented	Known	"Protein with similarity to heat shock protein YDR033w and Hsp30p, has 7 potential transmembrane domains"	12.970	0.803										1	w 163 tttCACGAAAgtg																																	1	w 229 TTACCCAGAAAGGAAA			
stress response (putative)	cell wall mannoprotein		M/G1	90	320	YBR067C	TIP1	TIP1	YPD	SGD	MIPS	5.43	4.35	4.86	0.21	2.16	2.02	2.09	2.09	viable	Known	"Cold- and heat-shock induced mannoprotein of the cell wall, member of the PAU1 family "	3.417	-0.327	2	w 613 GGGGCCAGCAAC	w 613 GGGGCCAGCAAC													1	c 218 cagCGCGAAAagt																	1	w 613 GGGGCCAGCAAC				1	w 613 GGGGCCAGCAAC								
transport	amino acid permease		G2/M	731	196	YBR069C	VAP1	VAP1	YPD	SGD	MIPS	2.47	4.35	3.27	0.31	1.23	1.29	1.26	1.26	viable	New	"Amino acid permease for valine, leucine, isoleucine, tyrosine, and tryptophan "	1.812	1.412																																																
stress response	osmotolerance protein (putative)		G1	237	490	YBR070C	SAT2	YBR070C	YPD	SGD	MIPS	2.29	1.78	2.02	2.02	3.02	1.37	2.04	0.49	lethal	New	Protein involved in osmotolerance 	3.742	-1.215	5	c156 aaaCACGAAAtta	w311 aagCGCGAAAtta	w174 ctaCGCGAAAgtt	w 200 attACGCGcatta	w 175 cctACGCGaaagt				1	c156 aaaCACGAAAtta					2	w311 aagCGCGAAAtta	w174 ctaCGCGAAAgtt								2	w 200 attACGCGcatta	w 175 cctACGCGaaagt																		1		
unknown	similar to Herpesvirus saimiri EERF2		G1	169	563	YBR071W	YBR071W	YBR071W	YPD	SGD	MIPS	4.60	2.06	3.08	3.08	3.40	5.00	4.12	0.24	undocumented	New	Protein with weak similarity to Herpesvirus saimiri EERF2	6.969	-0.824	5	w333 aaaCACGAAAtta	c178 aagCGCGAAAtta	c315 ctaCGCGAAAgtt	c 289 attACGCGcatta	c 314 cctACGCGaaagt				1	w333 aaaCACGAAAtta					2	c178 aagCGCGAAAtta	c315 ctaCGCGAAAgtt								2	c 289 attACGCGcatta	c 314 cctACGCGaaagt																				
meiosis	helicase		G1	282	469	YBR073W	RDH54	RDH54	YPD	SGD	MIPS	2.88	1.61	2.15	2.15	2.13	2.56	2.34	0.43	viable	New	Protein required for mitotic diploid-specific recombination and repair and for meiosis 	3.306	-1.386	3	w 199 acaACGCGctgtt	w 74 aaaACGCGaagag	c 112 ttaACGCGatcga																						3	w 199 acaACGCGctgtt	w 74 aaaACGCGaagag	c 112 ttaACGCGatcga																			
pseudohyphal growth	trancriptional activator		M/G1	53	275	YBR083W	TEC1	TEC1	YPD	SGD	MIPS	1.39	1.82	1.59	0.63	1.30	1.29	1.29	1.29	viable	Known	Transcriptional activator involved with STE12 in pseudohyphal formation 	4.634	-0.010	1	w 693 AAAGCCAGCTAT								1	w 629 ttcCACGAAAaca															1	c 439 cgtACGCGgaatg							1	w 693 AAAGCCAGCTAT													
unknown	similar to calcium and sodium channel proteins		G2/M	623	154	YBR086C	YBR086C	YBR086C	YPD	SGD	MIPS	1.77	1.42	1.59	1.59	1.18	1.33	1.25	1.25	undocumented	New	"Protein with similarity to calcium and sodium channel proteins, has 7-9 potential transmembrane domains "	3.200	2.154																										1	c 647 ttaACGCGatttt																					
DNA replication	DNA polymerase processivity factor		G1	275	610	YBR087W	RFC5	RFC5	YPD	SGD	MIPS	1.32	1.19	1.26	1.26	1.13	1.52	1.16	1.16	lethal	New	"Replication factor C, 40 kDa subunit "	1.481	-1.363	1	w 89 ttaACGCGatttt																								1	w 89 ttaACGCGatttt																					
DNA replication	DNA polymerase processivity factor		G1	252	538	YBR088C	POL30	POL30	YPD	SGD	MIPS	5.33	4.15	4.70	4.70	3.72	2.70	3.17	0.32	lethal	Known	"Proliferating cell nuclear antigen (PCNA), required for DNA synthesis and DNA repair"	10.050	-1.268	4	w584 gtaCACGAAAttc	w541 agtCACGAAAcgc	w609 catCGCGAAAttt	w 535 gaaACGCGccaaa					2	w584 gtaCACGAAAttc	w541 agtCACGAAAcgc				1	w609 catCGCGAAAttt									1	w 535 gaaACGCGccaaa																					
unknown	unknown		G1	293	495	YBR089W	YBR089W	YBR089W	YPD	SGD	MIPS	1.77	2.01	1.07	1.07	1.50	1.02	1.21	0.83	undocumented	New	novel; questionable ORF	9.285	-1.427																																																
thiamine uptake	"acid phosphatase, constitutive"		G2/M	755	202	YBR092C	PHO3	PHO3	YPD	SGD	MIPS	1.22	3.23	1.98	0.50	1.39	18.18	3.61	3.61	undocumented	New	acid phosphatase	10.740	1.110																																																
phosphate metabolism	"acid phosphatase, repressible"		G2/M	723	95	YBR093C	PHO5	PHO5	YPD	SGD	MIPS	1.86	3.33	2.49	0.40	17.42	12.86	14.97	14.97	viable	New	acid phosphatase	3.862	1.453	1	w 148 CCCATTTGGGATAAGGGTAAACAT																														1	w 148 CCCATTTGGGATAAGGGTAAACAT															
unknown	similar to Mec1p and porcine tubulin-tyrosine		G2/M	728	191	YBR094W	YBR094W	YBR094W	YPD	SGD	MIPS	1.31	1.72	1.15	0.87	1.14	1.64	1.20	1.20	undocumented	New	Protein with weak similarity to Mec1p and porcine tubulin-tyrosine ligase 	1.828	1.424																																																c 660 ATCTTTGTGGGG
unknown	"similar to wheat glutenin, secalin"		G1	224	347	YBR108W	YBR108W	YBR108W	YPD	SGD	MIPS	1.53	1.23	1.11	0.90	2.01	1.11	1.35	0.74	undocumented	New	"Protein with weak similarity to wheat glutenin, secalin, and Drosophila mastermind protein "	2.777	-1.160																																		1	c 678 GACGCCAGCATT													
cell cycle	Swe1p (kinase) regulator		S/G2	573	693	YBR133C	HSL7	HSL7	YPD	SGD	MIPS	1.22	1.35	1.28	1.28	1.01	1.15	1.08	0.93	viable	New	Negative regulator of the Swe1p protein kinase	1.371	2.561	2	w 631 aacACGCGTgct	w 523 ccaACGCGgccag																		1	w 631 aacACGCGTgct				1	w 523 ccaACGCGgccag							1	w 518 GCGGCCAGCAGT				1	w 518 GCGGCCAGCAGT								
meiosis	unknown		G2/M	669	246	YBR138C	HDR1	HDR1	YPD	SGD	MIPS	1.49	1.37	1.43	0.70	1.40	2.78	1.41	1.41	viable	New	Protein involved in meiotic segregation 	3.004	1.845										1	w 357 aagCACGAAAact																																					
unknown	similar to serine-type carboxypeptidases		G2/M	690	181	YBR139W	YBR139W	YBR139W	YPD	SGD	MIPS	1.15	1.67	1.38	0.72	1.11	1.43	1.26	1.26	undocumented	New	Protein with similarity to serine-type carboxypeptidases 	1.722	1.691																																		1	c 411 AATACCAGCTCA													w 163 CTTTTAGCGGGG
unknown	unknown		M/G1	18	319	YBR157C	YBR157C	YBR157C	YPD	SGD	MIPS	1.57	1.18	1.36	0.74	1.05	1.48	1.25	1.25	viable	New	Protein of unknown function 	5.145	0.316																																																
unknown	required for optimal growth		M/G1	85	291	YBR158W	YBR158W	YBR158W	YPD	SGD	MIPS	1.28	1.69	1.15	0.87	1.61	1.47	1.54	1.54	viable	New	leucine repeat motif has similarity to that of Grr1p; null mutant cells have slow growth and reduced germination rate	7.599	-0.264	1	C 470 AACACCAGCAGG																																1	C 470 AACACCAGCAGG													
unknown	"similar to Sur1p, Hoc1p, and Och1p"		G1	368	433	YBR161W	YBR161W	YBR161W	YPD	SGD	MIPS	2.32	1.69	1.98	1.98	1.38	1.49	1.44	0.70	viable	New	"Protein with similarity to Sur1p, Hoc1p, and Och1p "	1.851	-1.845	2	w504 ataCGCGAAAgta	w 505 tatACGCGaaagt													1	w504 ataCGCGAAAgta									1	w 505 tatACGCGaaagt																					
bud emergence	binds Cdc24p		G2/M	782	80	YBR200W	BEM1	BEM1	YPD	SGD	MIPS	1.69	2.08	1.88	0.53	1.01	1.56	1.25	1.25	viable	New	"Protein with SH3 domains, required for cell polarization and bud formation "	3.349	0.812																																																
DNA replication	MCM initiator complex		G2/M	784	90	YBR202W	CDC47	CDC47	YPD	SGD	MIPS	2.36	1.85	2.09	0.48	1.92	2.44	2.16	2.16	lethal	Known	MCM7; MCM proteins are components of the prereplication complex because association of MCM proteins with replication origins requires both Orc1p and Cdc6 function	9.591	0.811	1	w 135 CCTAATTAGGTTAAACGTAAATAA																														1	w 135 CCTAATTAGGTTAAACGTAAATAA															
unknown	similar to peroxisomal serine-active lipase		M/G1	105	328	YBR204C	YBR204C	YBR204C	YPD	SGD	MIPS	1.49	1.07	1.26	1.26	1.29	1.06	1.10	0.91	undocumented	New	Protein with similarity to peroxisomal serine-active lipase 	1.630	-0.480																										1	w 134 aggACGCGccatt																					
unknown	unknown		G2/M	613	138	YBR242W	YBR242W	YBR242W	YPD	SGD	MIPS	1.31	1.17	1.24	1.24	1.37	1.35	1.36	0.73	undocumented	New	strong similarity to hypothetical protein YGL101w	1.936	2.269																1	c 663 tccCGCGAAAcaa									1	c 410 gatACGCGgtctg																					
protein glycosylation	UDP-N-acetyl-glucosamine-1-P transferase (GPT)		S/G2	502	718	YBR243C	ALG7	ALG7	YPD	SGD	MIPS	2.79	2.27	2.51	2.51	1.89	1.12	1.30	0.77	lethal	New	involved in first step in the dolichol pathway of N-glycosylation of proteins	2.430	-3.132	1	w 106 cagCGCGAAAatt														1	w 106 cagCGCGAAAatt																	1	c 584 TAAGCCAGCCTG													
flavin biosynthesis	"riboflavin synthase, alpha chain"		S/G2	513	314	YBR256C	RIB5	RIB5	YPD	SGD	MIPS	1.16	1.82	1.25	0.80	1.18	1.12	1.15	0.87	viable	New	"Riboflavin synthase, last step of riboflavin synthesis, converts 6,7-dimethyl-8-ribityllumazine to riboflavin "	1.700	3.124	1	c 321 cctACGCGacaaa																								1	c 321 cctACGCGacaaa																					
unknown	unknown		M/G1	99	317	YBR273C	YBR273C	YBR273C	YPD	SGD	MIPS	1.77	1.19	1.22	1.22	1.00	1.33	1.15	1.15	undocumented	New	Protein of unknown function 	1.625	-0.413																																																
unknown	unknown		G2/M	763	23	YBR287W	YBR287W	YBR287W	YPD	SGD	MIPS	1.01	1.89	1.38	0.72	1.24	1.02	1.10	0.91	undocumented	New	similarity to hypothetical S. pombe protein	1.375	1.063																																																
unknown	similar to phosphate-repressible phosphate permease		M/G1	29	380	YBR296C	YBR296C	YBR296C	YPD	SGD	MIPS	1.61	1.01	1.26	0.79	1.09	1.09	1.00	1.00	undocumented	New	Protein with similarity to phosphate-repressible phosphate permease 	1.800	0.231																																																
unknown	unknown		G2/M	608	213	YCL012W	YCL012W	YCL012W	YPD	SGD	MIPS	1.44	1.03	1.22	1.22	1.24	1.17	1.21	1.21	undocumented	New	Now considered part of Bud3	5.242	2.295																																		1	w 571 GCCGCCAGCTTC												
			S/G2	587	215	YCL013W	BUD3	BUD3	YPD	SGD	MIPS	1.54	1.10	1.30	1.30	1.20	2.14	1.60	1.60	viable	New	"This is now part of YCL014w, which is actually BUD3"	3.976	2.459	1	TCGAACAATTCTAAAAAGGTAAAT   AAAAACAATGGTA																														1	TCGAACAATTCTAAAAAGGTAAAT   AAAAACAATGGTA	1	w 61 GCCGCCAGCTTC												
cell polarity	bud site selection		S/G2	595	214	YCL014W	BUD3	BUD3	YPD	SGD	MIPS	1.57	1.40	1.48	1.48	1.39	1.36	1.38	1.38	viable	New	"Protein localized at the neck filament ring required for axial budding, may provide a memory of the previous bud site"	5.369	2.397																																															
unknown	unknown		G1	194	496	YCL022C	YCL022C	YCL022C	YPD	SGD	MIPS	1.52	1.57	1.55	1.55	1.05	1.13	1.09	1.09	undocumented	New	now considered part of YCL024W (KCC4)	7.009	-1.004																																															
unknown	unknown		G1	207	401	YCL023C	YCL023C	YCL023C	YPD	SGD	MIPS	1.52	1.45	1.02	0.98	1.03	1.20	1.11	0.90	undocumented	New	Protein of unknown function 	3.792	-1.068																																		1	c 492 TTTGCCAGCGAC												
unknown	protein kinase		G1	200	497	YCL024W	YCL024W	YCL024W	YPD	SGD	MIPS	1.78	1.83	1.80	1.80	1.39	1.05	1.15	0.87	undocumented	New	aka KCC4; close homologue of GIN4	8.194	-1.038	3	c190 gcaCGCGAAAaaa	w169 aaaACGCGTaac	c 189 agcACGCGaaaaa												1	c190 gcaCGCGAAAaaa				1	w169 aaaACGCGTaac				1	c 189 agcACGCGaaaaa																				
transport	amino acid permease		S/G2	575	126	YCL025C	AGP1	AGP1	YPD	SGD	MIPS	1.07	1.37	1.21	0.83	1.65	1.27	1.45	1.45	viable	New	Broad substrate range amino acid permease with high affinity for asparagine and glutamine 	2.095	2.539																																															w 218 CCTAATTGGGTAAGTACATGATGAAACA
mating; cell fusion	SH3 domain protein		M/G1	112	309	YCL027W	FUS1	FUS1	YPD	SGD	MIPS	1.52	1.06	1.20	1.20	1.04	1.08	1.02	0.98	viable	Known	"Protein with SH3 domain required for cell fusion during mating, located at the tip of the mating projection (shmoo)"	1.710	-0.514	3	w 482 AAAACCAGCGTC	w 482 AAAACCAGCGTC	C 195 CGCACCAGCAAC																														2	w 482 AAAACCAGCGTC	C 195 CGCACCAGCAAC			1	w 482 AAAACCAGCGTC							
unknown	unknown		G2/M	725	195	YCL038C	YCL038C	YCL038C	YPD	SGD	MIPS	1.93	1.89	1.91	0.52	1.28	1.80	1.52	1.52	undocumented	New	"Protein of unknown function, member of the major facilitator superfamily (MFS) "	1.541	1.439																																															
glycolysis	glucokinase		M/G1	111	340	YCL040W	GLK1	GLK1	YPD	SGD	MIPS	1.35	1.30	1.33	1.33	1.99	2.12	1.03	1.03	viable	New	"Glucokinase, specific for aldohexoses "	1.789	-0.513	1	w 634 GGCACCAGCAGA																			1	w 529 tgcACGCGTaac				1	w 232 tagACGCGgcgct							1	w 634 GGCACCAGCAGA												
unknown	unknown		G1	177	339	YCL042W	YCL042W	YCL042W	YPD	SGD	MIPS	1.05	1.49	1.19	1.19	1.65	1.42	1.08	0.93	undocumented	New	novel; questionable ORF	1.831	-0.895	1	w278 tgcACGCGTaac																			1	w278 tgcACGCGTaac												1	w 383 GGCACCAGCAGA												
protein folding	protein disulfide isomerase		G2/M	708	158	YCL043C	PDI1	PDI1	YPD	SGD	MIPS	2.46	1.02	1.55	1.55	1.15	1.15	1.15	0.87	lethal	New	Protein disulfide isomerase 	1.407	1.601																					1	w 96 gttACGCGTgca				1	c 394 tagACGCGgcgct																				
karyogamy	transcription factor		M/G1	81	306	YCL055W	KAR4	KAR4	YPD	SGD	MIPS	1.38	1.32	1.02	1.02	1.24	1.29	1.27	0.79	viable	Known	Regulatory protein required for pheromone induction of karyogamy genes 	3.272	-0.253																																															
			G1	211	498	YCL060C		YCL060C			MIPS	1.85	2.10	1.97	1.97	1.91	1.28	1.57	0.64	irrelevant	New	now combined into YCL061C	6.432	-1.092																																															
unknown	unknown		G1	238	442	YCL061C	YCL061C	YCL061C	YPD	SGD	MIPS	1.36	1.60	1.48	1.48	1.34	1.40	1.37	0.73	undocumented	New	similarity to myosin heavy chain form b from Chicken and Xenopus	3.267	-1.218																																															
			S/G2	569	209	YCL062W		YCL062W		SGD	MIPS	1.07	1.27	1.09	0.92	1.42	1.54	1.48	1.48	irrelevant	New	This is now part of YCL063w	1.980	2.599																																		1	c 365 GTGGCCAGCTCG												
unknown	similar to plant aminocyclopropane-1-carboxylate		S/G2	603	208	YCL063W	YCL063W	YCL063W	YPD	SGD	MIPS	1.18	1.11	1.14	0.88	1.08	1.05	1.06	0.94	viable	New	Protein with similarity to plant aminocyclopropane-1-carboxylate synthase	3.017	2.311	1	w 132 actCGCGAAAaga														1	w 132 actCGCGAAAaga																	1	c 403 TTAACCAGCGAG				1	c 403 TTAACCAGCGAG						
unknown	unknown		G2/M	762	46	YCL065W	YCL065W	YCL065W	YPD	SGD	MIPS	1.83	1.63	1.73	0.58	1.28	1.25	1.01	0.99	undocumented	New	Protein of unknown function 	2.192	1.072	1	w 588 CCCAATGTAGAAAAGTACATCATATGAAACA																								1	w 102 ggcACGCGgacaa																			1
transcription	silenced copy at HML; see YCR040W		G2/M	773	48	YCL066W	ALPHA1	ALPHA1	YPD	SGD	MIPS	1.16	1.24	1.20	0.84	1.65	1.03	1.30	1.30	undocumented	New	"Regulatory protein MATalpha1p, with Mcm1p activates alpha-specific genes (ALPHA1 and MATALPHA1 have the same coding sequence, but ALPHA1 is silenced)"	1.442	0.942	1	w 119 CCCAATGTAGAAAAGTACATCATATGAAACA																																												1
			S/G2	580	125	YCLX09W	YCLX09W	YCLX09W	YPD	SGD	MIPS	1.40	1.27	1.34	0.75	1.12	1.19	1.15	1.15	undocumented	New		1.557	2.488																																														
cytokinesis	septin		S/G2	601	156	YCR002C	CDC10	CDC10	YPD	SGD	MIPS	1.46	1.09	1.16	1.16	1.42	1.13	1.27	0.79	viable	New	"GTP-binding protein localized to the bud neck ring, involved in cytokinesis "	1.359	2.338																																														
rRNA processing	nucleolar protein 		M/G1	64	311	YCR018C	SRD1	SRD1	YPD	SGD	MIPS	1.07	1.00	1.04	0.96	1.14	1.21	1.17	0.85	viable	New	"Nucleolar protein involved in pre-rRNA processing, does not bind to small nucleolar RNA (snoRNA) "	1.533	-0.120	1	w 321 TGTGCCAGCGGT														1	c 343 cgcCGCGAAAgca																	1	w 321 TGTGCCAGCGGT											
H+ homeostasis	regulates plasma membrane H+-ATPase		G2/M	713	200	YCR024C-A	PMP1	PMP1	YPD	SGD	MIPS	1.97	2.95	2.41	0.41	1.13	2.45	1.66	1.66	viable	New	"Plasma membrane proteolipid, associated with Pma1p and affects plasma membrane H-ATPase activity"	5.073	1.564																																														
transcription	alpha-specific gene activator		G2/M	772	47	YCR040W	ALPHA1	ALPHA1	YPD	SGD	MIPS	1.51	1.10	1.29	0.77	1.26	1.01	1.12	0.90	undocumented	New	"Regulatory protein MATalpha1p, with Mcm1p activates alpha-specific genes (ALPHA1 and MATALPHA1 have the same coding sequence, but ALPHA1 is silenced)"	2.374	0.949	1	w 119 CCCAATGTAGAAAAGTACATCATATGAAACA																																												1
unknown	unknown		G2/M	781	68	YCR041W	YCR041W	YCR041W	YPD	SGD	MIPS	1.32	1.71	1.50	0.67	1.13	1.34	1.23	1.23	undocumented	New	Protein with unknown function 	3.531	0.813	1	w 588 CCCAATGTAGAAAAGTACATCATATGAAACA																								1	w 102 ggcACGCGgacaa																			1
transcription	TFIID associated factor (TAF)		G2/M	777	78	YCR042C	TSM1	TSM1	YPD	SGD	MIPS	1.62	1.28	1.44	0.69	1.32	1.90	1.59	1.59	lethal	New	Component of TAF(II) complex (TBP-associated protein complex); required for activated transcription by RNA polymerase II; required for G2/M phase progression	4.022	0.885																																														
transcription (putative)	forkhead family of DNA-binding proteins		G1	260	475	YCR065W	HCM1	HCM1	YPD	SGD	MIPS	3.30	2.27	2.74	2.74	1.51	1.49	1.50	0.67	viable	New	Dosage-dependent suppressor of cmd1 and member of the forkhead family of DNA-binding proteins	4.464	-1.299	7	w401 gaaCGCGAAAaaa	w369 cgaCGCGAAAaaa	w320 ataACGCGTtaa	w272 aaaACGCGTcct	w 402 ggaACGCGaaaaa	w 383 cagACGCGagaac	w 370 gcgACGCGaaaaa								2	w401 gaaCGCGAAAaaa	w369 cgaCGCGAAAaaa			2	w320 ataACGCGTtaa	w272 aaaACGCGTcct			3	w 402 ggaACGCGaaaaa	w 383 cagACGCGagaac	w 370 gcgACGCGaaaaa																	
protein folding	peptidyl-prolyl cis-trans isomerase		S/G2	551	245	YCR069W	SCC3	SCC3	YPD	SGD	MIPS	1.79	1.11	1.27	1.27	1.39	1.11	1.24	0.80	viable	New	"Cyclophilin (peptidylprolyl isomerase) of the endoplasmic reticulum membrane, homolog of ninaA "	1.628	2.872	1	c 618 ggcACGCGgtttc																								1	c 618 ggcACGCGgtttc																			
			G2/M	691	107	YCRX05W						2.18	1.02	1.46	0.68	1.15	1.53	1.33	1.33	irrelevant	New	?	1.660	1.691																																		1	w 538 ATAACCAGCAAT				1	w 538 ATAACCAGCAAT						
"mitosis, sister chromatid cohesion"	unknown		G1	255	539	YDL003W	MCD1	MCD1	YPD	SGD	MIPS	18.55	5.88	10.44	10.44	3.15	2.50	2.81	0.36	lethal	Known	"aka RHC21; Cohesin, protein required for mitotic chromatid cohesion"	9.610	-1.273	3	w204 aaaCGCGAAAcgc	w198 gaaACGCGTaac	w 205 aaaACGCGaaacg												1	w204 aaaCGCGAAAcgc				1	w198 gaaACGCGTaac				1	w 205 aaaACGCGaaacg																			
unknown	similar to Ybr014p and glutaredoxins		G1	214	508	YDL010W	YDL010W	YDL010W	YPD	SGD	MIPS	2.36	1.14	1.64	1.64	1.50	1.56	1.53	0.65	undocumented	New	Protein with similarity to Ybr014p and glutaredoxins 	1.526	-1.111	4	w136 gttCGCGAAAtcg	w167 atgACGCGTccc	w 176 ggaACGCGcatga	c 462 taaACGCGgatga											1	w136 gttCGCGAAAtcg				1	w167 atgACGCGTccc				2	w 176 ggaACGCGcatga	c 462 taaACGCGgatga																		
unknown	unknown		G1	242	507	YDL011C	YDL011C	YDL011C	YPD	SGD	MIPS	1.61	1.04	1.29	1.29	1.60	1.92	1.75	0.57	undocumented	New	novel; questionable ORF	1.436	-1.241																																		1	w 678 TGGACCAGCAAA				1	w 678 TGGACCAGCAAA						
membrane trafficking; secretion (putative)	unknown		G1	298	486	YDL018C	YDL018C	ERP3	YPD	SGD	MIPS	1.46	1.01	1.20	0.83	1.87	1.28	1.55	0.65	undocumented	New	Protein with similarity to Yal007p 	4.596	-1.445	3	w168 ccaACGCGTcct	w130 agaACGCGTtct	c 241 cctACGCGatcat																	2	w168 ccaACGCGTcct	w130 agaACGCGTtct			1	c 241 cctACGCGatcat																			
unknown	"similar to glucan 1,4-alpha-glucosidase"		G2/M	749	8	YDL037C	YDL037C	YDL037C	YPD	SGD	MIPS	1.14	1.72	1.40	0.71	1.20	1.67	1.18	0.85	undocumented	New	"Protein with similarity to glucan 1,4-alpha-glucosidase "	2.615	1.237										1	c 484 aggCACGAAAaaa															1	w 472 tacACGCGcacat																			
unknown	unknown		G2/M	746	7	YDL039C	YDL039C	YDL039C	YPD	SGD	MIPS	1.75	2.50	2.09	0.48	1.18	1.82	1.47	0.68	undocumented	New	Protein of unknown function 	2.295	1.268																																		1	w 656 TCAACCAGCCAA											
tRNA splicing	unknown		G2/M	681	43	YDL048C	STP4	STP4	YPD	SGD	MIPS	1.19	1.19	1.00	1.00	1.11	1.54	1.18	1.18	undocumented	New	Protein involved in tRNA splicing and branched-chain amino acid uptake 	1.314	1.752																																														
mannose metabolism	mannose-1-phosphate guanyltransferase		G1	410	787	YDL055C	PSA1	PSA1	YPD	SGD	MIPS	4.61	2.86	3.63	3.63	2.60	2.86	2.73	0.37	lethal	Known	"Mannose-1-phosphate guanyltransferase, GDP-mannose pyrophosphorylase"	6.980	-2.342	2	w 118 ttgACGCGccaaa	w 99 aatACGCGatatt																							2	w 118 ttgACGCGccaaa	w 99 aatACGCGatatt																		
unknown	unknown		M/G1	42	327	YDL089W	YDL089W	YDL089W	YPD	SGD	MIPS	1.35	1.11	1.10	1.10	1.29	1.14	1.21	0.83	undocumented	New	novel	1.660	0.099																1	c 400 acaCGCGAAAgtg									1	c 399 aacACGCGaaagt																			
protein glycosylation	dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase		G1	326	436	YDL093W	PMT5	PMT5	YPD	SGD	MIPS	3.21	1.18	1.95	1.95	1.36	1.22	1.29	0.78	undocumented	New	"Protein with similarity to O-mannosyltransferases Pmt1p, Pmt2p, Pmt3p, Pmt4p, and Pmt6p "	2.060	-1.571	1	w159 tgcCGCGAAAagt														1	w159 tgcCGCGAAAagt																													
protein glycosylation	dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase		G1	325	773	YDL095W	PMT1	PMT1	YPD	SGD	MIPS	3.92	2.33	3.02	3.02	1.77	1.20	1.46	0.68	viable	New	"Mannosyltransferase (dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase), first step in O-glycosylation; lots of PMT genes appear to be coregulated"	1.520	-1.571																																														
unknown	unknown		G1	352	553	YDL096C	YDL096C	YDL096C	YPD	SGD	MIPS	2.88	1.89	2.33	2.33	1.72	1.11	1.24	0.80	undocumented	New	novel; questionable ORF	2.148	-1.701																																		1	w 61 CACACCAGCATA											
DNA repair	DNA damage-responsive protein kinase		G1	320	474	YDL101C	DUN1	DUN1	YPD	SGD	MIPS	2.14	1.27	1.65	1.65	1.13	1.11	1.01	1.01	undocumented	New	Protein kinase necessary for induction of Rnr3p and DNA repair genes after DNA damage	3.290	-1.561	2	w166 gcgACGCGTttg	w 171 gtgACGCGACGCG																		1	w166 gcgACGCGTttg				1	w 171 gtgACGCGACGCG																			
DNA replication	DNA polymerase delta catalytic 125 KD subunit		G1	147	454	YDL102W	CDC2	CDC2	YPD	SGD	MIPS	1.56	1.82	1.69	1.69	1.38	1.52	1.45	0.69	lethal	Known	"aka POL3; DNA polymerase delta large subunit, has intrinsic 3'-5' exonuclease"	2.010	-0.709	1	w 453 TTTCCCGTTTAGGAAA														1	w 493 tgaCGCGAAAgtt				1	w 511 gtgACGCGTcac				2	w 494 atgACGCGaaagt	c 526 caaACGCGggtaa																		
unknown	unknown		G1	193	550	YDL103C	QRI1	QRI1	YPD	SGD	MIPS	2.85	1.51	2.07	2.07	1.22	1.28	1.25	0.80	lethal	New 	aka UAP1; UDP-N-acetylglucosamine pyrophosphorylase; involved in chitin synthesis	2.725	-0.998	1	w133 gttACGCGTaat																			1	w133 gttACGCGTaat																								
unknown	unknown		G1	186	440	YDL105W	QRI2	QRI2	YPD	SGD	MIPS	1.22	1.54	1.37	1.37	1.60	1.49	1.54	0.65	lethal	New	Protein of unknown function 	1.561	-0.955	2	w111 gcaACGCGTtaa	w 118 gaaACGCGcaacg																		1	w111 gcaACGCGTtaa				1	w 118 gaaACGCGcaacg																			
unknown	unknown		M/G1	26	282	YDL117W	YDL117W	YDL117W	YPD	SGD	MIPS	1.15	1.02	1.08	0.92	1.60	1.28	1.43	0.70	undocumented	New	low similiarity to SRP40	5.967	0.286	1	C 451 CAAACCAGCCAT																																1	C 451 CAAACCAGCCAT											
cell cycle	G1/S cyclin		G1	141	566	YDL127W	PCL2	PCL2	YPD	SGD	MIPS	3.82	1.60	2.47	2.47	1.68	1.54	1.61	0.62	viable	Known	"Cyclin, found partly in association with Pho85p "	6.332	-0.672	7	w158 aatCGCGAAAaga	c454 caaCGCGAAAatg	c468 ccaCGCGAAAaga	c502 caaCGCGAAAaat	c 453 ccaACGCGaaaat	c 467 accACGCGaaaag	c 501 acaACGCGaaaaa								4	w158 aatCGCGAAAaga	c454 caaCGCGAAAatg	c468 ccaCGCGAAAaga	c502 caaCGCGAAAaat						3	c 453 ccaACGCGaaaat	c 467 accACGCGaaaag	c 501 acaACGCGaaaaa																	
transport	vacuolar H+/Ca(2+) exchanger		G2/M	775	204	YDL128W	VCX1	VCX1	YPD	SGD	MIPS	1.14	1.52	1.31	0.76	1.12	1.57	1.18	1.18	viable	New	Calcium transport (H+/Ca++ exchange) protein of the vacuolar membrane 	1.551	0.917																																														
transport	glucose permease		G2/M	787	64	YDL138W	RGT2	RGT2	YPD	SGD	MIPS	1.38	1.38	1.38	0.72	1.42	1.20	1.09	0.92	undocumented	New	"Glucose transporter responsible for induction of gene expression in the presence of high glucose, member of the sugar permease family "	2.069	0.756																																																	
unknown	unknown		G1	156	441	YDL156W	YDL156W	YDL156W	YPD	SGD	MIPS	1.26	1.73	1.48	1.48	1.77	1.22	1.47	0.68	undocumented	New	weak similarity to Pas7p	1.720	-0.763	1	w193 attACGCGTttt																			1	w193 attACGCGTttt																											
unknown	unknown		G1	373	606	YDL157C	YDL157C	YDL157C	YPD	SGD	MIPS	1.94	1.26	1.56	1.56	1.48	1.69	1.58	0.63	undocumented	New	novel	1.995	-1.899	1	w148 aaaACGCGTaat																			1	w148 aaaACGCGTaat																											
unknown	unknown		G1	188	515	YDL163W	YDL163W	YDL163W	YPD	SGD	MIPS	2.16	2.61	2.37	2.37	1.54	1.33	1.43	0.70	undocumented	New	novel; questionable ORF	2.562	-0.970																																																	
DNA replication and repair	DNA ligase		G1	159	516	YDL164C	CDC9	CDC9	YPD	SGD	MIPS	3.12	2.66	2.88	2.88	1.57	1.19	1.37	0.73	undocumented	Known	DNA ligase; level of mRNA is cell-cycle regulated and reaches maximum near the G1/S boundary	2.940	-0.776	4	w440 tttCACGAAAaaa	w183 ctaACGCGTtta	w131 gcgACGCGTaac	w 136 gaaACGCGACGCG					1	w440 tttCACGAAAaaa										2	w183 ctaACGCGTtta	w131 gcgACGCGTaac			1	w 136 gaaACGCGACGCG							1	c 340 CTTACCAGCCGG									1	c 387 TTTCCCTTTTAGGAAA				
unknown	unknown		M/G1	98	318	YDL169C	UGX2	UGX2	YPD	SGD	MIPS	1.51	1.05	1.20	0.83	1.33	1.15	1.24	0.81	undocumented	New	Protein of unknown function 	1.652	-0.413	1	w 57 AGTACCAGCGTT																																1	w 57 AGTACCAGCGTT														
cell cycle	cyclin (Pho85p)		M/G1	4	269	YDL179W	PCL9	PCL9	YPD	SGD	MIPS	1.90	1.10	1.45	0.69	1.04	1.61	1.30	0.77	viable	Known	Pho85 cyclin	3.296	0.526	3	w 328 GAAACCAGCGTC	w 328 GAAACCAGCGTC	w 284 AAAACCAGCTCA																														2	w 328 GAAACCAGCGTC	w 284 AAAACCAGCTCA			1	w 328 GAAACCAGCGTC									
unknown	unknown		G2/M	699	157	YDL180W	YDL180W	YDL180W	YPD	SGD	MIPS	1.86	1.10	1.30	1.30	1.50	1.11	1.16	0.86	undocumented	New	Protein of unknown function 	1.383	1.631																																																	
transcription	anti-silencing protein		G1	195	509	YDL197C	ASF2	ASF2	YPD	SGD	MIPS	2.17	1.58	1.85	1.85	1.74	2.00	1.86	0.54	viable	Known	Anti-silencing protein that causes depression of silent loci when overexpressed	1.714	-1.005	2	w183 acgACGCGTatt	w153 ctaACGCGTttt																		2	w183 acgACGCGTatt	w153 ctaACGCGTttt																										c 499 AAAAATGCGGGG
unknown	unknown		G1	367	467	YDL211C	YDL211C	YDL211C	YPD	SGD	MIPS	1.67	1.41	1.53	1.53	1.74	1.41	1.57	0.64	undocumented	New	similarity to hypothetical protein YNL176c	2.957	-1.835	2	c160 tgaCGCGAAAtct	c 159 ctgACGCGaaatc													1	c160 tgaCGCGAAAtct									1	c 159 ctgACGCGaaatc																						
homothallic switching endonuclease			G1	220	414	YDL227C	HO	HO	YPD	SGD	MIPS	1.42	1.47	1.44	1.44	1.41	1.13	1.26	0.79	viable	Known	"Homothallic switching endonuclease, initiates mating type interconversion by making a double-stranded break in the expressed MAT gene "	2.861	-1.137	3	w301 tcgCGCGAAAaaa	c306 tcgCGCGAAAaga	w236 attACGCGTcgt												2	w301 tcgCGCGAAAaaa	c306 tcgCGCGAAAaga			1	w236 attACGCGTcgt																											
trehalose metabolism	"alpha,alpha-trehalase"		G1	151	25	YDR001C	NTH1	YDR001C	YPD	SGD	MIPS	1.42	1.02	1.18	1.18	1.02	1.33	1.16	0.86	viable	New	"Neutral trehalase (alpha, alpha-trehalase)"	1.391	-0.726	1	c 424 agtACGCGgaaaa																								1	c 424 agtACGCGgaaaa																						
4-nitroquinoline-N-oxide resistance	putative ATP-dependent permease		S/G2	579	186	YDR011W	SNQ2	SNQ2	YPD	SGD	MIPS	1.14	1.50	1.31	1.31	1.81	1.02	1.36	0.74	viable	New	Multidrug resistance protein of the ATP-binding cassette (ABC) superfamily 	1.560	2.506																																																	
unknown	unknown		S/G2	592	616	YDR029W	YDR029W	YDR029W	YPD	SGD	MIPS	1.06	1.75	1.36	1.36	1.50	1.48	1.49	0.67	undocumented	New	Protein of unknown function 	1.333	2.426																																																	
unknown	similar to Yro2p		G2/M	751	92	YDR033W	YDR033W	YDR033W	YPD	SGD	MIPS	5.74	4.09	4.85	0.21	11.13	6.23	8.33	8.33	undocumented	Known	High similarity to YRO2 (see above)	11.640	1.208																																																w 436 AAAATACCGGGG	
unknown	unknown		G1	278	605	YDR053W	YDR053W	YDR053W	YPD	SGD	MIPS	2.25	1.52	1.85	1.85	1.62	1.39	1.50	0.67	undocumented	New	novel; questionable ORF	1.317	-1.366	1	w 594 actACGCGcttat																								1	w 594 actACGCGcttat																				w 112 CCCTATTTGGTTGCAATTCAATTCCGTGAAACC		
unknown	similar to members of the Sps2p-Ecm33p-Ycl048p		M/G1	32	265	YDR055W	YDR055W	PTS1	YPD	SGD	MIPS	3.69	4.67	4.15	0.24	1.03	1.55	1.26	0.79	undocumented	New	"similar to ECM33, which is involved in cell wall metabolism in some manner"	7.266	0.176																																																
unknown	putative cell surface glycoprotein		G2/M	800	67	YDR077W	SED1	SED1	YPD	SGD	MIPS	2.46	4.17	3.20	0.31	1.11	1.19	1.04	0.97	viable	Known	"Abundant cell surface glycoprotein, overexpression suppresses growth defect of erd2 "	3.256	0.565																																		1	w 47 GACACCAGCGAG													
mating	"cytoskeletal protein, similar to arrestins"		M/G1	63	315	YDR085C	AFR1	AFR1	YPD	SGD	MIPS	2.85	1.37	1.97	0.51	1.45	1.23	1.34	1.34	viable	New	Protein involved in morphogenesis of the mating projection (shmoo)	2.633	-0.110																																																
unknown	unknown		S/G2	574	676	YDR089W	YDR089W	YDR089W	YPD	SGD	MIPS	1.69	1.43	1.56	1.56	2.02	1.09	1.48	1.48	undocumented	New	"novel, with leucine zipper"	2.779	2.542																																																
DNA repair	MutS homolog; mismatch repair		G1	227	532	YDR097C	MSH6	MSH6	YPD	SGD	MIPS	3.82	3.17	3.48	3.48	1.54	1.25	1.39	0.72	viable	Known	"Component with Msh2p of DNA mismatch binding factor, involved in repair of single base mismatches"	8.874	-1.163	3	w260 aaaCGCGAAAtat	w 261 caaACGCGaaata	c 297 ttgACGCGaatta												1	w260 aaaCGCGAAAtat									2	w 261 caaACGCGaaata	c 297 ttgACGCGaatta																				
cell cycle	anaphase inhibitor (putative)		G1	396	752	YDR113C	PDS1	PDS1	YPD	SGD	MIPS	4.28	1.60	2.62	2.62	1.14	1.79	1.43	0.70	viable	New	Protein that may regulate sister chromatid separation in mitosis	6.298	-2.148	1	w187 caaACGCGTcaa																			1	w187 caaACGCGTcaa												1	c 588 TCTGCCAGCCTC													
unknown	unknown		S/G2	542	672	YDR130C	YDR130C	YDR130C	YPD	SGD	MIPS	1.90	1.08	1.33	1.33	1.26	1.49	1.37	1.37	undocumented	New	"weak similarity to sea urchin myosin heavy chain, has possible coiled-coil region "	2.892	2.970																																																
protein degradation	periplasmic aspartyl protease		G1	274	729	YDR144C	YPS2	MKC7	YPD	SGD	MIPS	2.05	1.85	1.95	1.95	1.80	1.01	1.35	0.74	viable	New	"Aspartyl protease of the periplasmic space, has similarity to Yap3p and Bar1p"	1.369	-1.363	2	w273 tacACGCGTttt	c 488 tatACGCGgcgaa																		1	w273 tacACGCGTttt				1	c 488 tatACGCGgcgaa																					c 633 AAACATGTGGGG
cell cycle	"transcription factor, regulates HO"		G2/M	668	237	YDR146C	SWI5	SWI5	YPD	SGD	MIPS	1.18	1.43	1.10	1.10	4.84	4.21	4.51	4.51	viable	Known	transcription factor for M/G1 regulated genes	6.726	1.866	1	GTACTTTAACCTGTTTAGGAAAAAG  GTAAACAATAACA																														1	GTACTTTAACCTGTTTAGGAAAAAG  GTAAACAATAACA															
unknown	unknown		S/G2	570	697	YDR149C		YDR149C		SGD	MIPS	1.08	2.77	1.73	1.73	1.04	1.19	1.07	0.94	undocumented	New	questionable ORF	2.562	2.588	1	w 536 gtaACGCGatcat																								1	w 536 gtaACGCGatcat																					
"mitosis, nuclear migration"	unknown		S/G2	605	207	YDR150W	NUM1	NUM1	YPD	SGD	MIPS	1.08	1.49	1.17	1.17	1.37	1.27	1.04	0.96	viable	Known	"Nuclear migration protein, controls interaction of bud-neck cytoskeleton with G2 nucleus"	2.306	2.309																					1	w 585 agtACGCGTcgc																										
unknown	unknown		M/G1	20	5	YDR157W	YDR157W	YDR157W	YPD	SGD	MIPS	1.35	1.27	1.31	0.76	3.55	1.08	1.81	0.55	undocumented	New	questionable ORF	1.316	0.308	1	w 190 AACACCAGCCTC																								2	w 216 ctgACGCGgacgc	c 700 tccACGCGcttcc						1	w 190 AACACCAGCCTC													
unknown	unknown		G2/M	779	98	YDR190C	YDR190C	YDR190C	YPD	SGD	MIPS	1.12	1.56	1.18	0.85	1.04	1.91	1.41	1.41	undocumented	New	"Protein of unknown function, has an ATP/GTP binding motif "	1.347	0.821																																		1	w 668 TATACCAGCGGC													c 304 AAATCGCCGGGG
silencing (telomere)	similar to nuclear lamins		M/G1	24	76	YDR191W	HST4	HST4	YPD	SGD	MIPS	1.71	1.27	1.47	0.68	2.00	1.46	1.71	1.71	viable	New	Protein with similarity to Sir2p 	5.955	0.293	1	w 581 ACCACCAGCTAA																																1	w 581 ACCACCAGCTAA													
chromatin structure	histone H2B		S	432	794	YDR224C	HTB1	HTB1	YPD	SGD	MIPS	3.16	1.91	2.46	2.46	1.65	1.16	1.39	0.72	viable	Known	Histone H2B (HTB1 and HTB2 code for nearly identical proteins)	10.380	-2.492	4	c 425 gggCGCGAAAtgc	w 402 gagACGCGaagct	c 147 gcaACGCGagaga	c 294 ttcACGCGcttaa											1	c 425 gggCGCGAAAtgc									3	w 402 gagACGCGaagct	c 147 gcaACGCGagaga	c 294 ttcACGCGcttaa																			
chromatin structure	histone H2A		S	437	796	YDR225W	HTA1	HTA1	YPD	SGD	MIPS	2.69	2.78	2.73	2.73	1.32	1.32	1.32	0.76	viable	Known	Histone H2A (HTA1 and HTA2 code for identical proteins)	10.680	-2.534	1	w 341 agaACGCGgtttc																								1	w 341 agaACGCGgtttc																					
unknown	putative protein kinase		S	466	698	YDR247W	YDR247W	YDR247W	YPD	SGD	MIPS									undocumented	New	Serine/threonine protein kinase with similarity to S. pombe RAN1 negative regulator of sexual conjugation and meiosis (GB:Z49701)	2.096	-2.823	1	c 531 cggACGCGgacc																								1	c 531 cggACGCGgacc																					
cell wall biogenesis	"exo-beta-1,3-glucanase"		S	456	782	YDR261C	EXG2	EXG2	YPD	SGD	MIPS	3.87	2.23	2.94	2.94	1.33	1.43	1.38	0.73	undocumented	New	"Exo-beta-1,3-glucanase (beta-1,3-D-glucanglucanohydrolase), minor isoform"	1.932	-2.705	2	w 163 tccCGCGAAAaaa	c 59 agaACGCGctaaa													1	w 163 tccCGCGAAAaaa									1	c 59 agaACGCGctaaa																					
unknown	unknown		G2/M	670	115	YDR276C	YDR276C	YDR276C	YPD	SGD	MIPS	1.36	1.45	1.41	0.71	1.44	1.07	1.16	0.86	undocumented	New	Abundant protein of unknown function 	1.314	1.845																										1	c 457 attACGCGcacgg																					
unknown	unknown		G1	305	468	YDR279W	YDR279W	YDR279W	YPD	SGD	MIPS	1.94	1.56	1.74	1.74	1.98	1.11	1.48	0.67	undocumented	New	novel	2.199	-1.476	2	c432 attCACGAAAgaa	w193 acaACGCGTttt							1	c432 attCACGAAAgaa										1	w193 acaACGCGTttt																										
sphingolipid metabolism	hydroxylase		G1	392	780	YDR297W	SUR2	SUR2	YPD	SGD	MIPS	5.41	3.40	4.29	4.29	2.12	1.61	1.85	0.54	viable	New	Hydroxylase involved in sphingolipid metabolism	2.471	-2.111	3	c149 aaaCACGAAAcga	w433 gaaACGCGTttt	c 329 aggACGCGgggtg						1	c149 aaaCACGAAAcga										1	w433 gaaACGCGTttt				1	c 329 aggACGCGgggtg																					
unknown	similar to GPI-anchor biosynthesis protein PIG-F		S/G2	522	706	YDR302W	YDR302W	YDR302W	YPD	SGD	MIPS	1.23	1.14	1.18	0.85	1.94	1.16	1.50	0.67	undocumented	New	Protein with similarity to GPI-anchor biosynthesis protein PIG-F 	1.953	3.082	1	w 153 gtaACGCGgggat																								1	w 153 gtaACGCGgggat																					
unknown	similar to Pmt1p		G1	235	555	YDR307W	YDR307W	YDR307W	YPD	SGD	MIPS	2.84	1.60	2.13	2.13	1.10	1.34	1.10	0.91	undocumented	New	Protein with similarity to Pmt1p 	1.464	-1.208																																																
bud emergence	binds Cdc42p		G1	119	561	YDR309C	GIC2	GIC2	YPD	SGD	MIPS	6.26	1.51	3.07	3.07	1.90	1.96	1.93	0.52	viable	Known	"Putative effector of Cdc42p, important for bud emergence"	4.287	-0.547	2	c140 agaCACGAAAcaa	w392 aagACGCGTtct							1	c140 agaCACGAAAcaa										1	w392 aagACGCGTtct																						1	w 378 TTTCCCTAATAGGAAA			
protein synthesis	"ribosomal protein, mitochondrial S28"		G2/M	789	62	YDR337W	MRPS28	MRPS28	YPD	SGD	MIPS	1.01	1.45	1.20	0.83	1.08	1.37	1.22	0.82	viable	New	Mitochondrial ribosomal protein of the small subunit (E. coli S15) 	1.699	0.690																																		1	w 190 TCAACCAGCTTT													
transport	hexose permease		M/G1	23	12	YDR342C	HXT7	HXT7	YPD	SGD	MIPS	3.90	1.85	2.69	0.37	1.91	1.52	1.71	0.59	viable	New	"High-affinity hexose transporter, member of the sugar permease family (HXT6 and HXT7 genes differ by 2 base pairs) "	1.465	0.301																																																
unknown	unknown		S/G2	576	663	YDR346C	YDR346C	YDR346C	YPD	SGD	MIPS	1.40	1.16	1.10	1.10	1.55	1.07	1.20	0.83	undocumented	New	has similarity to YDR222W and YLR225C	1.509	2.521																																		1	c 222 TCAACCAGCTGT													c 634 AAACATGTGGGG
pyrimidine biosynthesis	thioredoxin reductase		G1	346	385	YDR353W	TRR1	TRR1	YPD	SGD	MIPS	1.14	1.04	1.04	1.04	1.15	1.06	1.04	0.96	viable	New	Thioredoxin reductase 	2.147	-1.651	1	w139 cccACGCGTata																			1	w139 cccACGCGTata																										
unknown	unknown		S	425	797	YDR355C	YDR355C	YDR355C	YPD	SGD	MIPS	1.19	1.80	1.46	1.46	1.49	1.08	1.27	0.79	undocumented	New	Protein of unknown function 	3.671	-2.428																																																
cytoskeleton	spindle pole body component		G1	406	722	YDR356W	NUF1	NUF1	YPD	SGD	MIPS	1.16	2.26	1.62	1.62	1.61	1.10	1.21	0.83	lethal	Known	"aka SPC110; Spindle pole body component with coiled-coil structure, determines the spacing between the ends of microtubules and the central plaque "	3.005	-2.257																																																
unknown	similar to aldo-keto reductases		G1	148	341	YDR368W	YPR1	YPR1	YPD	SGD	MIPS	1.31	1.45	1.38	1.38	1.25	1.35	1.30	1.30	undocumented	New	Protein with similarity to members of the aldo/keto reductase family 	1.385	-0.711																																																
unknown	"similar to pyruvate decarboxylase, pyruvate"		G2/M	771	130	YDR380W	YDR380W	YDR380W	YPD	SGD	MIPS	1.89	1.78	1.03	0.97	1.09	1.00	1.04	0.96	undocumented	New	"Protein with similarity to pyruvate decarboxylase, pyruvate oxidase, acetolactate synthase (large subunit), and other enzymes that require thiamine pyrophosphate "	1.697	0.953																										1	w 55 ttgACGCGacttc																					
unknown	similar to E. coli protein		G1	335	472	YDR400W	YDR400W	YDR400W	YPD	SGD	MIPS	3.59	1.11	2.00	2.00	1.91	1.10	1.32	0.76	undocumented	New	similarity to C. fasciculata inosine-uridine preferring nucleoside hydrolase	2.451	-1.601	1	w 39 gtaACGCGatatt																								1	w 39 gtaACGCGatatt																				
mRNA export; protein import	nuclear shuttling protein		G2/M	698	111	YDR432W	NPL3	NPL3	YPD	SGD	MIPS	1.05	1.28	1.16	0.86	1.62	1.18	1.38	0.72	lethal	New	"Protein involved in 18S and 25S rRNA processing, export of RNA from the nucleus, import of proteins into the nucleus, and associated with U1 snRNP, has 2 RNA recognition (RRM) domains "	1.469	1.631																																															
"meiosis, checkpoint; transcriptional silencing "	unknown		G1	267	383	YDR440W	PCH1	DOT1	YPD	SGD	MIPS	1.82	1.07	1.30	0.77	1.83	1.21	1.23	0.81	viable	New	Protein required for cell cycle arrest at the pachytene stage of meiosis in a zip1 mutant 	2.045	-1.316	1	w176 cgcACGCGTcaa																			1	w176 cgcACGCGTcaa																									
chromatin structure	histone acetyltransferase complex subunit		S	470	658	YDR448W	ADA2	ADA2	YPD	SGD	MIPS	1.10	1.54	1.18	1.18	1.42	1.42	1.00	1.00	viable	New	Component of the nucleosomal histone acetyltransferase (Spt-Ada-Gcn5-Acetyltransferase or SAGA) complex 	1.465	-2.867	1	c 300 aagACGCGcattg																								1	c 300 aagACGCGcattg							1	c 632 GGGACCAGCAGG				1	c 632 GGGACCAGCAGG							
unknown	"similar to Yox1p, which binds Leu-tRNA (SP:P34161)"		S	469	734	YDR451C	YDR451C	YDR451C	YPD	SGD	MIPS	3.06	1.24	1.95	1.95	2.34	1.47	1.86	0.54	undocumented	New	Protein with similarity to Yox1p	3.066	-2.855	2	w 313 atgACGCGcgcca	w 279 cagACGCGctttc																							2	w 313 atgACGCGcgcca	w 279 cagACGCGctttc						1	w 68 CTCGCCAGCCAG												w 224 CCCAAAAAGGAAATTTACATGTTAAATGAAACC
mating	a-factor precursor		G1	333	3	YDR461W	MFA1	MFA1	YPD	SGD	MIPS	5.07	1.32	2.58	0.39	1.61	1.43	1.06	1.06	viable	New	"Mating pheromone a-factor, exported from cell by Ste6p "	1.440	-1.601																																															
phosphate metabolism	vacuolar alkaline phosphatase		G1	163	554	YDR481C	PHO8	PHO8	YPD	SGD	MIPS	4.09	1.03	1.99	1.99	1.31	2.22	1.30	0.77	undocumented	New	"Alkaline phosphatase (ALP), repressible (vacuolar), carries out dephosphorylation of phosphopeptides "	2.677	-0.792	4	c90 gagCACGAAAaaa	w 18 tgaACGCGcatta	c 158 tctACGCGcgaag	c 220 tagACGCGcctta					1	c90 gagCACGAAAaaa															3	w 18 tgaACGCGcatta	c 158 tctACGCGcgaag	c 220 tagACGCGcctta					2	w 447 AAGGCCAGCCAT	w 72 TTTGCCAGCAAG											
unknown	unknown		G1	386	721	YDR488C	PAC11	PAC11	YPD	SGD	MIPS	1.19	1.42	1.09	1.09	1.53	1.10	1.30	0.77	viable	New	"Protein with similarity to rat dynein intermediate chain, required in the absence of Cin8p "	1.963	-2.052	1	c95 aaaCACGAAAact								1	c95 aaaCACGAAAact																																				
unknown	unknown		M/G1	22	299	YDR493W	YDR493W	YDR493W	YPD	SGD	MIPS	1.58	1.37	1.47	0.68	1.21	1.56	1.38	0.73	undocumented	New	Protein of unknown function 	1.764	0.302																																															
unknown	unknown		G1	341	416	YDR501W	YDR501W	YDR501W	YPD	SGD	MIPS	1.21	1.07	1.14	1.14	1.20	1.16	1.18	0.85	undocumented	New	similarity to hypothetical protein YLR183c	2.864	-1.621	3	c220 aaaCGCGAAAaaa	w 235 caaACGCGataat	c 219 caaACGCGaaaaa												1	c220 aaaCGCGAAAaaa									2	w 235 caaACGCGataat	c 219 caaACGCGaaaaa																			
phospholipid metabolism	lipid phosphate phosphatase		G1	247	487	YDR503C	LPP1	LPP1	YPD	SGD	MIPS	1.36	1.22	1.29	1.29	1.04	1.18	1.11	0.90	undocumented	New	Lipid phosphate phosphatase 	3.537	-1.250	1	w163 ttcACGCGTaag																			1	w163 ttcACGCGTaag																									
cell cycle (growth inhibitor)	protein kinase		G1	157	446	YDR507C	GIN4	GIN4	YPD	SGD	MIPS	4.83	1.18	2.03	2.03	2.41	1.10	1.63	0.61	viable	New	"Serine/threonine-protein kinase with similarity to Ycl024p, growth inhibitory protein"	2.671	-0.766	3	w252 catCGCGAAAtat	w313 gaaACGCGTcaa	w 290 actACGCGcaatc												1	w252 catCGCGAAAtat				1	w313 gaaACGCGTcaa				1	w 290 actACGCGcaatc																				
unknown	unknown		G1	178	403	YDR528W	YDR528W	YDR528W	YPD	SGD	MIPS	1.50	1.82	1.10	0.91	1.23	1.16	1.03	0.97	undocumented	New	"has similarity to LRE1, a protein involved in laminarinase resistance "	3.035	-0.912	1	w476 ttcACGCGTgct																			1	w476 ttcACGCGTgct																									
unknown	similar to subtelomerically-encoded proteins		M/G1	47	600	YDR545W	YDR545W	YDR545W	YPD	SGD	MIPS	2.11	1.10	1.52	1.52	1.14	1.40	1.11	1.11	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	1.567	0.038																										1	w 590 ctgACGCGccata																				
unknown	unknown		S/G2	529	680	YEL017W	YEL017W	YEL017W	YPD	SGD	MIPS	2.05	1.09	1.37	1.37	1.15	1.01	1.07	1.07	viable	New	Protein of unknown function 	2.650	3.053																																															
unknown	unknown		G2/M	740	185	YEL025C	YEL025C	YEL025C	YPD	SGD	MIPS	1.09	1.01	1.04	0.96	1.01	1.12	1.05	0.95	viable	New	Protein of unknown function 	1.527	1.322																										1	w 157 tgaACGCGcttg																				
DNA replication	MCM initiator complex		M/G1	5	72	YEL032W	MCM3	MCM3	YPD	SGD	MIPS	2.41	1.02	1.54	0.65	1.49	1.15	1.14	1.14	lethal	New	Member of the MCM/P1 family that acts at ARS elements to initiate replication 	5.661	0.521	1	c 185 TTACCCATTTAGGAAA																																														c 627 TATCTCCCGGGG
unknown	unknown		M/G1	43	560	YEL040W	UTR2	UTR2	YPD	SGD	MIPS	2.72	1.48	2.01	2.01	1.48	1.27	1.08	0.93	viable	New	protein with similarity to YLR213C and YGR189C both of which have unknown functions	2.073	0.096																1	w 240 aagCGCGAAAatt									1	c 415 caaACGCGcatga																					
Golgi organization	Golgi membrane guanosine diphosphatase		S	481	760	YEL042W	GDA1	GDA1	YPD	SGD	MIPS	2.92	1.32	1.96	1.96	1.48	1.10	1.16	0.86	viable	New	converts GDP released from GDP-mannose to GMP which is returned to cytoplasm by an antiporter	1.920	-2.970																																																
unknown	putative fumarate reductase		G1	372	750	YEL047C	YEL047C	YEL047C	YPD	SGD	MIPS	4.89	1.29	2.51	2.51	1.22	1.32	1.04	0.96	viable	New	Cytoplasmic soluble fumarate reductase 	2.425	-1.889	2	w 126 gcaACGCGTcgc	c 121 ggaACGCGacgc																		1	w 126 gcaACGCGTcgc				1	c 121 ggaACGCGacgc																			1		
protein degradation	vacuolar protease B		S	453	352	YEL060C	PRB1	PRB1	YPD	SGD	MIPS	1.27	1.28	1.01	0.99	1.61	1.31	1.11	0.90	viable	New	"Protease B (yscB) (PrB) (cerevisin), serine protease of the subtilisin family with broad proteolytic specificity "	1.512	-2.646																																																
"mitosis, spindle maintenance"	kinesin related protein		S	414	732	YEL061C	CIN8	CIN8	YPD	SGD	MIPS	1.89	1.22	1.52	1.52	2.11	1.12	1.54	0.65	viable	New	Kinesin-related protein involved in establishment and maintenance of mitotic spindle 	2.368	-2.363	3	c 127 acaCACGAAAacg	w 98 gtaCGCGAAAtaa	w 99 ggtACGCGaaata						1	c 127 acaCACGAAAacg					1	w 98 gtaCGCGAAAtaa									1	w 99 ggtACGCGaaata																					w 506 ATCAAAGTGGGG
unknown	similar to members of the major facilitator		G1	225	384	YEL064C	YEL064C	YEL064C	YPD	SGD	MIPS	1.20	1.16	1.18	0.85	1.79	1.02	1.35	0.74	viable	New	Protein with similarity to members of the major facilitator superfamily (MFS) 	1.459	-1.160																																																
unknown	"similar to hexose transporters, member of"		G2/M	712	193	YEL065W	YEL065W	YEL065W	YPD	SGD	MIPS	2.03	1.29	1.25	0.80	1.04	1.25	1.14	1.14	viable	New	Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 	3.458	1.571																										1	w 634 tgaACGCGcaag																					
unknown	unknown		S	447	377	YEL068C	YEL068C	YEL068C	YPD	SGD	MIPS	1.30	1.63	1.12	1.12	1.21	1.01	1.10	0.91	viable	New	Protein of unknown function 	5.047	-2.593																																																
unknown	similar to other subtelomerically-encoded proteins		G1	120	569	YEL075C	YEL075C	YEL075C	YPD	SGD	MIPS	1.40	1.04	1.16	1.16	1.21	1.15	1.18	0.85	undocumented	New	"Protein with similarity to other subtelomerically-encoded proteins including Yhl049p, Yil177p, and Yjl225p "	4.200	-0.549	1	w 544 ctgACGCGccat																								1	w 544 ctgACGCGccat																					
unknown	similar to other subtelomerically-encoded proteins		G1	118	570	YEL076C	YEL076C	YEL076C	YPD	SGD	MIPS	1.55	1.35	1.07	1.07	1.41	1.01	1.18	0.85	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins 	4.076	-0.538	1	w 151 tgtCACGAAAtag								1	w 151 tgtCACGAAAtag																																					
unknown	unknown		G1	184	578	YEL076C-A	YEL076CA	YEL076C-A	YPD	SGD										undocumented	New	Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins)	3.149	-0.951	1	w 151 tgtCACGAAAtag								1	w 151 tgtCACGAAAtag																																					
protein glycosylation	"alpha-1,3-mannosyltransferase"		G1	359	471	YER001W	MNN1	MNN1	YPD	SGD	MIPS	7.10	1.39	2.26	2.26	3.57	1.11	1.99	0.50	viable	Known	"Alpha-1,3-mannosyltransferase, required for complex glycosylation of both N- and O-oligosaccharides"	7.599	-1.762	3	w50 gaaCGCGAAAaga	w36 aagACGCGTctc	w 51 agaACGCGaaaag												1	w50 gaaCGCGAAAaga				1	w36 aagACGCGTctc				1	w 51 agaACGCGaaaag																					
mannose metabolism	mannose-6-phosphate isomerase		S	451	786	YER003C	PMI40	PMI40	YPD	SGD	MIPS	5.86	1.43	2.02	2.02	2.09	1.06	1.49	0.67	lethal	New	"Mannose-6-phosphate isomerase, generates mannose-6-phosphate for synthesis of GDP-mannose and dolichol-phosphate-mannose "	3.868	-2.629	3	c 181 cagCACGAAAtgg	c 148 cggACGCGacaaa	c 559 tatACGCGatctt						1	c 181 cagCACGAAAtgg															2	c 148 cggACGCGacaaa	c 559 tatACGCGatctt																				
cytoskeleton	microtubule binding protein		G1	371	608	YER016W	BIM1	BIM1	YPD	SGD	MIPS	2.37	1.24	1.71	1.71	1.98	1.14	1.32	0.76	viable	New	Protein with affect on microtubule structure 	2.001	-1.889	2	w123 actACGCGTttg	w 131 ctaACGCGactac																		1	w123 actACGCGTttg				1	w 131 ctaACGCGactac																					
cytoskeleton	spindle pole body component		S/G2	496	627	YER018C	YER018C	SPC25	YPD	SGD	MIPS	1.80	1.26	1.20	0.84	1.80	1.01	1.35	0.74	lethal	New	Protein of unknown function 	2.317	-3.061	1	w 152 tttACGCGgaaa																								1	w 152 tttACGCGgaaa																					
unknown	similar to mammalian neutral		G1	403	630	YER019W	YER019W	YER019W	YPD	SGD	MIPS	1.18	1.20	1.01	0.99	1.24	1.30	1.27	0.79	viable	New	"Protein with weak similarity to mammalian neutral sphingomyelinases, has motifs typical of ATP/GTP-binding sites "	2.330	-2.234	3	c 32 tttACGCGgaaa	c 272 accACGCGcgcc	c 549 attACGCGcacg																						3	c 32 tttACGCGgaaa	c 272 accACGCGcgcc	c 549 attACGCGcacg										2	c 184 ATGGCCAGCATA	c 637 GGAGCCAGCGAT							
mRNA 3'-end processing	unknown		S/G2	520	699	YER032W	FIR1	FIR1	YPD	SGD	MIPS	1.00	1.18	1.09	0.92	1.70	1.08	1.25	0.80	viable	New	"Protein that interacts with Pap1p and Ref2p, probably involved in 3'-mRNA processing"	2.963	3.093																																		1	c 137 TAGGCCAGCAAA				1	c 137 TAGGCCAGCAAA								
oxidative stress response	peptide-methionine sulfoxide reductase		S/G2	518	639	YER042W	YER042W	MXR1	YPD	SGD	MIPS	1.30	1.18	1.05	1.05	1.42	1.10	1.14	0.88	viable	New	Peptide-methionine sulfoxide reductase involved in cellular antioxidation 	2.851	3.105																																																
DNA replication	ribonucleotide reductase		G1	179	514	YER070W	RNR1	RNR1	YPD	SGD	MIPS	8.04	1.71	3.71	3.71	6.05	1.08	2.55	0.39	lethal	Known	ribonucleotide reductase; regulated through a Mlu1 cell cycle box (MCB) element	4.600	-0.927	2	w123 gaaACGCGTtag	w111 gaaACGCGTtct																		2	w123 gaaACGCGTtag	w111 gaaACGCGTtct											2	c 391 CATACCAGCTAG	c 685 TGGGCCAGCCTG												
methionine biosynthesis	homocysteine methyltransferase		S	457	656	YER091C	MET6	MET6	YPD	SGD	MIPS	2.64	1.43	1.94	1.94	1.53	1.74	1.07	1.07	viable	New	"Homocysteine methyltransferase (5-methyltetrahydropteroyl triglutamate--homocysteine methyltransferase), methionine synthase, cobalamin-independent "	2.956	-2.705																																																c 578 ATTAGAGCGGGG
DNA repair and recombination	recombinase		G1	303	482	YER095W	RAD51	RAD51	YPD	SGD	MIPS	1.50	4.51	2.61	2.61	1.44	1.41	1.42	0.70	viable	Known	"Protein required for recombination and repair of X-ray damage, required with Dmc1p to establish interhomolog connections at meiotic recombination nodules"	6.028	-1.473	1	w118 agaACGCGTaag																			1	w118 agaACGCGTaag																										
cell cycle	transcription factor		M/G1	101	568	YER111C	SWI4	SWI4	YPD	SGD	MIPS	1.03	1.27	1.11	1.11	1.66	1.12	1.22	0.82	viable	Known	both Swi4p and Swi6p are required for the in vivo protection of the SCB sequences at any cell cycle stage	3.239	-0.446	3	c239 ttgCGCGAAActt	w447 tcaACGCGTacg	w262 tttACGCGTtac												1	c239 ttgCGCGAAActt				2	w447 tcaACGCGTacg	w262 tttACGCGTtac											1	w 697 ACAACCAGCTCA									1	c 394 TTACCCACTTAGGAAA			
"signaling, high osmolarity pathway"	transmembrane osmosensor		G1	366	762	YER118C	SHO1	SSU81	YPD	SGD	MIPS	3.75	1.79	2.59	2.59	1.55	1.61	1.58	0.63	viable	New	"aka SHO1, Protein with an SH3 domain involved as an osmosensor in the HOG1 high-osmolarity signal transduction pathway"	2.655	-1.826	3	w301 ccaACGCGTtca	c 320 aaaACGCGattaa	c 374 cttACGCGgatat																	1	w301 ccaACGCGTtca				2	c 320 aaaACGCGattaa	c 374 cttACGCGgatat																				w 643 TTATACGTGGGG
unknown	unknown		G1	271	285	YER124C	YER124C	YER124C	YPD	SGD	MIPS	1.84	1.05	1.32	0.76	1.40	1.08	1.23	0.81	viable	New	Protein of unknown function 	7.869	-1.345																																							2	w 401 CAAACCAGCAGT	c 256 TAAACCAGCAAA							
transport	iron permease		G2/M	754	252	YER145C	YER145C	FTR1	YPD	SGD	MIPS	2.56	1.64	2.05	2.05	1.38	1.08	1.13	0.89	viable	New	Iron permease that mediates high-affinity iron uptake 	1.952	1.119																										1	c 252 cttACGCGggcg																					
mating	unknown		G1	273	612	YER149C	PEA2	PEA2	YPD	SGD	MIPS	2.46	1.40	1.86	1.86	1.14	1.30	1.07	1.07	viable	New	Protein involved in oriented growth toward mating partner 	1.431	-1.360	1	c 145 ttgACGCGagcgc																								1	c 145 ttgACGCGagcgc																					
unknown	similar to Sed1p		M/G1	65	1	YER150W	YER150W	SPI1	YPD	SGD	MIPS	4.61	4.00	4.29	0.23	1.32	1.38	1.35	1.35	viable	New	Protein with similarity to Sed1p 	1.873	-0.120																																																
unknown	unknown		G1	338	365	YER152C	YER152C	YER152C	YPD	SGD	MIPS	1.26	1.75	1.49	1.49	1.55	1.05	1.22	0.82	viable	New	Protein of unknown function 	2.042	-1.611	1	w 23 acaACGCGTgct	c 421 gccACGCGcaaa																		1	w 23 acaACGCGTgct				1	c 421 gccACGCGcaaa																					
purine metabolism	"adenylate kinase,"		G1	302	448	YER170W	ADK2	ADK2	YPD	SGD	MIPS	2.30	1.09	1.58	1.58	1.39	1.25	1.32	0.76	viable	New	"Adenylate kinase (GTP:AMP phosphotransferase), mitochondrial; codes for a non-functional protein in most laboratory strains"	2.612	-1.471	1	w143 attCGCGAAAacc														1	w143 attCGCGAAAacc																															
unknown	similar to subtelomerically-encoded proteins		G1	116	571	YER189W	YER189W	YER189W	YPD	SGD	MIPS	1.13	2.21	1.58	1.58	1.34	1.48	1.05	1.05	undocumented	New	"Protein with similarity to subtelomerically-encoded proteins including Yil177p, Yhl049p, and Yjl225p "	3.922	-0.536																																																
unknown	similar to other subtelomerically-encoded proteins		G1	145	584	YER190W	YER190W	YER190W	YPD	SGD	MIPS	1.80	2.15	1.97	1.97	1.20	1.05	1.13	0.89	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins including Yil177p 	4.419	-0.695																																																
unknown	unknown		G2/M	791	6	YFL006W	YFL006W	YFL006W	YPD	SGD	MIPS	1.47	1.25	1.36	0.74	1.08	1.11	1.10	0.91	undocumented	New	Protein of unknown function 	1.369	0.683																																		2	w 277 TTCGCCAGCTGT	c 635 TAAGCCAGCCAC													c 161 AGTTTGGTGGGG
"mitosis, chromosome condensation and segregation"	unknown		G1	217	491	YFL008W	SMC1	SMC1	YPD	SGD	MIPS	1.24	1.31	1.27	1.27	1.68	1.20	1.42	0.70	lethal	New	Coiled-coil protein of the SMC family involved in chromosome condensation and segregation 	1.995	-1.123	2	w125 ataACGCGTaaa	w 619 tttACGCGccaaa																		1	w125 ataACGCGTaaa				1	w 619 tttACGCGccaaa																						
transport	hexose permease		M/G1	45	24	YFL011W	HXT10	HXT10	YPD	SGD	MIPS	1.30	1.14	1.07	0.94	1.26	1.27	1.26	0.79	undocumented	New	"Hexose transporter, member of sugar permease family "	1.925	0.041																					1	w 594 ggaACGCGTtga																											
mating	alpha-factor receptor		G2/M	788	56	YFL026W	STE2	STE2	YPD	SGD	MIPS	3.71	4.17	3.93	0.25	1.04	2.41	1.58	1.58	viable	Known	"Pheromone alpha-factor receptor, seven-transmembrane domain protein "	1.342	0.755	2	C 156 TCTGCCAGCCAA	w 177 TTACCCACTTAGGAAA																		1	w 207 ctcACGCGTcgg				2	w 408 ccgACGCGggtaa	w 219 gcgACGCGaggcc						1	C 156 TCTGCCAGCCAA									1	w 177 TTACCCACTTAGGAAA				
cytoskeleton	beta-tubulin		S/G2	563	717	YFL037W	TUB2	TUB2	YPD	SGD	MIPS	4.35	3.06	3.65	3.65	1.05	1.30	1.17	0.86	lethal	New	"Tubulin beta chain, required for mitosis and karyogamy"	2.333	2.700	1	w 104 aaaCACGAAAact								1	w 104 aaaCACGAAAact																																						
unknown	unknown		M/G1	15	30	YFL044C	YFL044C	YFL044C	YPD	SGD	MIPS	1.54	1.39	1.46	0.68	1.39	1.09	1.13	0.89	undocumented	New	Protein of unknown function 	1.419	0.341																																																c 441 TTTTCTCCGGGG	
unknown	unknown; induced in stationary phase		G1	295	409	YFL060C	SNO3	SNO3	YPD	SGD	MIPS	1.49	1.37	1.43	1.43	1.94	1.01	1.40	0.71	undocumented	New	Member of stationary phase-induced gene family (SNO3 and SNO2 code for nearly identical proteins)	1.856	-1.437	1	c 176 gtgACGCGccgcc																								1	c 176 gtgACGCGccgcc																						
unknown	similar to other subtelomerically-encoded proteins		G1	131	572	YFL064C	YFL064C	YFL064C	YPD	SGD	MIPS	1.38	2.51	1.86	1.86	1.47	1.54	1.02	1.02	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins; overlaps with other ORFs	4.465	-0.607	1	w 574 ctgACGCGccata																								1	w 574 ctgACGCGccata																						
unknown	similar to other subtelomerically-encoded proteins		M/G1	54	587	YFL065C	YFL065C	YFL065C	YPD	SGD	MIPS	1.47	2.02	1.72	1.72	1.21	1.20	1.21	0.83	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins; overlaps with YFL064C	1.715	-0.010										1	w 42 tgtCACGAAAtag																																						
unknown	similar to other subtelomerically-encoded proteins		M/G1	68	588	YFL066C	YFL066C	YFL066C	YPD	SGD	MIPS	2.22	2.88	2.53	2.53	1.25	1.33	1.03	1.03	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	1.809	-0.140																1	w 125 taaCGCGAAAaag									1	w 126 gtaACGCGaaaaa																						
unknown	similar to periodic clock protein		M/G1	89	585	YFL067W	YFL067W	YFL067W	YPD	SGD	MIPS	2.78	1.89	2.29	2.29	1.19	1.14	1.16	0.86	undocumented	New	Protein with similarity to periodic clock protein	2.684	-0.326	1	w 267 CTGGCCAGCCCA																																1	w 267 CTGGCCAGCCCA														
nuclear protein targeting	nuclear pore protein		G2/M	797	250	YFR002W	NIC96	NIC96	YPD	SGD	MIPS	1.14	1.18	1.16	1.16	1.55	1.04	1.27	0.79	lethal	New	"Nuclear pore protein (nucleoporin) that acts in a complex with Nsp1p, Nup57p, and Nup49p "	1.697	0.604																																																w 567 TTTACGCCGGGG	
glycogen metabolism	glycogen synthase		M/G1	76	337	YFR015C	GSY1	GSY1	YPD	SGD	MIPS	1.57	1.01	1.26	1.26	1.91	1.47	1.67	1.67	undocumented	New	UDPglucose--starch glucosyltransferase (glycogen synthetase) isoform 1 	1.457	-0.212	1	C 293 TTGACCAGCTAA																																1	C 293 TTGACCAGCTAA														
"mitosis, sister chromatid cohesion (putative)"	unknown		G1	162	510	YFR027W	YFR027W	ECO1	YPD	SGD	MIPS	1.59	1.39	1.49	1.49	1.41	1.35	1.38	0.72	undocumented	New	novel	1.776	-0.783	3	c116 gtaCGCGAAAggc	w137 tcaACGCGTaat	c 115 agtACGCGaaagg												1	c116 gtaCGCGAAAggc				1	w137 tcaACGCGTaat				1	c 115 agtACGCGaaagg							1	w 78 GATGCCAGCTAC														
sulfate assimilation	sulfite reductase subunit		S	478	651	YFR030W	MET10	MET10	YPD	SGD	MIPS	5.63	1.64	3.04	3.04	1.84	1.12	1.44	0.70	viable	New	"Assimilatory sulfite reductase subunit, flavin-binding (alpha) subunit, part of the sulfate assimilation pathway "	1.647	-2.960	1	w 380 tctCGCGAAAtca														1	w 380 tctCGCGAAAtca																																
unknown	unknown		G2/M	632	145	YFR039C	YFR039C	YFR039C	YPD	SGD	MIPS	1.83	1.06	1.31	1.31	1.05	1.04	1.04	1.04	undocumented	New	Protein of unknown function 	2.167	2.095																																		1	w 286 ATTACCAGCCCT														
H+ homeostasis	plasma membrane H+-ATPase		G2/M	704	201	YGL008C	PMA1	PMA1	YPD	SGD	MIPS	1.70	3.57	2.47	0.41	2.35	3.43	2.84	2.84	lethal	New	see PMA2	4.135	1.611																																														
DNA repair (putative)	DNA damage-responsive protein		G2/M	617	238	YGL021W	ALK1	ALK1	YPD	SGD	MIPS	1.27	1.78	1.19	1.19	3.03	3.33	3.18	3.18	undocumented	New	DNA damage responsive protein; induced by mating pheromones	7.360	2.219	1	w 103 CCCTTTTTGGTAAAACGTAAACAA																														1	w 103 CCCTTTTTGGTAAAACGTAAACAA													
cell wall biogenesis	"beta-1,6-glucan assembly protein"		G1	380	772	YGL027C	CWH41	CWH41	YPD	SGD	MIPS	4.14	2.53	3.24	3.24	1.65	1.14	1.37	0.73	viable	New	"Type II integral N-glycoprotein of the endoplasmic reticulum involved in beta-1,6-glucase assembly"	2.428	-1.940	2	c107 ttaCGCGAAAatg	c 106 attACGCGaaaat													1	c107 ttaCGCGAAAatg									1	c 106 attACGCGaaaat																			
unknown	unknown		G1	144	288	YGL028C	YGL028C	YGL028C	YPD	SGD	MIPS	1.16	2.04	1.54	1.54	2.11	1.12	1.37	0.73	undocumented	New	similarity to hypothetical proteins YGR279c and YMR305c	10.820	-0.687	1	c 592 taaACGCGagaaa																								1	c 592 taaACGCGagaaa							2	w 616 AGAGCCAGCATT	w 536 GAAACCAGCAAC			2	w 616 AGAGCCAGCATT	w 536 GAAACCAGCAAC					
mating	a-agglutinin binding subunit		M/G1	52	55	YGL032C	AGA2	AGA2	YPD	SGD	MIPS	3.74	2.13	2.82	0.35	1.09	1.58	1.31	1.31	undocumented	New	a-Agglutinin binding subunit 	1.427	0.000																																														
unknown	unknown		M/G1	74	332	YGL037C	YGL037C	YGL037C	YPD	SGD	MIPS	1.09	1.02	1.03	1.03	1.12	1.18	1.15	0.87	undocumented	New	Protein of unknown function 	1.893	-0.191	2	w 673 ATGGCCAGCACA	w 673 ATGGCCAGCACA																							1	c 289 accACGCGgcgcc							1	w 673 ATGGCCAGCACA				1	w 673 ATGGCCAGCACA						
protein glycosylation	membrane-bound mannosyltransferase		G1	167	456	YGL038C	OCH1	OCH1	YPD	SGD	MIPS	2.65	1.55	2.03	2.03	2.37	1.02	1.55	0.64	viable	New	"Alpha-1,6-mannosyltransferase involved in initiation of mannose outer chain elongation of N-linked oligosaccharides of type Man[9]GlcNac[2]"	2.828	-0.810	2	w299 cacCGCGAAAaga	w 269 taaACGCGccttt													1	w299 cacCGCGAAAaga									1	w 269 taaACGCGccttt																			
unknown	unknown		M/G1	55	258	YGL055W	OLE1	OLE1	YPD	SGD	MIPS	1.10	2.44	1.64	0.61	1.01	1.14	1.06	0.94	viable	New	"Stearoyl-CoA desaturase (delta-9 fatty acid desaturase), required for synthesis of unsaturated fatty acids "	7.478	-0.030																																														
unknown	unknown		G1	361	399	YGL060W	YGL060W	YGL060W	YPD	SGD	MIPS	1.44	1.17	1.30	1.30	1.50	1.09	1.28	0.78	undocumented	New	Protein of unknown function 	2.261	-1.784	1	c 275 caaACGCGataaa																								1	c 275 caaACGCGataaa																			
unknown	unknown		G1	348	418	YGL061C	DUO1	DUO1	YPD	SGD	MIPS	1.17	1.09	1.04	0.96	1.13	1.47	1.14	0.88	lethal	New	Protein that interacts with Dif1p and causes cell death upon overproduction 	1.879	-1.671	1	w 93 caaACGCGataaa																								1	w 93 caaACGCGataaa																			
mating	alpha factor		G1	153	301	YGL089C	mf(alpha)2	MF(ALPHA)2	YPD	SGD	MIPS	1.04	1.03	1.00	1.00	1.22	1.25	1.23	0.81	viable	New	Mating pheromone alpha-2 factor 	3.969	-0.734																																		1	w 299 AATGCCAGCAAC											
DNA replication (putative)	interacts with DNA ligase		M/G1	103	300	YGL090W	LIF1	LIF1	YPD	SGD	MIPS	1.12	1.10	1.11	0.90	1.69	1.18	1.41	0.71	viable	New	Protein that interacts with DNA ligase protein Dnl4	1.933	-0.478	1	C 323 GCTACCAGCAGA																																1	C 323 GCTACCAGCAGA											
cytoskeleton	spindle pole body component		G1	388	798	YGL093W	YGL093W	SPC105	YPD	SGD	MIPS	1.82	2.85	2.28	2.28	1.59	1.28	1.43	0.70	undocumented	New	Protein of unknown function 	2.211	-2.075																																														
unknown	unknown		S/G2	541	682	YGL101W	YGL101W	YGL101W	YPD	SGD	MIPS	1.35	1.13	1.24	1.24	1.13	1.14	1.13	0.88	undocumented	New	strong similarity to YBR242W 	3.388	2.972																																		1	c 298 ACCACCAGCAGC											
mitosis	activator of the anaphase promoting complex		G2/M	717	233	YGL116W	CDC20	CDC20	YPD	SGD	MIPS	1.71	1.19	1.42	0.70	2.55	3.81	3.12	3.12	lethal	Known	adaptor for APC	6.425	1.549	1	ATTTGATTGCCGAAAGAGGCAAAAC  GTAAATAGGTTGT																														1	ATTTGATTGCCGAAAGAGGCAAAAC  GTAAATAGGTTGT													
methionine metabolism	"methylenetetrahydrofolate reductase, putative"		S	479	638	YGL125W	MET11	MET13	YPD	SGD	MIPS	1.24	1.42	1.33	1.33	1.15	1.27	1.21	0.83	undocumented	New	Methylene tetrahydrofolate reductase - has similarity to Met12p 	1.323	-2.960	2	c 106 ctaCACGAAAcac	w 578 ttgACGCGatgc							1	c 106 ctaCACGAAAcac															1	w 578 ttgACGCGatgc																			
transport	hypoxic gene family (sterol uptake)		G2/M	722	108	YGL162W	SUT1	SUT1	YPD	SGD	MIPS	2.72	1.16	1.53	0.65	1.43	1.61	1.51	1.51	viable	New	Protein involved in sterol uptake 	2.030	1.457																																																
DNA repair	DNA-dependent ATPase		G1	253	391	YGL163C	RAD54	RAD54	YPD	SGD	MIPS	1.23	1.01	1.11	1.11	1.33	1.49	1.41	0.71	viable	Known	"DNA-dependent ATPase of the Snf2p family, required for recombination and repair of X-ray damage "	2.879	-1.269																																																
unknown	similar to cystathionine beta-lyase		S	438	643	YGL184C	YGL184C	YGL184C	YPD	SGD	MIPS	1.58	2.15	1.84	1.84	1.40	1.09	1.13	0.88	undocumented	New	Protein with strong similarity to cystathionine beta-lyase 	3.813	-2.542	2	w 518 ataCACGAAAgaa	c 412 caaACGCGgactg							1	w 518 ataCACGAAAgaa															1	c 412 caaACGCGgactg																					
unknown	similar to D-2-hydroxyacid dehydrogenase		G1	168	392	YGL185C	YGL185C	YGL185C	YPD	SGD	MIPS	1.27	1.18	1.22	1.22	1.42	1.11	1.26	0.80	undocumented	New	Protein with similarity to D-2-hydroxyacid dehydrogenase 	1.606	-0.822	1	w 141 cgcACGCGcgaag																								1	w 141 cgcACGCGcgaag																					
protein synthesis	translational activator of GCN4		G1	306	614	YGL195W	GCN1	GCN1	YPD	SGD	MIPS	1.23	2.24	1.35	1.35	1.55	1.20	1.14	0.88	viable	New	Component of a protein complex required for activation of Gcn2p protein kinase in response to starvation for amino acids or purines 	1.584	-1.493	2	c420 tacCACGAAAtaa	w 646 ctaACGCGagaag							1	c420 tacCACGAAAtaa															1	w 646 ctaACGCGagaag							1	c 212 ATTACCAGCTCG													
secretion	vesicle coat component		G1	399	757	YGL200C	EMP24	EMP24	YPD	SGD	MIPS	1.69	1.39	1.53	1.53	1.82	1.03	1.33	0.75	viable	New	Component of the COPII coat of certain secretory pathway vesicles derived from the endoplasmic reticulum 	1.740	-2.192	2	w92 tgaCACGAAActt	w 157 aagACGCGaggaa							1	w92 tgaCACGAAActt															1	w 157 aagACGCGaggaa							1	w 674 ATCACCAGCAAA													
DNA replication	MCM initiator complex		G2/M	796	77	YGL201C	MCM6	MCM6	YPD	SGD	MIPS	1.37	1.05	1.20	0.83	1.08	1.23	1.07	0.94	lethal	New	Member of the MCM/P1 family of proteins involved in DNA replication 	2.848	0.628																1	c 346 aatCGCGAAAagg																															
chromatin structure	non-histone protein		G1	196	549	YGL207W	SPT16	SPT16	YPD	SGD	MIPS	1.72	2.23	1.96	1.96	1.84	1.45	1.63	0.61	lethal	New	aka CDC68; General chromatin factor required for adequate expression of CLN and other genes	2.553	-1.005	2	c36 gttCACGAAAggt	c 206 atcACGCGacttc							1	c36 gttCACGAAAggt															1	c 206 atcACGCGacttc																					
glucose repression	transcriptional repressor		G2/M	667	39	YGL209W	MIG2	MIG2	YPD	SGD	MIPS	1.07	1.11	1.09	0.92	1.29	1.03	1.15	0.87	viable	New	Zinc-finger protein involved in glucose repression of SUC2 	1.501	1.866																																																
vacuole biogenesis	unknown; regulator		S/G2	544	368	YGL212W	VAM7	VAM7	YPD	SGD	MIPS	1.29	1.16	1.23	1.23	1.29	1.20	1.04	0.97	viable	New	Protein involved in morphogenesis of the vacuole 	1.447	2.948																																		1	w 612 GCAACCAGCCTA												w 588 CCCAATGTAGAAAAGTACATCATATGAAACA	
mitosis	kinesin related protein		S/G2	498	745	YGL216W	KIP3	KIP3	YPD	SGD	MIPS	1.01	1.41	1.18	1.18	2.11	1.36	1.24	0.80	undocumented	New	"Kinesin-related protein, involved in pre-anaphase nuclear migration"	3.063	-3.101																																																
protein glycosylation			S	426	769	YGL225W	GOG5	GOG5	YPD	SGD	MIPS	5.47	3.09	4.11	4.11	1.35	1.85	1.58	0.63	lethal	Known	Golgi GDP-mannose transporter; vanadate-resistance protein required for normal Golgi functions including N-linked glycosylation	1.440	-2.442	3	c317 cggCACGAAAact	c360 agcCGCGAAAata	c 352 aaaACGCGagccg						1	c317 cggCACGAAAact					1	c360 agcCGCGAAAata									1	c 352 aaaACGCGagccg							3	w 403 CAGGCCAGCCCT	c 448 GGCACCAGCTCG	c 651 ATCACCAGCAAA											
transport	high-affinity zinc transporter		G2/M	665	146	YGL255W	ZRT1	ZRT1	YPD	SGD	MIPS	1.24	1.37	1.30	1.30	1.16	1.69	1.21	0.83	viable	New	High-affinity zinc transport protein 	2.751	1.876																																																
bud emergence	unknown		G1	345	763	YGR014W	MSB2	MSB2	YPD	SGD	MIPS	4.31	2.89	3.53	3.53	3.32	1.85	2.48	0.40	viable	New	Protein for which overproduction suppresses bud emergence defect of cdc24 mutant	2.458	-1.651	3	w469 agaCACGAAAaca	c 513 gggACGCGcgcca	c 648 ttcACGCGgatgt						1	w469 agaCACGAAAaca															2	c 513 gggACGCGcgcca	c 648 ttcACGCGgatgt						2	c 68 GAAGCCAGCTAG	c 674 TCCACCAGCTCG												
unknown	unknown		G2/M	627	168	YGR035C	YGR035C	YGR035C	YPD	SGD	MIPS	1.25	1.08	1.16	0.86	1.42	1.54	1.48	0.68	undocumented	New	Protein of unknown function 	3.874	2.121																																																
"bud site selection, bipolar"	unknown		G1	161	565	YGR041W	BUD9	BUD9	YPD	SGD	MIPS	1.27	1.46	1.36	1.36	1.36	1.28	1.32	0.76	viable	New	required for bud site selection but not for default mating	6.509	-0.778																																												1	c 185 TTACCCATTTAGGAAA			c 368 AATTGCGCGGGG
unknown	unknown		G1	164	295	YGR042W	YGR042W	YGR042W	YPD	SGD	MIPS	1.51	1.27	1.09	1.09	1.16	1.30	1.06	0.94	undocumented	New	Protein of unknown function 	2.350	-0.793																																																
meiosis	transcription factor		G1	183	290	YGR044C	RME1	RME1	YPD	SGD	MIPS	1.56	1.32	1.43	0.70	1.58	1.47	1.52	0.66	viable	Known	regulator of meiosis; transcriptional activator of CLN2	7.011	-0.949	1	c700 aaaCACGAAAttc								1	c700 aaaCACGAAAttc																							2	w 338 TTTACCAGCAGA	c 288 AAAGCCAGCAGA			1	c 288 AAAGCCAGCAGA								
transport	methionine permease		G1	411	654	YGR055W	MUP1	MUP1	YPD	SGD	MIPS	2.25	1.25	1.68	1.68	1.55	1.01	1.25	0.80	viable	New	High-affinity methionine permease 	2.227	-2.349																																		1	w 563 GCCACCAGCCGC													
unknown	allantoate permease family		G2/M	758	59	YGR065C	YGR065C	YGR065C	YPD	SGD	MIPS	1.44	2.17	1.77	0.57	1.49	1.75	1.08	1.08	undocumented	New	Member of the allantoate permease family 	1.362	1.098																																		1	c 547 CGAGCCAGCTGC													
unknown	unknown		M/G1	72	284	YGR086C	YGR086C	YGR086C	YPD	SGD	MIPS	1.43	1.09	1.15	1.15	1.62	1.13	1.20	0.84	undocumented	New	strong similarity to hypothetical protein YPL004c	5.144	-0.171																										1	c 515 gagACGCGcagta																					
cell cycle	late mitosis; protein kinase		G2/M	760	86	YGR092W	DBF2	DBF2	YPD	SGD	MIPS	1.89	1.39	1.62	0.62	1.37	1.81	1.58	1.58	viable	Known	"Serine/threonine protein kinase related to Dbf20p, required for events in anaphase/telophase"	6.256	1.088																																																
telomere length regulation	telomere binding protein		S	460	741	YGR099W	TEL2	TEL2	YPD	SGD	MIPS	1.76	1.20	1.45	1.45	1.70	1.17	1.20	0.83	lethal	New	Protein involved in controlling telomere length and telomere position effect 	2.667	-2.718																																																
cell cycle	G2/M cyclin		G2/M	657	241	YGR108W	CLB1	CLB1	YPD	SGD	MIPS	4.03	1.51	2.47	2.47	7.19	3.15	4.76	4.76	viable	Known	B-type cyclin	8.779	1.919	1	TTACAACCGCCCAAAGAGGAAAAACATCAACAATCAAG																														1	TTACAACCGCCCAAAGAGGAAAAACATCAACAATCAAG															
cell cycle	B-type cyclin; S phase		G1	176	500	YGR109C	CLB6	CLB6	YPD	SGD	MIPS	2.89	5.33	3.92	3.92	1.16	1.11	1.14	0.88	viable	Known	B-type cyclin involved in S-phase initiation	7.086	-0.880	2	w168 attACGCGTcgc	c 154 tttACGCGattcc																		1	w168 attACGCGTcgc				1	c 154 tttACGCGattcc																					
unknown	unknown; interacts with Duo1p and Mps1p		S	452	723	YGR113W	DIF1	DAM1	YPD	SGD	MIPS	1.54	1.20	1.36	1.36	1.47	1.06	1.18	0.85	lethal	New	Duo1p-interacting factor 	1.849	-2.629	2	c 173 gcaACGCGcaatg	c 326 attACGCGcttct																							2	c 173 gcaACGCGcaatg	c 326 attACGCGcttct																				
asparagine biosynthesis	asparagine synthetase		S/G2	503	634	YGR124W	ASN2	ASN2	YPD	SGD	MIPS	1.63	1.27	1.13	1.13	1.14	1.05	1.04	0.96	viable	New	"Asparagine synthetase (L-aspartate: L-glutamine amidoligase [AMP-forming]), Asn1p and Asn2p are isozymes "	6.280	3.142																																																
unknown	major facilitator superfamily		S/G2	591	625	YGR138C	YGR138C	YGR138C	YPD	SGD	MIPS	2.63	1.32	1.41	1.41	1.25	1.61	1.14	0.88	undocumented	New	Member of major facilitator superfamily (MFS) multidrug-resistance proteins family 1	2.925	2.436	2	w 656 ctgACGCGTgcg	c 520 gcgACGCGacagt																		1	w 656 ctgACGCGTgcg				1	c 520 gcgACGCGacagt																					
mitosis	"kinetochore protein complex CBF3, 110 KD subunit"		G1	409	726	YGR140W	CBF2	CBF2	YPD	SGD	MIPS	2.28	1.38	1.77	1.77	1.50	1.61	1.56	0.64	lethal	New	Component (subunit a) of Cbf3 kinetochore complex 	2.327	-2.321	3	c615 aggCACGAAAata	c69 aaaCGCGAAAggt	c 68 aaaACGCGaaagg						1	c615 aggCACGAAAata					1	c69 aaaCGCGAAAggt									1	c 68 aaaACGCGaaagg																					
cell wall biogenesis	(1->6)-beta-glucan synthase subunit		G2/M	738	82	YGR143W	SKN1	SKN1	YPD	SGD	MIPS	1.93	1.33	1.60	0.62	2.66	2.53	2.59	2.59	viable	New	"Glucan synthase subunit involved in synthesis of beta-1,6-glucan "	5.617	1.341	1	w 615 CCCAAAGCGGAAAATTGGTCAACAT																														1	w 615 CCCAAAGCGGAAAATTGGTCAACAT	1	c 175 TCTACCAGCTGC													
unknown	unknown		G2/M	759	2	YGR146C	YGR146C	YGR146C	YPD	SGD	MIPS	1.93	1.85	1.89	0.53	1.05	1.01	1.02	1.02	undocumented	New	Protein of unknown function 	1.495	1.091																																																
unknown	unknown		G1	248	530	YGR151C	YGR151C	YGR151C	YPD	SGD	MIPS	2.39	1.88	2.12	2.12	2.32	1.52	1.87	0.53	undocumented	New	novel; questionable ORF	4.730	-1.257	1	c 186 ggaACGCGatcgg																								1	c 186 ggaACGCGatcgg							1	c 475 ACCACCAGCACC													c 215 TATAATGCGGGG
bud site selection	"GTP-binding protein, ras superfamily"		G1	236	529	YGR152C	RSR1	RSR1	YPD	SGD	MIPS	4.74	2.03	3.10	3.10	1.95	1.72	1.83	0.55	viable	New	GTP-binding protein of the ras superfamily involved in bud site selection	5.978	-1.211	2	w152 aaaCGCGAAAact	w 153 aaaACGCGaaaac													1	w152 aaaCGCGAAAact									1	w 153 aaaACGCGaaaac																			
unknown	unknown		G1	283	404	YGR153W	YGR153W	YGR153W	YPD	SGD	MIPS	2.07	1.11	1.37	1.37	1.94	1.47	1.69	0.59	undocumented	New	Protein of unknown function 	1.434	-1.386	3	c352 aaaCGCGAAAtat	w 315 ttgACGCGaatta	c 351 caaACGCGaaata												1	c352 aaaCGCGAAAtat									2	w 315 ttgACGCGaatta	c 351 caaACGCGaaata						1	w 638 ACCACCAGCACC											
unknown	unknown		G2/M	688	102	YGR176W	YGR176W	YGR176W	YPD	SGD	MIPS	2.30	1.47	1.84	0.54	1.29	1.32	1.01	1.01	undocumented	New	novel; questionable ORF	2.530	1.701																																		1	w 380 AACACCAGCACC											
acetate ester biosynthesis	alcohol acetyltransferase		G2/M	694	101	YGR177C	ATF2	ATF2	YPD	SGD	MIPS	1.96	2.38	2.16	0.46	1.07	1.11	1.09	0.92	undocumented	New	Alcohol O-acetyltransferase 	3.141	1.681																																														
"cell cycle, checkpoint"	protein kinase		G1	370	425	YGR188C	BUB1	BUB1	YPD	SGD	MIPS	1.43	1.59	1.51	1.51	1.64	1.64	1.64	0.61	undocumented	New	Serine/threonine protein kinase and checkpoint protein required for cell cycle arrest in response to loss of microtubule function 	3.273	-1.877	1	w 146 gatACGCGctagg																								1	w 146 gatACGCGctagg							1	c 251 AAAACCAGCTAT											
unknown	unknown		G1	270	754	YGR189C	YGR189C	YGR189C	YPD	SGD	MIPS	5.94	1.43	2.91	2.91	4.65	4.00	4.31	0.23	viable	New	similarity to Utr2p	8.290	-1.344	3	c313 tacCACGAAAagc	w422 atgACGCGTttt	c 466 ttcACGCGgttcg						1	c313 tacCACGAAAagc										1	w422 atgACGCGTttt				1	c 466 ttcACGCGgttcg							1	c 156 CTAACCAGCAAG				1	c 156 CTAACCAGCAAG						
unknown	unknown		M/G1	79	324	YGR219W	YGR219W	YGR219W	YPD	SGD	MIPS	1.18	1.41	1.29	0.78	1.53	1.08	1.28	0.78	undocumented	New	Protein of unknown function 	1.405	-0.243																																														
unknown	unknown		G1	264	525	YGR221C	YGR221C	YGR221C	YPD	SGD	MIPS	2.31	2.18	2.25	2.25	1.57	1.23	1.39	0.72	undocumented	New	has similarity to YHR149C and FLO11	6.070	-1.311	4	w274 agtCGCGAAAaaa	c242 gaaCGCGAAActt	c 180 tttACGCGactgg	c 241 cgaACGCGaaact											2	w274 agtCGCGAAAaaa	c242 gaaCGCGAAActt								2	c 180 tttACGCGactgg	c 241 cgaACGCGaaact																		
unknown	similar to Spo12p		G2/M	799	85	YGR230W	YGR230W	YGR230W	YPD	SGD	MIPS	1.81	1.43	1.61	0.62	1.76	1.36	1.55	1.55	undocumented	New	Protein with similarity to Spo12p 	3.674	0.579																																														
oxidative stress response (putative)	flavohemoglobin		M/G1	83	264	YGR234W	YHB1	YHB1	YPD	SGD	MIPS	2.31	2.04	2.17	0.46	1.18	1.43	1.10	0.91	viable	New	"Flavohemoglobin of unknown function, distantly related to animal hemoglobins "	1.972	-0.253	2	w 573 AGTACCAGCAAA	C 301 AGTGCCAGCAAA																							1	w 385 cggACGCGcttat							2	w 573 AGTACCAGCAAA	C 301 AGTGCCAGCAAA										
unknown	similar to Kel1p and Kel3p		G1	203	427	YGR238C	KEL2	KEL2	YPD	SGD	MIPS	1.63	1.31	1.46	1.46	1.11	1.14	1.12	0.89	undocumented	New	Protein with similarity to Kel1p and Kel3p 	1.683	-1.060	1	w271 ctgCACGAAAtga								1	w271 ctgCACGAAAtga																																			
glycolysis	phosphofructokinase		G2/M	646	153	YGR240C	PFK1	PFK1	YPD	SGD	MIPS	1.01	1.15	1.07	1.07	1.40	1.08	1.14	0.88	viable	New	"Phosphofructokinase alpha subunit, part of a complex with Pfk2p which carries out a key regulatory step in glycolysis "	1.619	1.983																																														
unknown	unknown		G2/M	692	9	YGR259C	YGR259C	YGR259C	YPD	SGD	MIPS	1.45	2.00	1.71	0.59	1.70	1.19	1.20	0.84	undocumented	New	Protein of unknown function 	1.323	1.691																																														
unknown	similar to Dal5p		G2/M	727	10	YGR260W	YGR260W	YGR260W	YPD	SGD	MIPS	1.13	1.69	1.38	0.72	1.04	1.05	1.05	0.95	undocumented	New	Protein with similarity to Dal5p 	1.433	1.427																																														
DNA replication (putative)	ribonuclease H		M/G1	69	294	YGR276C	RNH70	RNH70	YPD	SGD	MIPS	1.23	1.16	1.03	1.03	1.14	1.33	1.23	0.81	undocumented	New	RNase H 	1.768	-0.151																																														
unknown	unknown		G2/M	640	198	YGR279C	YGR279C	YGR279C	YPD	SGD	MIPS	2.35	4.00	3.06	0.33	1.44	3.05	2.10	2.10	undocumented	New	Protein of unknown function 	2.662	2.028																1	c 436 tcgCGCGAAAagc									2	w 392 aacACGCGcaacg	w 319 ttcACGCGcattt																		
unknown	similar to mouse Surf-4 protein PIR:A34727		G2/M	742	45	YGR284C	YGR284C	YGR284C	YPD	SGD	MIPS	1.23	1.25	1.24	0.81	1.36	1.35	1.00	1.00	undocumented	New	Protein with similarity to mouse Surf-4 protein PIR:A34727 	1.850	1.290																																		1	c 354 GGCACCAGCAGC													w 586 TATTCGGCGGGG
unknown	similar to other subtelomerically-encoded proteins		G1	150	591	YGR296W	YGR296W	YGR296W	YPD	SGD	MIPS	1.06	1.89	1.42	1.42	1.53	1.23	1.12	0.90	undocumented	New	Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins)	3.643	-0.722	1	w 255 ctgACGCGccata																								1	w 255 ctgACGCGccata																					
unknown	unknown		G2/M	756	65	YHL026C	YHL026C	YHL026C	YPD	SGD	MIPS	1.04	1.89	1.40	0.71	2.55	1.34	1.85	1.85	undocumented	New	"Protein of unknown function, has potential signal sequence and 2 potential transmembrane domains "	4.457	1.105																										1	c 688 cacACGCGgaaaa							1	w 129 AGAGCCAGCGCC				1	w 129 AGAGCCAGCGCC								
cell wall integrity and stress response	unknown		G2/M	634	180	YHL028W	WSC4	WSC4	YPD	SGD	MIPS	1.09	1.18	1.04	1.04	1.71	1.06	1.27	1.27	viable	New	"cell Wall integrity and Stress response Component; has similarity to Slg1p, Wsc2p, and Wsc3p"	9.908	2.073																																																
unknown	similar to subtelomerically-encoded proteins		G2/M	735	100	YHL040C	YHL040C	YHL040C	YPD	SGD	MIPS	1.66	1.40	1.52	0.66	1.39	1.07	1.14	0.88	undocumented	New	Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 	1.984	1.378																																																
unknown	similar to other subtelomerically-encoded proteins		G1	129	574	YHL049C	YHL049C	YHL049C	YPD	SGD	MIPS	1.98	2.14	1.04	1.04	1.98	1.45	1.17	0.86	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	4.874	-0.597																																																
unknown	similar to other subtelomerically-encoded proteins		G1	121	589	YHL050C	YHL050C	YHL050C	YPD	SGD	MIPS	2.34	2.65	2.49	2.49	1.32	1.20	1.26	0.79	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.155	-0.550	2	w125 taaCGCGAAAaag	w 126 gtaACGCGaaaaa													1	w125 taaCGCGAAAaag									1	w 126 gtaACGCGaaaaa																					
"signaling, pheromone pathway"	alpha subunit of G protein coupled to mating factor		M/G1	10	75	YHR005C	GPA1	GPA1	YPD	SGD	MIPS	1.51	1.89	1.69	0.59	1.84	1.70	1.04	0.96	lethal	New	Guanine nucleotide-binding protein alpha subunit of the pheromone response pathway 	6.566	0.386	1	c 251 TTTCCCTTTAAGGAAA																								1	c 330 aggACGCGcagag																					
tRNA splicing	unknown		S/G2	530	367	YHR006W	STP2	STP2	YPD	SGD	MIPS	1.20	1.04	1.07	0.93	1.48	1.01	1.22	0.82	undocumented	New	Protein involved in tRNA splicing and branched-chain amino acid uptake 	1.446	3.049																																		1	w 660 AATACCAGCACT													
unknown	similar to N-terminal region of ras-related		M/G1	13	28	YHR022C	YHR022C	YHR022C	YPD	SGD	MIPS	1.35	1.27	1.03	0.97	1.01	1.14	1.06	0.94	undocumented	New	Protein with weak similarity to N-terminal region of ras-related proteins 	1.321	0.360																																																c 495 AATGTTGTGGGG
cell wall biosynthesis	myosin heavy chain		G2/M	653	225	YHR023W	MYO1	MYO1	YPD	SGD	MIPS	1.49	1.23	1.10	0.91	1.44	2.39	1.29	1.29	viable	New	mutants probably fail in septation because Chs2p required for septum formation is not transported to the proper site	5.613	1.951	1	w 188 CCCAAAAGGGTAATTGCGTAAACAT																														1	w 188 CCCAAAAGGGTAATTGCGTAAACAT	1	w 122 ATGACCAGCTAC													
unknown	similar to thymidylate synthase in the N-terminal		G2/M	675	129	YHR029C	YHR029C	YHR029C	YPD	SGD	MIPS	1.80	1.05	1.38	0.73	1.11	1.18	1.14	0.88	undocumented	New	Protein with similarity to thymidylate synthase in the N-terminal region 	1.574	1.824																																																
"signaling, PKC1 pathway"	MAP kinase (mitogen-activated protein kinase)		S	444	356	YHR030C	SLT2	SLT2	YPD	SGD	MIPS	2.39	1.13	1.46	1.46	1.75	1.66	1.71	0.59	viable	New	Serine/threonine protein kinase of MAP kinase family involved in the cell wall integrity (low-osmolarity) pathway 	1.639	-2.579																																																
bud emergence	binds Cdc42p		S	454	740	YHR061C	GIC1	GIC1	YPD	SGD	MIPS	1.50	1.73	1.61	1.61	1.84	1.39	1.60	0.63	viable	New	"Putative effector of Cdc42p, important for bud emergence"	5.193	-2.660	2	w 294 attCGCGAAAaga	w 303 gcgACGCGaattc													1	w 294 attCGCGAAAaga									1	w 303 gcgACGCGaattc																					
unknown	unknown		G1	125	373	YHR067W	YHR067W	YHR067W	YPD	SGD	MIPS	1.14	1.05	1.10	0.91	1.41	1.20	1.30	0.77	undocumented	New	Protein of unknown function 	1.386	-0.585																																		1	c 57 TGTACCAGCCAC													
"RNA splicing, mitochondrial"	RNA binding protein		S/G2	493	694	YHR086W	NAM8	NAM8	YPD	SGD	MIPS	1.42	1.20	1.31	1.31	1.15	1.06	1.10	0.91	viable	New	"U1 snRNA-associated protein, essential for meiotic recombination and suppressor of mitochondrial splicing defects, has 3 RNA recognition (RRM) domains "	3.086	-3.021																																																
transport	hexose permease		M/G1	3	13	YHR092C	HXT4	HXT4	YPD	SGD	MIPS	2.51	1.06	1.63	0.61	1.93	1.59	1.75	0.57	viable	New	"Moderate- to low-affinity hexose transporter, member of sugar permease family "	1.431	0.534																																														
transport	hexose permease		M/G1	107	18	YHR094C	HXT1	HXT1	YPD	SGD	MIPS	2.46	1.05	1.61	0.62	1.56	1.10	1.31	0.76	viable	New	"Low-affinity hexose transporter and member of sugar permease family, induced by glucose only at high concentration "	1.863	-0.491																																														
unknown	unknown; binds Sed3p and Sec23p		S	463	778	YHR098C	YHR098C	SFB3	YPD	SGD	MIPS	2.07	1.79	1.93	1.93	1.42	1.09	1.24	0.80	viable	New	similarity to human hypothetical protein	1.575	-2.791	2	c 503 acgCACGAAAata	c 419 gacACGCGcattt							1	c 503 acgCACGAAAata															1	c 419 gacACGCGcattt																			
pyrimidine biosynthesis	thioredoxin reductase		G1	239	349	YHR106W	TRR2	TRR2	YPD	SGD	MIPS	1.06	1.17	1.05	1.05	1.20	1.04	1.08	0.93	viable	New	Thioredoxin reductase 	1.701	-1.224	1	c 129 acaACGCGcccga																								1	c 129 acaACGCGcccga							1	c 314 TTTGCCAGCCAG											
unknown	unknown		S/G2	536	784	YHR108W	YHR108W	YHR108W	YPD	SGD	MIPS	3.69	1.80	2.58	2.58	1.06	1.06	1.00	1.00	undocumented	New	strong similarity to hypothetical protein YDR358w	1.440	3.022	1	w 550 ttaACGCGTaat																			1	w 550 ttaACGCGTaat												1	c 339 CCAACCAGCGTT				1	c 339 CCAACCAGCGTT						
membrane trafficking; secretion (putative)	unknown		G1	307	488	YHR110W	YHR110W	ERP5	YPD	SGD	MIPS	1.99	1.38	1.66	1.66	1.48	1.33	1.41	0.71	undocumented	New	related to component of the COPII coat of certain ER-derived vesicles	5.152	-1.502	2	w135 ctgACGCGTttt	c 112 aaaACGCGagaaa																		1	w135 ctgACGCGTttt				1	c 112 aaaACGCGagaaa							1	w 486 TATACCAGCAGG											
unknown	similar to vacuolar aminopeptidase Lap4p/Ape1p		G1	140	323	YHR113W	YHR113W	YHR113W	YPD	SGD	MIPS	1.60	1.22	1.14	1.14	1.37	1.25	1.05	0.95	undocumented	New	Protein with similarity to vacuolar aminopeptidase Lap4p/Ape1p 	1.760	-0.661	2	c664 ttgCACGAAAaga	c 573 aacACGCGatata							1	c664 ttgCACGAAAaga															1	c 573 aacACGCGatata																			
phospholipid metabolism	"sn-1,2-diacylglycerol ethanolamine- and cholinephosphotranferase"		G1	228	405	YHR123W	EPT1	EPT1	YPD	SGD	MIPS	1.37	1.03	1.15	1.15	1.40	1.12	1.25	0.80	viable	New	"sn-1,2-Diacylglycerol ethanolaminephosphotransferase "	1.641	-1.169	1	w 137 tttACGCGaggaa																								1	w 137 tttACGCGaggaa																			
unknown	similar to members of the Pir1p/Hsp150p/Pir3p		M/G1	1	52	YHR126C	YHR126C	YHR126C	YPD	SGD	MIPS	1.86	1.28	1.54	0.65	1.17	1.19	1.18	0.85	undocumented	New	Protein with similarity to members of the Pir1p/Hsp150p/Pir3p family 	2.224	0.554																1	c 609 caaCGCGAAAaaa									1	c 608 ccaACGCGaaaaa																			
unknown	suppresses SEC4 dominant negative mutant		G1	290	607	YHR127W	HSN1	HSN1	YPD	SGD	MIPS	1.81	1.81	1.81	1.81	1.58	1.03	1.28	0.78	viable	New	High-copy allele-specific suppressor SEC4 	1.446	-1.420	2	w135 caaCGCGAAAaaa	w 136 ccaACGCGaaaaa													1	w135 caaCGCGAAAaaa									1	w 136 ccaACGCGaaaaa																			
unknown	protein kinase		S/G2	545	669	YHR135C	YCK1	YCK1	YPD	SGD	MIPS	1.94	1.36	1.62	1.62	1.92	1.08	1.33	0.75	viable	New	Casein kinase I isoform	2.263	2.945	1	c 45 atgCGCGAAAttt														1	c 45 atgCGCGAAAttt																	2	w 642 GTCACCAGCATA	c 33 AGGGCCAGCGAA			1	c 33 AGGGCCAGCGAA						
aromatic amino acod metabolism	aromatic amino acid aminotransferase II		G2/M	631	121	YHR137W	ARO9	ARO9	YPD	SGD	MIPS	1.60	1.33	1.46	0.68	1.60	1.45	1.05	0.95	viable	New	Aromatic amino acid aminotransferase II 	2.152	2.107																																														
unknown	unknown		G1	287	286	YHR143W	RPC10	YHR143W	YPD	SGD	MIPS	1.04	1.37	1.15	0.87	1.16	1.20	1.18	0.85	lethal	New	"Shared subunit of RNA polymerases I, II, and III (ABC10alpha), has zinc-binding domain "	9.329	-1.404																																		3	w 424 AGAACCAGCAAT	w 265 TAAACCAGCAAT	c 642 GAGACCAGCGGA		3	w 424 AGAACCAGCAAT	w 265 TAAACCAGCAAT	c 642 GAGACCAGCGGA				
unknown	similar to pheromone adaptation protein Mdg1p		S/G2	537	244	YHR146W	YHR146W	YHR146W	YPD	SGD	MIPS	2.97	1.11	1.64	1.64	1.61	1.10	1.33	0.75	undocumented	New	Protein with similarity to pheromone adaptation protein Mdg1p 	1.783	3.018																																														
unknown	unknown		G1	155	473	YHR149C	YHR149C	YHR149C	YPD	SGD	MIPS	2.16	1.01	1.46	1.46	1.97	1.43	1.68	0.60	undocumented	New	similar to YGR221C 	2.344	-0.753	1	c292 cttCGCGAAAaaa														1	c292 cttCGCGAAAaaa																	1	c 609 GAGACCAGCTCA											
unknown	unknown		G2/M	741	161	YHR151C	YHR151C	YHR151C	YPD	SGD	MIPS	1.83	1.11	1.42	1.42	2.49	1.22	1.43	1.43	undocumented	New	novel	2.841	1.303																																		1	c 110 AATACCAGCAAA											
meiosis	unknown		G2/M	729	87	YHR152W	SPO12	SPO12	YPD	SGD	MIPS	2.78	2.78	2.78	0.36	2.58	4.96	3.58	3.58	viable	Known	"involved in meiosis, and exit from mitosis"	2.075	1.423																																		1	c 561 ATTACCAGCAGA														
"meiosis, spore formation"	unknown		G1	277	524	YHR153C	SPO16	SPO16	YPD	SGD	MIPS	1.96	2.25	2.10	2.10	1.12	1.12	1.00	1.00	undocumented	New	Early meiotic protein required for efficient spore formation	3.278	-1.365	3	w168 tgaCGCGAAAaac	w105 ttaACGCGTgaa	w 169 gtgACGCGaaaaa												1	w168 tgaCGCGAAAaac				1	w105 ttaACGCGTgaa				1	w 169 gtgACGCGaaaaa																						
silencing	unknown		G1	364	437	YHR154W	ESC4	ESC4	YPD	SGD	MIPS	4.69	3.43	4.01	4.01	3.43	1.28	2.10	0.48	undocumented	New	Protein involved in chromatin silencing 	1.642	-1.816	4	c128 tgaCGCGAAAaac	w190 ttcACGCGTtaa	c 127 gtgACGCGaaaaa	c 545 ttcACGCGcttga											1	c128 tgaCGCGAAAaac				1	w190 ttcACGCGTtaa				2	c 127 gtgACGCGaaaaa	c 545 ttcACGCGcttga																					
unknown	unknown		G1	279	410	YHR159W	YHR159W	YHR159W	YPD	SGD	MIPS	1.61	1.96	1.78	1.78	1.13	1.20	1.03	0.97	undocumented	New	Protein of unknown function 	2.059	-1.375	2	c 148 atcACGCGgcacg	c 176 gcgACGCGgttgt																							2	c 148 atcACGCGgcacg	c 176 gcgACGCGgttgt																					
cytoskeleton	spindle pole body component		G1	384	728	YHR172W	SPC97	SPC97	YPD	SGD	MIPS	1.09	1.07	1.01	1.01	1.45	1.03	1.22	0.82	lethal	New	Spindle pole body component that plays a role in organization of nuclear and cytoplasmic microtubules 	1.477	-1.985																																																	
unknown	unknown		G1	374	765	YHR173C	YHR173C	YHR173C	YPD	SGD	MIPS	1.70	1.50	1.60	1.60	1.45	1.33	1.39	0.72	undocumented	New	novel	1.771	-1.908																																		1	w 662 ACCACCAGCGTG														
transcription	unknown; binds Sin3p		S/G2	524	695	YHR178W	STB5	STB5	YPD	SGD	MIPS	1.60	1.32	1.45	1.45	1.31	1.10	1.09	0.91	lethal	New	"Protein with similarity to transcription factors, has Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-terminal region "	1.352	3.076																																		1	c 492 ATTACCAGCATT														
signaling	protein kinase		G2/M	610	626	YHR205W	SCH9	SCH9	YPD	SGD	MIPS	1.17	1.15	1.16	1.16	1.31	1.02	1.13	0.88	lethal	New	Serine/threonine protein kinase that is activated by cAMP 	1.508	2.293										1	c 197 gacCACGAAAagg																							1	c 343 GCGACCAGCGAA				1	c 343 GCGACCAGCGAA								c 60 TTTAAGGTGGGG	
branched chain amino acid degradation	transaminase		S/G2	508	633	YHR208W	BAT1	BAT1	YPD	SGD	MIPS	1.40	1.69	1.10	0.91	2.07	1.41	1.71	0.59	viable	New	Mitochondrial branched-chain amino acid transaminase 	3.460	3.135	1	c 322 tacACGCGgtact																								1	c 322 tacACGCGgtact																						
phosphate metabolism	secreted acid phosphatase		G2/M	750	93	YHR215W	PHO12	PHO12	YPD	SGD	MIPS	1.51	1.75	1.63	0.62	4.94	2.16	3.27	3.27	viable	New	"Acid phosphatase, secreted (PHO11 and PHO12 code for nearly identical proteins)"	5.297	1.213																																																	
unknown	similar to other subtelomerically-encoded proteins		G1	133	579	YHR218W	YHR218W	YHR218W	YPD	SGD	MIPS	1.70	2.20	1.94	1.94	1.43	1.42	1.00	1.00	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	4.986	-0.622																																																	
unknown	similar to other subtelomerically-encoded proteins		M/G1	108	586	YHR219W	YHR219W	YHR219W	YPD	SGD	MIPS	2.03	1.91	1.97	1.97	1.14	1.09	1.11	0.90	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	2.481	-0.492																										1	w 14 ggtACGCGagttc																						
fatty acid metabolism	acyl CoA synthase		M/G1	48	274	YIL009W	FAA3	FAA3	YPD	SGD	MIPS	1.82	2.50	2.13	0.47	1.20	1.17	1.01	0.99	viable	New	"Acyl-CoA synthase (long-chain fatty acid CoA ligase), activates endogenous but not imported fatty acids "	6.035	0.037	1	w 479 GATACCAGCAGT																																1	w 479 GATACCAGCAGT													w 555 CTAATCGTGGGG	
unknown	"similar to Yil176p, Yir041p and other members of"		G2/M	614	144	YIL011W	YIL011W	YIL011W	YPD	SGD	MIPS	1.02	1.16	1.09	0.92	2.03	1.27	1.60	0.62	undocumented	New	"Protein with similarity to Yil176p, Yir041p and other members of the PAU1 family"	1.603	2.253																																		1	c 70 ACAACCAGCAAG				1	c 70 ACAACCAGCAAG				1	c 258 TTTCCCAAAAAGGAAA				
unknown	unknown		G1	332	420	YIL025C	YIL025C	YIL025C	YPD	SGD	MIPS	1.10	1.18	1.03	1.03	1.14	1.04	1.09	1.09	undocumented	New	Protein of unknown function 	1.980	-1.591																																																	
unknown	colony morphology		G1	245	426	YIL026C	IRR1	IRR1	YPD	SGD	MIPS	1.17	1.24	1.20	1.20	1.56	1.45	1.51	0.66	lethal	New	Protein involved in colony morphology and adhesion to solid supports 	2.887	-1.247	3	c538 ttcCACGAAAtga	w138 gcgACGCGTgac	w 143 gcaACGCGACGCG						1	c538 ttcCACGAAAtga										1	w138 gcgACGCGTgac				1	w 143 gcaACGCGACGCG																						
cell cycle	cyclin		S/G2	552	690	YIL050W	PCL7	PCL7	YPD	SGD	MIPS	1.08	1.09	1.00	1.00	1.47	1.43	1.45	0.69	undocumented	New	"Cyclin, associates with Pho85p "	2.186	2.841																																																
unknown	unknown		G2/M	648	42	YIL056W	YIL056W	YIL056W	YPD	SGD	MIPS	1.50	1.00	1.22	1.22	1.04	1.03	1.03	0.97	undocumented	New	Protein of unknown function 	2.363	1.973																																																
DNA repair	repair-induced ribonucleotide reductase		G1	244	477	YIL066C	RNR3	RNR3	YPD	SGD	MIPS	2.28	3.00	2.61	2.61	2.94	1.59	2.16	0.46	viable	New	Ribonucleotide reductase; transcription is tightly cell cycle regulated and moderately inducible by DNA damage	7.525	-1.244	5	c153 gaaCACGAAAcaa	c178 tgaCACGAAAaac	c330 aacCACGAAAaaa	w549 cgcACGCGTaaa	w190 ctgACGCGTttc				3	c153 gaaCACGAAAcaa	c178 tgaCACGAAAaac	c330 aacCACGAAAaaa								2	w549 cgcACGCGTaaa	w190 ctgACGCGTttc																									
"meiosis, synapsis"	DNA binding protein		S/G2	557	36	YIL072W	HOP1	HOP1	YPD	SGD	MIPS	1.36	1.49	1.05	1.05	1.52	1.41	1.47	0.68	viable	New	"Meiosis-specific protein associated with lateral elements of the synaptonemal complex, involved in homologous chromosome synapsis and chiasmata formation "	10.360	2.797																																		1	c 415 TGGACCAGCGGC				1	c 415 TGGACCAGCGGC								
unknown	putative alpha-ketoisocaproate reductase		S	434	646	YIL074C	YIL074C	YIL074C	YPD	SGD	MIPS									undocumented	New	Potential alpha-ketoisocaproate reductase 	1.574	-2.506																																																
secretion	vesicle coat component		G1	355	387	YIL076W	SEC28	SEC28	YPD	SGD	MIPS	1.37	1.08	1.22	1.22	1.58	1.85	1.71	0.59	viable	New	"Coatamer complex epsilon chain (epsilon-COP) of secretory pathway vesicles, required for retrograde transport from Golgi to endoplasmic reticulum "	1.353	-1.711																																		1	c 225 TTCACCAGCTTG													
lysine biosynthesis	homo-isocitrate dehydrogenase		G2/M	624	105	YIL094C	LYS12	LYS12	YPD	SGD	MIPS	1.42	1.79	1.59	0.63	1.65	1.08	1.23	0.81	viable	New	"Homoisocitrate dehyrogenase, fourth step in lysine biosynthesis pathway, converts homoisocitrate to alpha-ketoadipate "	1.536	2.154																																																
unknown	unknown		G1	240	364	YIL104C	YIL104C	YIL104C	YPD	SGD	MIPS	1.23	1.11	1.17	0.86	1.83	1.14	1.27	0.79	undocumented	New	Protein of unknown function 	1.914	-1.237																																																
mitosis	unknown; binds Mps1p and Dbf2p		G2/M	664	230	YIL106W	MOB1	MOB1	YPD	SGD	MIPS	1.64	1.41	1.52	0.66	1.05	2.07	1.47	1.47	lethal	Known	Mps one binder	4.663	1.876																																																w 343 TGTATGCTGGGG
mitochondrial transport	"porin, anion channel"		M/G1	94	20	YIL114C	POR2	POR2	YPD	SGD	MIPS	1.67	1.37	1.51	0.66	1.34	1.11	1.10	0.91	viable	New	Outer mitochondrial membrane porin (voltage-dependent anion-selective channel)	1.509	-0.379	2	w 653 GTGGCCAGCATA	w 653 GTGGCCAGCATA																							1	c 601 cccACGCGaacac							1	w 653 GTGGCCAGCATA				1	w 653 GTGGCCAGCATA								
unknown	unknown		S	415	358	YIL117C	YIL117C	YIL117C	YPD	SGD	MIPS	1.44	1.27	1.06	0.94	1.81	1.60	1.70	0.59	undocumented	New	Protein of unknown function 	1.527	-2.377																																																
"signaling, Ras pathway"	negative regulator of ras-cAMP pathway		G2/M	705	106	YIL119C	RPI1	RPI1	YPD	SGD	MIPS	2.76	1.03	1.69	0.59	1.71	1.12	1.24	1.24	viable	New	"Negative regulator of ras-cAMP pathway, downregulates normal but not mutant ras function "	2.621	1.601																																																
unknown	major facilitator superfamily		G2/M	776	159	YIL121W	YIL121W	YIL121W	YPD	SGD	MIPS	1.13	1.19	1.16	0.86	1.02	1.28	1.12	0.89	undocumented	New	Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 	1.315	0.893																																		1	c 52 ATGACCAGCAAC				1	c 52 ATGACCAGCAAC								w 615 TATTCGGCGGGG
unknown	unknown		G2/M	663	188	YIL122W	YIL122W	YIL122W	YPD	SGD	MIPS	1.01	1.01	1.00	1.00	1.09	1.10	1.00	1.00	undocumented	New	Protein of unknown function 	1.934	1.886																										2	c 163 aatACGCGaacct	c 187 agtACGCGatttg																				
cell cycle	unknown		S/G2	525	716	YIL123W	SIM1	SIM1	YPD	SGD	MIPS	4.51	2.33	3.24	3.24	2.03	2.00	2.02	0.50	undocumented	New	Protein involved in the aging process and in regulation of the cell cycle; has 71% identity to Sun4p over 359 amino acids 	3.317	3.075	3	w 300 cgtCACGAAAatt	c 229 tgaCGCGAAAcgc	c 228 ctgACGCGaaacg						1	w 300 cgtCACGAAAatt					1	c 229 tgaCGCGAAAcgc									1	c 228 ctgACGCGaaacg																					
unknown	unknown		S/G2	515	713	YIL129C	YIL129C	YIL129C	YPD	SGD	MIPS	1.24	1.60	1.13	1.13	1.52	1.24	1.11	0.90	undocumented	New	similarity to hypothetical human protein	5.001	3.119	1	w 197 aacCACGAAAcga								1	w 197 aacCACGAAAcga																																					
unknown	similar to Drosophila fork head protein		S/G2	540	700	YIL131C	FKH1	FKH1	YPD	SGD	MIPS	2.09	1.33	1.67	1.67	1.78	1.05	1.37	1.37	viable	New	contains a forkhead-associated (FHA) domain	3.345	2.977																																																w 256 ATGAAGGTGGGG	
unknown	unknown		G1	315	424	YIL132C	YIL132C	YIL132C	YPD	SGD	MIPS	1.22	1.41	1.31	1.31	1.31	1.01	1.15	0.87	undocumented	New	novel	2.132	-1.523	2	w106 aaaCGCGAAAgct	w 107 caaACGCGaaagc													1	w106 aaaCGCGAAAgct									1	w 107 caaACGCGaaagc							2	c 561 TTTACCAGCATT	c 636 TTGACCAGCTCT													
unknown	unknown		S/G2	505	691	YIL135C	YIL135C	YIL135C	YPD	SGD	MIPS	1.45	1.14	1.28	1.28	1.13	1.12	1.13	0.89	undocumented	New	Protein of unknown function 	1.530	3.142																																																	
cytoskeleton	tropomyosin		S/G2	582	369	YIL138C	TPM2	TPM2	YPD	SGD	MIPS	1.20	1.47	1.11	0.90	1.06	1.13	1.03	1.03	viable	New	"Tropomyosin isoform 2, coiled-coil protein "	1.840	2.486																																																	
"bud site selection, axial"	plasma membrane protein		G1	330	534	YIL140W	SRO4	SRO4	YPD	SGD	MIPS	8.03	3.06	4.96	4.96	8.53	4.35	6.09	0.16	viable	New	"aka AXL2/BUD10; Membrane glycoprotein localized at site of bud emergence, required for axial budding"	9.661	-1.581	4	w386 agaCGCGAAAaaa	w368 acaACGCGTcat	w 387 aagACGCGaaaaa	c 345 gtgACGCGaattg											1	w386 agaCGCGAAAaaa				1	w368 acaACGCGTcat				2	w 387 aagACGCGaaaaa	c 345 gtgACGCGaattg																					c 262 AAGATGGTGGGG
unknown	unknown		G1	301	483	YIL141W	YIL141W	YIL141W	YPD	SGD	MIPS	1.16	1.63	1.19	1.19	2.66	1.72	2.14	0.47	undocumented	New	novel; questionable ORF	6.591	-1.459	4	w73 agaCGCGAAAaaa	w55 acaACGCGTcat	w 74 aagACGCGaaaaa	c 32 gtgACGCGaattg											1	w73 agaCGCGAAAaaa				1	w55 acaACGCGTcat				2	w 74 aagACGCGaaaaa	c 32 gtgACGCGaattg						2	c 413 AAAACCAGCATT	c 674 TTCACCAGCTTT			1	c 413 AAAACCAGCATT									
unknown	unknown		S	422	720	YIL144W	TID3	TID3	YPD	SGD	MIPS	1.87	1.15	1.28	1.28	1.17	1.14	1.15	0.87	lethal	New	"Protein with similarity to myosin heavy chain, possible coiled-coil "	1.650	-2.413																																		1	c 331 TCAACCAGCCCA														
unknown	similar to Ykr100p		G2/M	607	227	YIL158W	YIL158W	YIL158W	YPD	SGD	MIPS	1.13	1.12	1.01	0.99	1.69	2.00	1.84	1.84	undocumented	New	questionable ORF	5.693	2.306																										1	w 417 attACGCGaagta																						
sucrose utilization	invertase		G2/M	677	194	YIL162W	SUC2	SUC2	YPD	SGD	MIPS	10.33	3.85	6.30	0.16	1.01	1.84	1.37	1.37	viable	New	Beta-fructofuranosidase 2 (invertase)	1.731	1.803																					1	w 426 aatACGCGTagc																											
gluconeogenesis	serine dehydratase		G2/M	798	61	YIL167W	YIL167W	YIL167W	YPD	SGD	MIPS	1.68	1.10	1.36	0.74	1.37	1.35	1.36	0.73	viable	New	"Serine dehydratase, converts serine to pyruvate and ammonia for gluconeogenesis "	2.482	0.597																																		1	c 174 TAAACCAGCATT				1	c 174 TAAACCAGCATT									
gluconeogenesis	serine dehydratase		G2/M	765	32	YIL168W	SDL1	SDL1	YPD	SGD	MIPS	1.84	1.45	1.63	0.61	1.27	1.03	1.11	1.11	viable	New	"Serine dehydratase, converts serine to pyruvate and ammonia for gluconeogenesis "	2.051	1.033																																																	
unknown	similar to subtelomerically-encoded proteins		G1	149	595	YIL177C	YIL177C	YIL177C	YPD	SGD	MIPS	1.71	2.12	1.90	1.90	1.63	1.04	1.25	0.80	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.884	-0.713	1	w 595 ctgACGCGccata																								1	w 595 ctgACGCGccata																						
unknown	unknown		S/G2	506	683	YIR010W	YIR010W	YIR010W	YPD	SGD	MIPS	2.35	1.36	1.79	1.79	1.10	1.37	1.23	0.82	undocumented	New	novel	2.420	3.142																																																	
sulfur amino acid metbolism	transcriptional activator 		S	431	642	YIR017C	MET28	MET28	YPD	SGD	MIPS	1.54	1.05	1.27	1.27	2.25	1.47	1.82	0.55	viable	New	"Transcriptional activator of the basic leucine zipper (bZIP) family, works with Met4p and Cbf1p to regulation sulfur amino acid metabolism "	2.166	-2.478																																																	
unknown	similar to proteins of the short-chain alcohol		M/G1	86	334	YIR036C	YIR036C	YIR036C	YPD	SGD	MIPS	1.25	1.22	1.24	0.81	1.50	1.12	1.30	0.77	undocumented	New	Protein with similarity to proteins of the short-chain alcohol dehydrogenase family and to 7-alpha-hydroxysteroid dehydrogenase 	1.549	-0.274																																																w 571 TAACTTGTGGGG	
unknown	unknown		G1	124	4	YJL015C	YJL015C	YJL015C	YPD	SGD	MIPS	1.16	1.02	1.07	0.94	1.73	1.13	1.24	0.81	undocumented	New	"Protein of unknown function, overlaps with YJL016W "	1.363	-0.582	1	w 699 aagACGCGagaat																								1	w 699 aagACGCGagaat							1	w 346 CTCACCAGCTAG														
unknown	unknown		G1	319	484	YJL018W	YJL018W	YJL018W	YPD	SGD	MIPS	1.52	1.81	1.66	1.66	1.23	1.56	1.39	0.72	undocumented	New	"Questionable ORF, overlaps with YJL018W "	2.240	-1.543																																														
unknown	unknown		G1	362	485	YJL019W	YJL019W	YJL019W	YPD	SGD	MIPS	2.33	1.87	2.09	2.09	1.22	1.02	1.12	0.90	undocumented	New	novel	2.899	-1.784	3	w195 agaCGCGAAAatg	w 439 gggACGCGattga	w 196 gagACGCGaaaat												1	w195 agaCGCGAAAatg									2	w 439 gggACGCGattga	w 196 gagACGCGaaaat																		
secretion	GTPase-activating protein for Ypt6		M/G1	7	316	YJL044C	GYP6	GYP6	YPD	SGD	MIPS	1.88	2.04	1.96	0.51	1.12	1.67	1.22	1.22	undocumented	New	GTPase-activating protein for Ypt6p 	2.523	0.431	3	c 245 TAAACCAGCGCA	w 307 CATGCCAGCCGT	C 245 TAAACCAGCGCA																														2	w 307 CATGCCAGCCGT	C 245 TAAACCAGCGCA			1	c 245 TAAACCAGCGCA						
unknown	unknown		G2/M	635	226	YJL051W	YJL051W	YJL051W	YPD	SGD	MIPS	1.27	1.09	1.08	0.93	2.50	2.31	2.40	2.40	undocumented	New	novel	6.092	2.073	1	w 255 CCTTTTTGGGAAATAAGTAAACAA																														1	w 255 CCTTTTTGGGAAATAAGTAAACAA	1	c 631 GATACCAGCGGA											
unknown	similar to kynurenine aminotransferase		S/G2	509	711	YJL060W	YJL060W	YJL060W	YPD	SGD	MIPS	3.79	1.33	2.25	2.25	1.46	1.28	1.07	0.94	undocumented	New	Protein with similarity to kynurenine aminotransferase 	2.900	3.134																																														
unknown	unknown		M/G1	17	330	YJL067W	YJL067W	YJL067W	YPD	SGD	MIPS	1.38	1.27	1.32	0.76	1.26	1.43	1.34	0.74	undocumented	New	Protein of unknown function 	1.745	0.329	2	c 252 AAGACCAGCATG	C 252 AAGACCAGCATG																							1	w 53 cacACGCGcaagg							1	C 252 AAGACCAGCATG				1	c 252 AAGACCAGCATG						
unknown	unknown		G1	336	394	YJL072C	YJL072C	YJL072C	YPD	SGD	MIPS	1.98	1.05	1.37	1.37	1.51	1.12	1.30	0.77	undocumented	New	novel	1.851	-1.601																																		1	c 469 CGCACCAGCGAT											
mating; nuclear fusion	DnaJ-like protein		G1	219	457	YJL073W	JEM1	JEM1	YPD	SGD	MIPS	2.33	1.13	1.62	1.62	1.63	1.48	1.55	0.65	viable	New	"DnaJ-like protein, required for nuclear fusion"	2.005	-1.135	2	w82 ctaACGCGTcgc	c 78 aagACGCGACGCG																		1	w82 ctaACGCGTcgc				1	c 78 aagACGCGACGCG							1	w 601 AAAACCAGCGGT				1	w 601 AAAACCAGCGGT						
chromatin structure	cohesin		G1	226	505	YJL074C	SMC3	SMC3	YPD	SGD	MIPS	2.36	1.44	1.84	1.84	2.66	1.19	1.77	0.56	lethal	New	"Cohesin, coiled-coil protein of the SMC family involved in chromosome condensation and segregation"	4.700	-1.162	4	w310 cgaCGCGAAAaat	w258 cgaCGCGAAAaaa	w 311 acgACGCGaaaaa	w 264 gcgACGCGACGCG											2	w310 cgaCGCGAAAaat	w258 cgaCGCGAAAaaa								2	w 311 acgACGCGaaaaa	w 264 gcgACGCGACGCG																		
unknown	similar to plant PR-pathogen related proteins		G1	190	289	YJL078C	PRY3	PRY3	YPD	SGD	MIPS	3.99	1.08	1.92	0.52	2.01	1.03	1.44	0.69	undocumented	New	has strong similarity to Pry1p and Pry2p 	6.460	-0.985	1	w541 ggaACGCGTcgc																			1	w541 ggaACGCGTcgc												1	c 487 AGAACCAGCCAT											
unknown	similar to plant PR-pathogen related proteins		G2/M	792	70	YJL079C	PRY1	PRY1	YPD	SGD	MIPS	3.67	1.10	2.01	0.50	4.60	3.46	3.99	3.99	undocumented	New	Protein expressed under starvation conditions 	6.259	0.682																																														
unknown	similar to Can1p		G1	377	730	YJL091C	YJL091C	YJL091C	YPD	SGD	MIPS	1.31	1.22	1.26	1.26	2.14	1.10	1.53	0.65	viable	New	null mutants grow very slowly; contains 12 putative transmembrane domains	1.575	-1.921	1	c 69 ttcACGCGagcat																								1	c 69 ttcACGCGagcat							1	w 666 TATACCAGCATT											
meiosis	DNA helicase		S	446	737	YJL092W	HPR5	HPR5	YPD	SGD	MIPS	1.74	1.82	1.78	1.78	1.94	1.39	1.64	0.61	viable	Known	"DNA helicase involved in DNA repair, suppressor of rad6 and rad18 mutations"	1.737	-2.593	1	w147 attACGCGTtat																			1	w147 attACGCGTtat																								
cell wall biogenesis	chitin biosynthesis		S/G2	516	622	YJL099W	CHS6	CHS6	YPD	SGD	MIPS	1.05	1.04	1.05	1.05	1.18	1.02	1.10	1.10	viable	New	"Protein with tetratricopeptide (TPR) repeats involved for chitin synthase Chs3p activity, mutants are resistant to calcofluor white "	1.460	3.112																																														
transcription	anti-silencing protein		G1	250	430	YJL115W	ASF1	ASF1	YPD	SGD	MIPS	1.59	1.19	1.38	1.38	2.04	1.59	1.80	0.56	undocumented	Known	Anti-silencing protein that causes depression of silent loci when overexpressed	6.176	-1.259	4	c330 taaCACGAAAttc	w306 cggCGCGAAAttt	c297 ctcCGCGAAAaat	c 317 cggACGCGatttt					1	c330 taaCACGAAAttc					2	w306 cggCGCGAAAttt	c297 ctcCGCGAAAaat								1	c 317 cggACGCGatttt							1	w 698 AAGGCCAGCTTC											
unknown	unknown		S	472	687	YJL118W	YJL118W	YJL118W	YPD	SGD	MIPS	1.29	1.19	1.04	0.96	1.21	1.16	1.19	0.84	undocumented	New	novel	4.111	-2.877	2	w 19 gacCACGAAAaaa	c 80 caaACGCGcttat							1	w 19 gacCACGAAAaaa															1	c 80 caaACGCGcttat																			
unknown	unknown		S	477	628	YJL119C	YJL119C	YJL119C	YPD	SGD	MIPS	1.50	1.02	1.24	0.81	1.15	1.39	1.26	0.79	undocumented	New	Protein of unknown function 	2.055	-2.938																																																
sphingolipid metabolism	sphingoid base-phosphate phosphatase		S/G2	546	679	YJL134W	LCB3	LCB3	YPD	SGD	MIPS	1.37	1.59	1.08	0.93	1.44	1.12	1.27	0.79	viable	New	"Sphingoid base-phosphate phosphatase, a key regulator of sphingolipid metabolism and stress response "	2.080	2.943	1	w 650 gagACGCGgcgaa																								1	w 650 gagACGCGgcgaa							3	w 668 CCCACCAGCTCC	w 307 TCAACCAGCTAT	w 37 CAGACCAGCGGA		1	w 37 CAGACCAGCGGA								
glycogen metabolism	glycogen synthesis initiator		S/G2	554	675	YJL137C	GLG2	GLG2	YPD	SGD	MIPS	2.34	1.53	1.89	1.89	1.26	1.23	1.01	1.01	viable	New	Self-glucosylating initiator of glycogen synthesis 	1.841	2.806																																																
cell cycle	Cdc28p kinase inhibitor		G2/M	795	84	YJL157C	FAR1	FAR1	YPD	SGD	MIPS	10.57	1.28	3.68	0.27	7.57	1.19	2.52	2.52	viable	Known	 Inhibitor of Cdc28p/Cln1p and Cdc28p/Cln2p complexes involved in cell cycle arrest for mating	6.488	0.639	2	w 236 TATGCCAGCCTT	w 154 TTTCCCTTTTAGGAAA													2	w 123 tttCGCGAAAtct	c 126 tttCGCGAAActg			1	w 328 taaACGCGTaat												1	w 236 TATGCCAGCCTT									1	w 154 TTTCCCTTTTAGGAAA			
unknown	unknown		S/G2	553	715	YJL158C	CIS3	CIS3	YPD	SGD	MIPS	2.92	2.07	2.46	2.46	2.47	1.84	2.13	0.47	undocumented	New	cik1 suppressor; Protein with similarity to members of the Pir1p/Hsp150p/Pir3p family	1.709	2.835																																																
heat shock response	secreted glycoprotein of HSP family		M/G1	44	276	YJL159W	HSP150	HSP150	YPD	SGD	MIPS	4.23	5.00	4.60	0.22	1.47	1.22	1.34	1.34	viable	New	member of the Pir1p/Hsp150p/Pir3p family	10.860	0.050	2	c 550 GCGGCCAGCAAC	C 550 GCGGCCAGCAAC																															1	C 550 GCGGCCAGCAAC				1	c 550 GCGGCCAGCAAC							w 119 CCCAATGTAGAAAAGTACATCATATGAAACA	
DNA replication	"replication factor A, 13 kD subunit"		G1	394	751	YJL173C	RFA3	RFA3	YPD	SGD	MIPS	2.74	1.39	1.95	1.95	1.39	1.72	1.55	0.65	lethal	Known	"DNA replication factor A, 13K subunit"	3.471	-2.125	3	w 313 taaCACGAAAaat	c 156 gatCGCGAAAttt	w 270 taaACGCGTaat						1	w 313 taaCACGAAAaat					1	c 156 gatCGCGAAAttt				1	w 270 taaACGCGTaat																										
unknown	unknown		G1	197	493	YJL181W	YJL181W	YJL181W	YPD	SGD	MIPS	1.44	1.33	1.04	1.04	1.92	1.04	1.41	0.71	undocumented	New	has similarity to Yjr030p	3.648	-1.007	4	c166 acgCGCGAAAacg	w172 gtgACGCGTttt	w 17 agtACGCGcaaac	c 163 ctgACGCGcgaaa											1	c166 acgCGCGAAAacg				1	w172 gtgACGCGTttt				2	w 17 agtACGCGcaaac	c 163 ctgACGCGcgaaa																				
cell cycle	negative regulator of Cdc28p		G1	284	520	YJL187C	SWE1	SWE1	YPD	SGD	MIPS	3.48	1.88	2.56	2.56	2.25	1.41	1.78	0.56	viable	Known	Serine/tyrosine dual-specificity protein kinase able to phosphorylate Cdc28p on tyrosine and inhibit its activity	4.635	-1.390	2	w116 gcgACGCGTgag	w 121 gcgACGCGACGCG																		1	w116 gcgACGCGTgag				1	w 121 gcgACGCGACGCG							1	c 600 CGAACCAGCACT				1	c 600 CGAACCAGCACT								
DNA replication	pre-initiation complex formation		M/G1	9	54	YJL194W	CDC6	CDC6	YPD	SGD	MIPS	1.01	1.02	1.00	1.00	1.59	1.11	1.20	0.84	lethal	Known	"Protein that regulates initiation of DNA replication through binding to origins of replication at the end of mitosis, directing the assembly of MCM proteins and the pre-replication complex "	4.130	0.415																																																
unknown	unknown		M/G1	12	53	YJL195C	YJL195C	YJL195C	YPD	SGD	MIPS	1.31	1.07	1.10	0.91	1.03	1.08	1.02	0.98	undocumented	New	Protein of unknown function 	3.298	0.361																																																
fatty acid metabolism	fatty acid elongation protein		M/G1	61	381	YJL196C	ELO1	ELO1	YPD	SGD	MIPS	1.31	1.41	1.36	0.74	2.18	1.09	1.41	0.71	viable	New	Fatty acid elongation protein involved in elongation of tetradecanoic acid  to hexadecanoic acid  	1.838	-0.090	2	w 411 TCTGCCAGCCAA	c 394 TTACCCACTTAGGAAA																		1	w 360 ccgACGCGTgag				2	c 160 ccgACGCGggtaa	c 349 gcgACGCGaggcc						1	w 411 TCTGCCAGCCAA													
cell wall biogenesis	unknown		S	423	739	YJL201W	ECM25	ECM25	YPD	SGD	MIPS	2.27	1.12	1.59	1.59	1.03	1.02	1.03	0.98	undocumented	New	Protein possibly involved in cell wall structure or biosynthesis	2.302	-2.420																																																
unknown	unknown		G1	189	348	YJL217W	YJL217W	YJL217W	YPD	SGD	MIPS	2.83	1.39	1.43	0.70	2.18	1.52	1.82	0.55	undocumented	New	novel	2.690	-0.972	1	w300 aaaACGCGTggc																			1	w300 aaaACGCGTggc												1	c 293 GCTACCAGCCAC													w 458 GAAATTGTGGGG
unknown	similar to other subtelomerically-encoded proteins		M/G1	109	592	YJL225C	YJL225C	YJL225C	YPD	SGD	MIPS	1.24	1.57	1.39	1.39	1.74	1.36	1.13	0.88	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.694	-0.501																										1	w 595 ctgACGCGccata																					
unknown	major facilitator superfamily		S/G2	486	712	YJR001W	YJR001W	YJR001W	YPD	SGD	MIPS	2.87	1.52	2.09	2.09	1.06	1.12	1.03	0.97	undocumented	New	"similarity to YNL101w and C.elegans hypothetical protein T20G5.6, weak similarity to A.thaliana aminoacid permease AAP4; member of the major facilitator superfamily (MFS) "	1.545	-3.001	2	w 228 acaACGCGTctt	c 186 aaaACGCGatgaa																		1	w 228 acaACGCGTctt				1	c 186 aaaACGCGatgaa																					
unknown	similar to human collagen alpha 3 (VI) chain		G2/M	658	109	YJR003C	YJR003C	YJR003C	YPD	SGD	MIPS	1.60	1.14	1.19	0.84	1.42	1.15	1.28	0.78	undocumented	New	Protein with weak similarity to human collagen alpha 3 (VI) chain precursor 	1.809	1.919																																																
mating	alpha-agglutinin		M/G1	110	302	YJR004C	SAG1	SAG1	YPD	SGD	MIPS	1.01	1.10	1.05	0.95	1.54	1.30	1.09	0.92	undocumented	New	alpha-Agglutinin involved in cell-cell interactions during mating 	3.383	-0.512																																																
DNA replication	polymerase delta 55 KD subunit		G1	318	431	YJR006W	HUS2	HYS2	YPD	SGD	MIPS	1.57	1.46	1.52	1.52	2.62	1.04	1.65	0.61	lethal	New	Aka POL31; Small subunit of dna polymerase delta	2.271	-1.542	1	w110 cagACGCGTctg																			1	w110 cagACGCGTctg																										
methionine biosynthesis	sulfate adenylyltransferase		S/G2	504	650	YJR010W	MET3	MET3	YPD	SGD	MIPS	7.30	1.15	2.52	2.52	1.33	1.43	1.38	0.73	viable	New	ATP-sulfurylase (sulfate adenylyltransferase)	4.410	3.142	1	w 416 ccaACGCGcatcc																								1	w 416 ccaACGCGcatcc																					
unknown	unknown		G1	198	429	YJR030C	YJR030C	YJR030C	YPD	SGD	MIPS	1.01	1.50	1.23	1.23	1.81	1.41	1.60	0.63	undocumented	New	has similarity to Yjl181p 	2.368	-1.021	2	c193 tgaCACGAAAaaa	w234 ctaACGCGTcgc							1	c193 tgaCACGAAAaaa										1	w234 ctaACGCGTcgc																										
DNA replication	polymerase delta 55 kD subunit		G1	308	611	YJR043C	POL32	POL32	YPD	SGD	MIPS	1.89	1.34	1.59	1.59	2.23	1.00	1.49	0.67	viable	New	Small subunit of DNA polymerase delta 	1.864	-1.504	3	w127 acaCGCGAAActc	w145 taaACGCGTatg	w 128 aacACGCGaaact												1	w127 acaCGCGAAActc				1	w145 taaACGCGTatg				1	w 128 aacACGCGaaact																					
oxidative phosphorylation	cytochrome-c isoform 1		S/G2	564	117	YJR048W	CYC1	CYC1	YPD	SGD	MIPS	1.24	1.72	1.46	1.46	1.25	1.08	1.16	0.86	viable	New	"Cytochrome-c isoform 1, member of the cytochrome bc1 complex, predominant isoform during aerobic growth "	1.351	2.696	1	w 267 cccACGCGTagg																			1	w 267 cccACGCGTagg																										
unknown	unknown		G1	181	312	YJR054W	YJR054W	YJR054W	YPD	SGD	MIPS	2.79	1.73	2.20	2.20	2.60	1.49	1.97	0.51	undocumented	New	has similarity to Yml047p 	1.846	-0.935	2	c198 agaCGCGAAAtgt	c197 cagACGCGaaatg													1	c198 agaCGCGAAAtgt									1	c197 cagACGCGaaatg																					
"bud site selection, axial"	unknown		G2/M	621	220	YJR092W	BUD4	BUD4	YPD	SGD	MIPS	1.06	1.11	1.02	1.02	2.27	1.55	1.88	1.88	viable	New	required for bud site selection but not for default mating	4.456	2.168	1	AATAGATGACCCGATTTGGAAAAAGGTAAACAACAATG																														1	AATAGATGACCCGATTTGGAAAAAGGTAAACAACAATG															
unknown	unknown		S/G2	567	617	YJR110W	YJR110W	YJR110W	YPD	SGD	MIPS	1.21	2.05	1.30	1.30	1.46	1.30	1.06	0.94	undocumented	New	Protein tyrosine phosphatase (PTPase) of unknown function 	1.544	2.633																																																
cell wall biogenesis	unknown		S	480	652	YJR137C	ECM17	ECM17	YPD	SGD	MIPS	3.46	1.58	2.34	2.34	1.66	1.04	1.31	0.76	viable	New	Putative sulfite reductase (ferredoxin)	2.395	-2.970																																																c 73 AACTAGCTGGGG
branched chain amino acid biosynthesis	transaminase		G1	322	386	YJR148W	BAT2	BAT2	YPD	SGD	MIPS	2.15	1.54	1.82	0.55	1.20	2.18	1.35	1.35	viable	New	Cytosolic branched-chain amino acid transaminase 	3.070	-1.567																																		1	w 609 GATACCAGCATT													
unknown	unknown		G1	313	407	YJR154W	YJR154W	YJR154W	YPD	SGD	MIPS	1.33	1.10	1.10	0.91	2.62	1.10	1.70	0.59	undocumented	New	Protein of unknown function 	1.512	-1.514	2	w114 gtgACGCGTctg	w 296 ataACGCGaagtg																		1	w114 gtgACGCGTctg				1	w 296 ataACGCGaagtg																					w 562 ATTTGTGCGGGG
unknown	hypothetical aryl-alcohol dehydrogenase		G1	158	408	YJR155W	AAD10	AAD10	YPD	SGD	MIPS	1.22	1.04	1.13	0.89	1.63	1.23	1.42	0.71	undocumented	New	Protein with similarity to aryl-alcohol dehydrogenase 	1.620	-0.767																																		1	c 195 TATACCAGCTGT													
sulfate assimilation	adenylylsulfate kinase		S	443	648	YKL001C	MET14	MET14	YPD	SGD	MIPS	1.04	1.08	1.06	1.06	1.36	1.07	1.20	0.83	undocumented	New	"Adenosine-5'-phosphosulfate 3'-phosphotransferase (adenylylsulfate kinase), part of the sulfate assimilation pathway "	3.206	-2.579																																		1	w 397 ATCACCAGCTCG													
sphingolipid metabolism	phosphatidylinositol:ceramide phosphoinositol transferase		S/G2	597	662	YKL004W	AUR1	AUR1	YPD	SGD	MIPS	1.10	1.43	1.14	0.88	1.63	1.07	1.23	0.81	lethal	New	"Phosphatidylinositol:ceramide phosphoinositol transferase (IPC synthase), essential for sphingolipid synthesis"	1.905	2.393																																																
unknown	"similar to Lag1p, has 6 potential transmembrane"		S	427	781	YKL008C	YKL008C	YKL008C	YPD	SGD	MIPS	6.72	1.50	3.17	3.17	1.42	1.28	1.05	1.05	undocumented	New	"Protein with similarity to Lag1p, has 6 potential transmembrane domains "	4.750	-2.442	2	w 545 cgaCGCGAAAaaa	w 551 aaaACGCGACGCG													1	w 545 cgaCGCGAAAaaa									1	w 551 aaaACGCGACGCG																						
pyrimidine metabolism	"UGP1, UDP-glucose pyrophosphorylase"		S/G2	501	249	YKL035W	UGP1	UGP1	YPD	SGD	MIPS	2.19	1.43	1.24	1.24	1.13	2.13	1.37	1.37	lethal	New	UDP-glucose pyrophosphorylase (UTP-glucose-1-P uridylyltransferase) (UGPase)	2.010	-3.122	1	w 244 ctgACGCGcttcc																								1	w 244 ctgACGCGcttcc																						
cytoskeleton	spindle pole body component		G1	258	444	YKL042W	SPC42	SPC42	YPD	SGD	MIPS	1.37	1.11	1.23	1.23	6.23	1.25	2.79	0.36	lethal	Known	Component of the spindle pole body	2.643	-1.290	2	w219 tttACGCGTttt	w183 taaACGCGTaaa																		2	w219 tttACGCGTttt	w183 taaACGCGTaaa																										
pseudohyphal growth	transcription factor		G2/M	715	16	YKL043W	PHD1	PHD1	YPD	SGD	MIPS	1.07	1.10	1.01	0.99	1.84	1.02	1.34	0.74	viable	New	Transcription factor involved in regulation of filamentous growth 	2.011	1.562																																																	
unknown	unknown		G2/M	730	17	YKL044W	YKL044W	YKL044W	YPD	SGD	MIPS	1.50	1.56	1.02	1.02	1.90	1.10	1.45	0.69	undocumented	New	Protein of unknown function 	1.442	1.418																										1	w 487 taaACGCGgtcgg																						
DNA replication	polymerase alpha 58 kD subunit (DNA primase)		G1	210	533	YKL045W	PRI2	PRI2	YPD	SGD	MIPS	2.11	1.56	1.81	1.81	1.71	1.61	1.66	0.60	lethal	Known	"DNA polymerase alpha 58 kDa subunit, DNA primase (large subunit) involved in synthesis of RNA primers for Okazaki fragments"	6.044	-1.087	2	w287 tggACGCGTtga	w262 gtgACGCGTaaa																		2	w287 tggACGCGTtga	w262 gtgACGCGTaaa																										
pseudohyphal growth	protein kinase		S/G2	507	667	YKL048C	ELM1	ELM1	YPD	SGD	MIPS	1.34	1.34	1.34	1.34	1.11	1.32	1.21	0.83	undocumented	New	Serine/threonine protein kinase regulating pseudohyphal growth 	3.080	3.136																																		1	c 535 GTTACCAGCCGG														
unknown	unknown		S/G2	519	666	YKL052C	YKL052C	YKL052C	YPD	SGD	MIPS	1.16	1.00	1.08	1.08	1.96	1.22	1.55	0.65	undocumented	New	Protein of unknown function 	2.161	3.104																																		1	c 370 CTTGCCAGCCAT														
unknown	ER 25 kDa transmembrane protein		S	484	350	YKL065C	YET1	YET1	YPD	SGD	MIPS	1.08	1.67	1.34	0.74	1.36	1.33	1.35	0.74	viable	New	Transmembrane protein of the endoplasmic reticulum 	1.446	-2.990																																																	
unknown	unknown		G1	360	397	YKL066W	YKL066W	YKL066W	YPD	SGD	MIPS	1.19	1.34	1.06	1.06	1.51	1.32	1.41	0.71	undocumented	New	Protein of unknown function 	2.792	-1.762	2	c670 agaCACGAAAcga	c 688 attACGCGccttt							1	c670 agaCACGAAAcga															1	c 688 attACGCGccttt																						
nucleotide metabolism	nucleoside diphosphate kinase		G1	375	396	YKL067W	YNK1	YNK1	YPD	SGD	MIPS	1.23	1.43	1.33	1.33	1.75	1.75	1.75	0.57	viable	New	"Nucleoside diphosphate kinase, responsible for synthesis of all nucleoside triphosphates except ATP "	3.934	-1.908	2	c201 agaCACGAAAcga	c 219 attACGCGccttt							1	c201 agaCACGAAAcga															1	c 219 attACGCGccttt							2	c 247 CTCGCCAGCCCA	c 546 TGCGCCAGCTTC													
unknown	unknown		S/G2	549	678	YKL069W	YKL069W	YKL069W	YPD	SGD	MIPS	1.20	1.09	1.14	0.88	1.47	1.18	1.31	0.76	undocumented	New	Protein of unknown function 	2.741	2.881																																																	
mitosis	centromere protein		G1	300	449	YKL089W	MIF2	MIF2	YPD	SGD	MIPS	1.69	1.33	1.50	1.50	2.02	1.33	1.64	0.61	lethal	New	Catalytic (alpha) subunit of the mitochondrial processing peptidase 	1.963	-1.453	1	w98 ataACGCGTtag																			1	w98 ataACGCGTtag																											
cell wall protein	"beta-1,6-glucan acceptor"		S/G2	512	710	YKL096W	CWP1	CWP1	YPD	SGD	MIPS	3.54	1.99	2.65	2.65	2.38	2.50	2.44	0.41	viable	Known	"Mannoprotein of the cell wall, member of the PAU1 family"	6.010	3.127	3	c 317 aagCGCGAAAttt	c 438 aaaACGCGcatat	c 697 agaACGCGgtatt												1	c 317 aagCGCGAAAttt									2	c 438 aaaACGCGcatat	c 697 agaACGCGgtatt																					
unknown	cell wall protein		S/G2	600	703	YKL096W-A	CWP2	CWP2	YPD	SGD	MIPS	1.19	1.03	1.08	1.08	1.49	1.39	1.44	0.70	viable	Known	"Mannoprotein of the cell wall, member of the PAU1 family"	2.031	2.353																																																	w 578 CTTTTGCCGGGG
cell cycle	negative regulator of swe1 kinase		G1	350	438	YKL101W	HSL1	HSL1	YPD	SGD	MIPS	8.71	2.91	5.03	5.03	3.88	1.85	2.68	0.37	viable	Known	Serine/threonine protein kinase that interacts genetically with histone mutations 	4.447	-1.701	5	w 411 agaACGCGcatct	w 392 aagACGCGccctt	w 342 ttcACGCGctttg	w 50 gtaACGCGctttt	c 359 acgACGCGccttc																				5	w 411 agaACGCGcatct	w 392 aagACGCGccctt	w 342 ttcACGCGctttg	w 50 gtaACGCGctttt	c 359 acgACGCGccttc			1	w 423 AGAACCAGCAAA				1	w 423 AGAACCAGCAAA									
protein degradation	vacuolar aminopeptidase ysc1		G1	268	338	YKL103C	LAP4	LAP4	YPD	SGD	MIPS	2.14	1.60	1.85	1.85	1.01	1.89	1.36	0.73	viable	New	Aminopeptidase I (yscI) (API) of the vacuole 	2.100	-1.330	1	c404 cctCACGAAAtgg								1	c404 cctCACGAAAtgg																																					
cell wall biogenesis	chitin biosynthesis		M/G1	50	60	YKL104C	GFA1	GFA1	YPD	SGD	MIPS	1.06	1.33	1.19	0.84	1.41	1.05	1.16	0.86	undocumented	New	"Glucosamine--fructose-6-phosphate aminotransferase, isomerizing (hexosephosphate aminotransferase), first step in chitin biosynthesis pathway "	1.617	0.014	2	w 106 AAAGCCAGCATA	w 106 AAAGCCAGCATA																							1	w 415 gtaACGCGcggct							1	w 106 AAAGCCAGCATA				1	w 106 AAAGCCAGCATA								
DNA replication	unknown; interacts with Dpb11p		G1	171	428	YKL108W	YKL108W	SLD2	YPD	SGD	MIPS	1.08	1.12	1.10	1.10	1.58	1.35	1.46	0.68	undocumented	New	novel	3.528	-0.826	2	w499 aatCACGAAAaca	w112 tttACGCGTatg							1	w499 aatCACGAAAaca										1	w112 tttACGCGTatg																										
DNA repair	ssDNA endonuclease		G1	180	512	YKL113C	RAD27	RAD27	YPD	SGD	MIPS	4.64	2.09	3.11	3.11	2.32	1.67	1.97	0.51	viable	Known	Single-stranded DNA endonuclease and 5'-3' exonuclease that functions in the MSH2-MLH1-PMS1-dependent mismatch repair system; promoter contains 2 MluI cell cycle box (MCB) elements	3.445	-0.932	5	c245 aaaCACGAAActa	w495 tttACGCGTttt	w445 aaaACGCGTaaa	w374 taaACGCGTcat	w309 aggACGCGTaaa				1	c245 aaaCACGAAActa										4	w495 tttACGCGTttt	w445 aaaACGCGTaaa	w374 taaACGCGTcat	w309 aggACGCGTaaa																							
unknown	putative protein kinase		M/G1	77	281	YKL116C	YKL116C	YKL116C	YPD	SGD	MIPS	1.13	1.05	1.03	1.03	1.82	1.09	1.29	0.77	undocumented	New	most similar to GIN4	5.073	-0.212																1	c 320 caaCGCGAAAcat									3	w 129 tcaACGCGgggtg	c 319 gcaACGCGaaaca	c 599 cttACGCGattta																			
glycolysis	phosphoglucomutase		G1	402	800	YKL127W	PGM1	PGM1	YPD	SGD	MIPS	2.19	3.06	2.59	2.59	2.62	1.06	1.67	0.60	viable	New	"Phosphoglucomutase, minor isoform, interconverts Glc-1-P and Glc-6-P "	3.412	-2.234	3	c144 aaaCGCGAAAtac	c 143 taaACGCGaaata	c 525 catACGCGctacc												1	c144 aaaCGCGAAAtac									2	c 143 taaACGCGaaata	c 525 catACGCGctacc																				c 480 TAACAGCTGGGG
cell polarity	asymmetric HO expression		G2/M	666	221	YKL130C	SHE2	SHE2	YPD	SGD	MIPS	1.20	1.28	1.24	0.81	1.13	2.24	1.59	1.59	viable	New	Protein required for mother cell-specific expression of HO 	2.370	1.876																																																
unknown	unknown		M/G1	27	329	YKL151C	YKL151C	YKL151C	YPD	SGD	MIPS	2.06	1.22	1.59	0.63	1.17	1.16	1.17	1.17	undocumented	New	Protein of unknown function 	1.506	0.252	1	w 238 GTTACCAGCTTG																																1	w 238 GTTACCAGCTTG													
unknown	similar to members of the Pir1p/Hsp150p/Pir3p		M/G1	49	278	YKL163W	PIR3	PIR3	YPD	SGD	MIPS	4.46	4.35	4.40	0.23	1.64	1.51	1.57	1.57	viable	New	has 80% identity to Hsp150p	12.510	0.028																																																
unknown	Pir1p/Hsp150p/Pir3p family		M/G1	59	277	YKL164C	PIR1	PIR1	YPD	SGD	MIPS	3.83	5.56	4.61	0.22	1.23	1.51	1.36	1.36	viable	New	"has 84% identity to Hsp150p ; unlike HSP150, PIR1 transcription is not induced by heat; pir1 pir2 double null mutant has slow growth and is heat sensitive"	15.990	-0.080	3	w 668 AGCACCAGCACT	w 433 TCGGCCAGCTTG	C 212 TATACCAGCGTT																														3	w 668 AGCACCAGCACT	w 433 TCGGCCAGCTTG	C 212 TATACCAGCGTT											
sporulation	morphogenesis checkpoint		G1	259	447	YKL165C	MCD4	MCD4	YPD	SGD	MIPS	2.45	1.61	1.99	1.99	1.83	1.32	1.55	0.64	lethal	New	morphogenesis checkpoint protein; 	2.577	-1.295	2	w119 aaaCGCGAAAaaa	w 120 taaACGCGaaaaa													1	w119 aaaCGCGAAAaaa									1	w 120 taaACGCGaaaaa																					
unknown	unknown; EBNA1-binding protein homolog		G2/M	656	366	YKL172W	YKL172W	EBP2	YPD	SGD	MIPS	1.31	1.75	1.52	0.66	1.83	1.23	1.22	0.82	undocumented	New	Protein of unknown function 	6.716	1.939										1	c 351 catCACGAAAtca																																					
unknown	unknown		M/G1	73	303	YKL177W	YKL177W	YKL177W	YPD	SGD	MIPS	2.00	1.50	1.15	0.87	1.46	1.20	1.32	0.76	undocumented	New	Protein of unknown function 	4.526	-0.171																																																
mating	a-factor receptor		M/G1	60	304	YKL178C	STE3	STE3	YPD	SGD	MIPS	1.43	1.30	1.05	0.95	1.77	1.01	1.34	0.75	undocumented	New	"Pheromone a-factor receptor, seven-transmembrane domain protein "	4.254	-0.080	1	C 360 TGTACCAGCGCT																																1	C 360 TGTACCAGCGCT									1	w 595 TTTCCCACTAAGGAAA			
fatty acid metabolism	"fatty-acyl-CoA synthase, beta subunit"		M/G1	106	260	YKL182W	FAS1	FAS1	YPD	SGD	MIPS	1.15	1.40	1.10	1.10	1.34	1.16	1.08	0.93	undocumented	New	"Fatty-acyl-CoA synthase, beta chain (contains acetyl transferase, enoyl reductase, dehydratase, and malonyl/palmitoyl transferase)"	1.377	-0.490																																																
unknown	unknown		S/G2	599	110	YKL183W	YKL183W	YKL183W	YPD	SGD	MIPS	1.46	1.47	1.00	1.00	1.49	1.43	1.46	0.69	undocumented	New	Protein of unknown function 	1.335	2.367																																																
mating type switching	transcription factor		M/G1	35	279	YKL185W	ASH1	ASH1	YPD	SGD	MIPS	3.08	1.41	2.08	0.48	1.15	1.32	1.07	0.93	viable	Known	asymmetric synthesis of HO; also involved in pseudohyphal development	11.800	0.159	4	w 643 CTAGCCAGCAAA	w 467 TGAGCCAGCAAT	w 643 CTAGCCAGCAAA	w 467 TGAGCCAGCAAT																					1	c 667 taaACGCGcgcag							2	w 643 CTAGCCAGCAAA	w 467 TGAGCCAGCAAT			2	w 643 CTAGCCAGCAAA	w 467 TGAGCCAGCAAT							
mating	a-factor exporter (ABC superfamily)		G2/M	786	58	YKL209C	STE6	STE6	YPD	SGD	MIPS	1.82	1.52	1.66	0.60	1.15	1.03	1.05	1.05	viable	New	"transporter, responsible for a-factor export"	1.771	0.793																										2	w 698 ttaACGCGcgata	w 394 ataACGCGacata																				
DNA replication (putative)	interacts with DNA		S	462	685	YKR010C	TOF2	TOF2	YPD	SGD	MIPS	1.49	1.48	1.49	1.49	1.14	1.24	1.19	0.84	viable	New	Protein that interacts with DNA topoisomerase I 	2.672	-2.750	1	w 242 catCACGAAAaaa								1	w 242 catCACGAAAaaa																																					
unknown	unknown		G1	321	479	YKR012C	YKR012C	YKR012C	YPD	SGD	MIPS	3.47	3.69	3.58	3.58	3.34	2.78	3.05	0.33	undocumented	New	novel; questionable ORF	6.980	-1.564																																		2	c 274 CCTACCAGCACA	c 643 ATTACCAGCTAC												
unknown	similar to plant PR-pathogen related proteins		G1	334	480	YKR013W	PRY2	PRY2	YPD	SGD	MIPS	7.02	4.98	5.91	5.91	4.22	4.00	4.11	0.24	undocumented	New	expressed under starvation conditions	9.805	-1.601	3	c209 ataCACGAAAtgt	w365 attCGCGAAAtgc	c380 cgcCGCGAAAgtc						1	c209 ataCACGAAAtgt					2	w365 attCGCGAAAtgc	c380 cgcCGCGAAAgtc																														
unknown	unknown		G2/M	678	190	YKR021W	YKR021W	YKR021W	YPD	SGD	MIPS	1.21	1.28	1.25	0.80	1.29	1.77	1.51	1.51	undocumented	New	strong similarity to hypothetical protein YJL084c	1.856	1.762																																																
cytoskeleton	spindle pole body component		S	450	744	YKR037C	YKR037C	SPC34	YPD	SGD	MIPS	1.77	1.68	1.72	1.72	2.06	1.06	1.48	0.68	lethal	New	aka SPC34; spindle pole body protein	2.284	-2.624	1	w 99 aagCGCGAAAata														1	w 99 aagCGCGAAAata																															
transport	general amino acid permease		S/G2	602	127	YKR039W	GAP1	GAP1	YPD	SGD	MIPS	1.40	1.39	1.40	0.72	1.41	2.06	1.21	1.21	viable	New	"General amino acid permease, proton symport transporter for all naturally-occuring L-amino acids, 4-aminobutyric acid (GABA), ornithine, citrulline, some D-amino acids, and some toxic analogs "	2.567	2.334																																																
unknown	unknown		S/G2	543	623	YKR041W	YKR041W	YKR041W	YPD	SGD	MIPS	1.79	1.10	1.40	0.71	1.81	1.05	1.31	0.76	undocumented	New	Protein of unknown function 	2.106	2.956																																																
aging	unknown		G2/M	766	66	YKR042W	UTH1	UTH1	YPD	SGD	MIPS	4.67	3.13	3.82	0.26	1.33	2.10	1.67	1.67	undocumented	New	"Protein involved in the aging process, mutants have longer lifespan and better viability upon starvation "	3.144	1.029																										1	w 617 gctACGCGcgggc																					
unknown	unknown		G2/M	615	123	YKR046C	YKR046C	YKR046C	YPD	SGD	MIPS	1.44	1.32	1.37	0.73	1.40	1.25	1.32	0.76	undocumented	New	Protein of unknown function 	1.803	2.243																																		1	c 357 CCTGCCAGCAAA													
methionine biosynthesis	siroheme synthase		S	461	645	YKR069W	MET1	MET1	YPD	SGD	MIPS	1.64	1.08	1.23	1.23	1.79	1.01	1.35	0.74	viable	New	Siroheme synthase involved in methionine metabolism 	1.709	-2.727																																																
unknown	unknown		G1	152	562	YKR077W	YKR077W	YKR077W	YPD	SGD	MIPS	1.05	1.69	1.33	1.33	3.45	1.19	2.03	0.49	undocumented	New	related to YOR066W	6.829	-0.726	4	w184 tgaCGCGAAAcgc	w335 tacACGCGTtcc	w178 gaaACGCGTtaa	w 185 ttgACGCGaaacg											1	w184 tgaCGCGAAAcgc				2	w335 tacACGCGTtcc	w178 gaaACGCGTtaa			1	w 185 ttgACGCGaaacg																					
unknown	unknown		G2/M	769	103	YKR079C	YKR079C	YKR079C	YPD	SGD	MIPS	1.85	1.11	1.43	0.70	2.10	1.07	1.40	0.71	undocumented	New	Protein of unknown function 	1.429	0.975																																																
unknown	unknown		G1	328	439	YKR090W	YKR090W	YKR090W	YPD	SGD	MIPS	2.24	1.74	1.97	1.97	2.24	1.12	1.58	0.63	undocumented	New	similarity to chicken Lim protein kinase and Islet proteins	2.050	-1.571	1	c 254 aggACGCGaattg																								1	c 254 aggACGCGaattg																					
unknown	unknown; suppressor of Rad53 lethality		G1	323	357	YKR091W	YKR091W	SRL3	YPD	SGD	MIPS	1.13	1.23	1.04	1.04	2.67	1.54	2.03	0.49	undocumented	New	Suppressor of Rad53 lethality	2.210	-1.568	1	w501 tttACGCGTcat																			1	w501 tttACGCGTcat												1	w 665 TTAGCCAGCCTT													w 384 TTAGTTCTGGGG
unknown	ATP-binding cassette (ABC) superfamily		M/G1	8	27	YKR103W	YKR103W	YKR103W	YPD	SGD	MIPS	1.61	1.46	1.05	0.95	1.52	1.02	1.25	0.80	undocumented	New	"Member of the ATP-binding cassette (ABC) superfamily, possible pseudogene "	1.582	0.424																																																
diepoxybutane and mitomycin C resistance	unknown		G1	263	522	YLL002W	KIM2	KIM2	YPD	SGD	MIPS	1.82	2.06	1.94	1.94	1.21	1.33	1.27	0.79	undocumented	New	Protein involved in resistance to mutagens such as diepoxybutane and mitomycin C	3.831	-1.307	3	c130 gaaCACGAAAagt	w 444 ccgACGCGaggaa	c 123 acaACGCGaacac						1	c130 gaaCACGAAAagt															2	w 444 ccgACGCGaggaa	c 123 acaACGCGaacac																				
unknown	similar to human triacylglycerol lipase		G1	404	603	YLL012W	YLL012W	YLL012W	YPD	SGD	MIPS	3.80	1.29	2.21	2.21	2.88	1.82	2.29	0.44	undocumented	New	Protein with similarity to YLR020C	1.716	-2.234	1	w 203 gaaACGCGaagga																								1	w 203 gaaACGCGaagga																					
chromatin structure	interacts with histone acetyltransferase		G1	310	531	YLL022C	HIF1	HIF1	YPD	SGD	MIPS	2.16	2.82	2.47	2.47	1.47	1.72	1.59	0.63	viable	New	aka HIF1; Hat1 Interacting Factor 1	4.368	-1.508	3	c93 aaaCGCGAAActt	w515 aaaACGCGTcac	c 92 aaaACGCGaaact												1	c93 aaaCGCGAAActt				1	w515 aaaACGCGTcac				1	c 92 aaaACGCGaaact																					
unknown	major facilitator superfamily		G2/M	700	162	YLL028W	YLL028W	YLL028W	YPD	SGD	MIPS	1.54	1.92	1.72	0.58	1.11	1.14	1.12	1.12	undocumented	New	Member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 	5.468	1.621																										1	w 482 cggACGCGgaagg							1	w 677 TTTGCCAGCCAG													c 605 ATTAGCGTGGGG
unknown	unknown		S/G2	589	673	YLL032C	YLL032C	YLL032C	YPD	SGD	MIPS	1.17	1.22	1.02	1.02	1.29	1.00	1.14	0.88	undocumented	New	weak similarity to SCP160	4.251	2.456																																																
unknown	similar to Gap1p and other amino acid permeases		S	482	644	YLL061W	YLL061W	YLL061W	YPD	SGD	MIPS	1.83	1.09	1.30	1.30	2.02	1.25	1.59	0.63	undocumented	New	Protein with similarity to Gap1p and other amino acid permeases 	1.604	-2.970																																		1	w 561 TGCGCCAGCAAT													
unknown	unknown		S	439	647	YLL062C	YLL062C	YLL062C	YPD	SGD	MIPS	3.01	1.06	1.68	1.68	1.11	1.23	1.17	0.85	undocumented	New	Protein of unknown function 	2.518	-2.542																																		2	c 476 TTCACCAGCGAT	c 547 CCAACCAGCCGT												
unknown	similar to other subtelomerically-encoded proteins		G1	136	593	YLL066C	YLL066C	YLL066C	YPD	SGD	MIPS	2.18	1.83	2.00	2.00	1.02	1.01	1.02	0.98	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.717	-0.645	1	w42 tgtCACGAAAtag								1	w42 tgtCACGAAAtag																																					w 585 AGATTTCTGGGG
unknown	similar to other subtelomerically-encoded proteins		G1	117	581	YLL067C	YLL067C	YLL067C	YPD	SGD	MIPS	2.04	1.59	1.80	1.80	1.28	1.09	1.08	0.92	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.423	-0.536	1	w42 tgtCACGAAAtag								1	w42 tgtCACGAAAtag																																					
unknown	unknown		M/G1	34	29	YLR013W	YLR013W	YLR013W	YPD	SGD	MIPS	1.46	1.57	1.04	1.04	1.29	1.14	1.21	0.83	undocumented	New	Protein of unknown function 	1.430	0.159																																																
DNA repair	DNA helicase		G1	134	461	YLR032W	RAD5	RAD5	YPD	SGD	MIPS	1.04	1.96	1.42	1.42	2.00	1.12	1.50	0.67	viable	New	Protein required for meiosis-specific double-stranded break repair and meiotic recombination 	1.528	-0.623	2	w140 tttACGCGTcat	c 165 acgACGCGccaac																		1	w140 tttACGCGTcat				1	c 165 acgACGCGccaac																					
unknown	unknown		G2/M	686	170	YLR034C	YLR034C	YLR034C	YPD	SGD	MIPS	1.73	1.33	1.52	0.66	1.51	1.30	1.08	0.93	undocumented	New	Protein with similarity to Smf2p 	2.163	1.711																																																
unknown	unknown		M/G1	31	305	YLR040C	YLR040C	YLR040C	YPD	SGD	MIPS	1.73	1.05	1.28	1.28	2.22	1.05	1.53	0.65	undocumented	New	Protein of unknown function 	1.847	0.186																																																
unknown	unknown		M/G1	30	26	YLR041W	YLR041W	YLR041W	YPD	SGD	MIPS	1.76	1.20	1.21	0.83	1.24	1.23	1.24	0.81	undocumented	New	Protein of unknown function 	2.543	0.202	1	C 256 TATGCCAGCCAA																																1	C 256 TATGCCAGCCAA													
cytoskeleton	spindle pole body component		S	449	736	YLR045C	STU2	STU2	YPD	SGD	MIPS	2.57	1.67	2.07	2.07	1.56	1.28	1.41	0.71	lethal	New	Component of the spindle pole body	3.242	-2.624	2	c 183 cgaCACGAAAaaa	c 393 ttgCGCGAAAggt							1	c 183 cgaCACGAAAaaa					1	c 393 ttgCGCGAAAggt																	1	c 532 TTAACCAGCAAT				1	c 532 TTAACCAGCAAT						1		
unknown	unknown		G1	128	564	YLR049C	YLR049C	YLR049C	YPD	SGD	MIPS	5.33	1.95	3.23	3.23	1.73	1.79	1.76	0.57	viable	New	novel	8.653	-0.596	4	c291 ggaCGCGAAActt	w305 gaaACGCGTcac	w60 atcACGCGTaca	c 290 aggACGCGaaact											1	c291 ggaCGCGAAActt				2	w305 gaaACGCGTcac	w60 atcACGCGTaca			1	c 290 aggACGCGaaact							1	c 270 AAAACCAGCCAT														
unknown	similar to C-terminal region of human MAC30		G1	329	393	YLR050C	YLR050C	YLR050C	YPD	SGD	MIPS	1.26	1.03	1.10	1.10	2.13	1.54	1.81	0.55	undocumented	New	Protein with similarity to C-terminal region of human MAC30 	1.630	-1.571																																																	
sterol metabolism	C-5 sterol desaturase		S/G2	568	143	YLR056W	ERG3	ERG3	YPD	SGD	MIPS	2.44	1.86	2.13	2.13	1.69	1.04	1.33	0.75	viable	New	"C-5 sterol desaturase, an iron non-heme oxygen-requiring enzyme of the ergosterol biosynthesis pathway "	1.657	2.611	2	w 516 aacCGCGAAAcga	w 469 acgACGCGTtgt													1	w 516 aacCGCGAAAcga				1	w 469 acgACGCGTtgt																											
unknown	unknown		G2/M	733	210	YLR057W	YLR057W	YLR057W	YPD	SGD	MIPS	1.35	1.41	1.02	1.02	2.17	1.16	1.59	1.59	undocumented	New	weak similarity to mouse alpha-mannosidase	2.159	1.389																																																	
one-carbon interconversion	serine hydroxymethyltransferase		S/G2	583	113	YLR058C	SHM2	SHM2	YPD	SGD	MIPS	1.15	1.82	1.45	0.69	2.15	1.02	1.45	0.69	viable	New	"Serine hydroxymethyltransferase (glycine hydroxymethyltransferase), interconverts serine and glycine "	1.550	2.485	1	w 289 acaCACGAAAcat								1	w 289 acaCACGAAAcat																																						
cell cycle	Cdc28p-Clb5 protein kinase inhibitor		M/G1	67	283	YLR079W	SIC1	SIC1	YPD	SGD	MIPS	1.46	1.22	1.34	1.34	1.56	1.27	1.41	0.71	viable	Known	Clb kinase inhibitor	7.374	-0.131	3	w 170 ATAGCCAGCACA	w 170 ATAGCCAGCACA	C 146 CAAGCCAGCCAT																						1	c 134 gcgACGCGaacaa							2	w 170 ATAGCCAGCACA	C 146 CAAGCCAGCCAT			1	w 170 ATAGCCAGCACA									
unknown	unknown		G2/M	674	242	YLR084C	YLR084C	YLR084C	YPD	SGD	MIPS	1.69	1.55	1.62	1.62	1.24	1.71	1.46	1.46	undocumented	New	novel	2.110	1.824	1	c 290 CCTAATTTGGGAATTTGTCAATAA														1	c 222 tatCGCGAAAaaa															1	c 290 CCTAATTTGGGAATTTGTCAATAA																
unknown	unknown		G2/M	701	613	YLR095C	YLR095C	YLR095C	YPD	SGD	MIPS	1.35	1.37	1.36	1.36	1.08	1.28	1.18	0.85	undocumented	New	Protein of unknown function 	2.520	1.621										1	c 361 ttaCACGAAAttc															1	c 580 gacACGCGagttg							2	c 593 TGCACCAGCCAC	c 640 ATGACCAGCAAC			1	c 640 ATGACCAGCAAC									
ser/thr metabolism	CHA1 activator		G2/M	637	624	YLR098C	CHA4	CHA4	YPD	SGD	MIPS	1.33	1.13	1.09	1.09	1.20	1.30	1.04	1.04	undocumented	New	"Zinc-finger protein necessary for activation of CHA1, has a Zn[2]-Cys[6] fungal-type binuclear cluster "	1.711	2.051																																		1	c 345 ATGGCCAGCATC				1	c 345 ATGGCCAGCATC									
unknown	unknown		S/G2	584	44	YLR099C	YLR099C	YLR099C	YPD	SGD	MIPS	2.32	1.21	1.68	1.68	1.39	1.43	1.41	0.71	undocumented	New	Protein of unknown function 	1.828	2.485	1	c 279 attCACGAAAccg								1	c 279 attCACGAAAccg																																						
unknown	unknown		G2/M	744	132	YLR100W	YLR100W	YLR100W	YPD	SGD	MIPS	1.59	1.22	1.14	1.14	1.12	1.91	1.31	1.31	undocumented	New	Protein of unknown function 	1.740	1.282										1	w 615 attCACGAAAccg																																						
DNA replication	pre-replicative complex subunit (putative)		G1	234	506	YLR103C	CDC45	CDC45	YPD	SGD	MIPS	2.01	1.28	1.60	1.60	1.83	1.43	1.62	0.62	lethal	Known	functions with ORC complex and MCM proteins in the initiation of DNA replication; promoter has two perfect MluI cell cycle (MCB) boxes	4.782	-1.206	4	w406 tttACGCGTacc	w380 ccaACGCGTatt	c 370 aaaACGCGaagaa	c 442 gggACGCGcccat																2	w406 tttACGCGTacc	w380 ccaACGCGTatt			2	c 370 aaaACGCGaagaa	c 442 gggACGCGcccat																					
protein processing	GPI-anchored aspartic protease		G1	324	460	YLR121C	YPS4	YPS4	YPD	SGD	MIPS	4.77	1.71	2.86	2.86	1.77	3.03	2.31	0.43	viable	New	"Yapsin 4, GPI-anchored aspartyl protease "	6.270	-1.568	1	c247 aagCGCGAAAaaa														1	c247 aagCGCGAAAaaa																																
transcription	CUP1 regulator		G2/M	651	232	YLR131C	ACE2	ACE2	YPD	SGD	MIPS	1.03	1.39	1.16	1.16	1.35	1.92	1.19	1.19	viable	Known	has 37% identity overall to Swi5p 	5.996	1.961																																																	
unknown	unknown		G1	316	388	YLR135W	YLR135W	YLR135W	YPD	SGD	MIPS	1.11	1.09	1.10	1.10	1.76	1.25	1.48	0.67	undocumented	New	Protein of unknown function 	1.340	-1.537	2	w118 taaCGCGAAAgct	w 119 ataACGCGaaagc													1	w118 taaCGCGAAAgct									1	w 119 ataACGCGaaagc																						c 498 AAAAAACCGGGG
glutamate biosynthesis	proline oxidase		S/G2	559	248	YLR142W	PUT1	PUT1	YPD	SGD	MIPS	1.94	1.54	1.12	1.12	1.07	1.66	1.33	1.33	undocumented	New	"Proline oxidase, first step in synthesis of glutamate from proline "	2.486	2.760																																																	
unknown	unknown		G1	344	400	YLR151C	YLR151C	YLR151C	YPD	SGD	MIPS	2.05	1.50	1.75	1.75	1.92	1.33	1.60	0.63	undocumented	New	novel	1.443	-1.631	2	c 83 cttACGCGgatcc	c 136 aatACGCGattgg																							2	c 83 cttACGCGgatcc	c 136 aatACGCGattgg						1	w 350 TACGCCAGCATG													
unknown	unknown		G1	363	609	YLR154C	YLR154C	YLR154C	YPD	SGD	MIPS	1.38	1.42	1.40	1.40	1.63	1.03	1.26	0.79	undocumented	New	novel	2.181	-1.784	1	w106 aaaACGCGTtag																			1	w106 aaaACGCGTtag																										c 381 GTAATTGCGGGG
unknown	unknown		S/G2	590	166	YLR169W	YLR169W	YLR169W	YPD	SGD	MIPS	1.32	1.27	1.02	0.98	1.28	1.06	1.16	0.86	undocumented	New	Protein of unknown function 	1.487	2.453																																																
methionine metabolism	S-adenosylmethionine synthetase		S/G2	521	635	YLR180W	SAM1	SAM1	YPD	SGD	MIPS	1.38	1.10	1.12	1.12	2.17	1.02	1.49	0.67	undocumented	New	S-adenosylmethionine synthetase 1 	2.373	3.087																																																
unknown	unknown		G1	291	540	YLR183C	YLR183C	YLR183C	YPD	SGD	MIPS	9.67	5.16	7.06	7.06	3.46	1.75	2.46	0.41	undocumented	New	"contains a forkhead-associated (FHA) domains, which is found almost entirely among nuclear proteins"	10.310	-1.421	3	c176 aaaCACGAAAgca	w230 aaaCGCGAAAaaa	w 231 aaaACGCGaaaaa						1	c176 aaaCACGAAAgca					1	w230 aaaCGCGAAAaaa									1	w 231 aaaACGCGaaaaa																					
unknown	unknown		G2/M	689	236	YLR190W	YLR190W	YLR190W	YPD	SGD	MIPS	2.15	2.17	2.16	0.46	4.05	5.35	4.66	4.66	undocumented	New	novel	10.650	1.701																										1	c 177 cacACGCGattct																					
unknown	unknown		M/G1	92	292	YLR194C	YLR194C	YLR194C	YPD	SGD	MIPS	1.30	1.75	1.51	0.66	2.97	2.94	2.95	0.34	undocumented	New	novel	3.997	-0.337	1	C 253 AAAGCCAGCCAT								1	c 339 gtaCACGAAAact										1	w 545 ttaACGCGTtga												1	C 253 AAAGCCAGCCAT													
unknown	similar to human purine nucleoside phosphorylase		S/G2	523	719	YLR209C	YLR209C	YLR209C	YPD	SGD	MIPS	1.98	1.26	1.58	1.58	1.48	1.14	1.30	1.30	undocumented	New	Protein with similarity to human purine nucleoside phosphorylase	1.893	3.078																																																
cell cycle	G2/M cyclin		S/G2	489	665	YLR210W	CLB4	CLB4	YPD	SGD	MIPS	1.09	1.04	1.02	1.02	2.08	1.01	1.45	0.69	viable	Known	G2/M-phase-specific cyclin 	3.080	-3.011	3	w211 caaACGCGTtaa	w176 aaaACGCGTcgc	c 172 tacACGCGACGCG																	2	w211 caaACGCGTtaa	w176 aaaACGCGTcgc			1	c 172 tacACGCGACGCG																					
cytoskeleton	gamma-tubulin		G1	272	451	YLR212C	TUB4	TUB4	YPD	SGD	MIPS	1.35	1.76	1.54	1.54	1.31	1.11	1.21	0.83	lethal	New	"Gamma tubulin, required for microtubule organization and nuclear division "	3.546	-1.349	1	w132 agaACGCGTtaa																			1	w132 agaACGCGTtaa																										w 76 TAAACACCGGGG
iron homeostasis	ferric (and cupric) reductase		G2/M	672	99	YLR214W	FRE1	FRE1	YPD	SGD	MIPS	1.36	1.89	1.60	0.62	1.91	1.41	1.64	0.61	viable	New	"Ferric and cupric reductase, acts on ferric iron chelates external to the cell "	1.609	1.844										1	c 640 ttgCACGAAAtaa																							2	w 673 GGCACCAGCTGT	c 564 AATACCAGCTAA												
unknown	unknown		S/G2	535	359	YLR225C	YLR225C	YLR225C	YPD	SGD	MIPS	1.22	1.13	1.18	1.18	1.36	1.27	1.31	0.76	undocumented	New	Protein of unknown function 	1.701	3.027																																		1	c 521 ACCACCAGCATC													
unknown	similar to rat kynureninase (PIR:PS0370)		G1	314	313	YLR231C	YLR231C	YLR231C	YPD	SGD	MIPS	1.40	1.04	1.21	0.83	1.05	1.12	1.04	0.97	undocumented	New	"Protein with weak similarity to rat kynureninase (PIR:PS0370), likely active in tryptophan degradation and nicotinic acid synthesis "	3.395	-1.515	1	w218 accCACGAAAata								1	w218 accCACGAAAata																																					
telomere length regulation	putative end-binding protein		G1	231	489	YLR233C	EST1	EST1	YPD	SGD	MIPS	2.11	1.47	1.76	1.76	1.01	1.35	1.17	0.86	viable	New	Putative component of telomerase 	1.331	-1.176	2	c138 gaaCGCGAAAatc	c 137 tgaACGCGaaaat													1	c138 gaaCGCGAAAatc									1	c 137 tgaACGCGaaaat																					
DNA replication	DNA topoisomerase III		G1	327	463	YLR234W	TOP3	TOP3	YPD	SGD	MIPS	1.74	2.97	1.31	1.31	1.59	1.02	1.27	0.79	viable	New	"DNA topoisomerase III, relaxes negatively (but not positively) supercoiled DNA "	2.340	-1.571	2	w133 gaaCGCGAAAatc	w 134 tgaACGCGaaaat													1	w133 gaaCGCGAAAatc									1	w 134 tgaACGCGaaaat																					
unknown	unknown		G1	280	422	YLR235C	YLR235C	YLR235C		SGD	MIPS	1.45	1.56	1.04	1.04	1.47	1.31	1.39	0.72	undocumented	New	questionable ORF	2.436	-1.375	1	c 14 ttcACGCGcgact																								1	c 14 ttcACGCGcgact																					
unknown	unknown		G1	289	423	YLR236C	YLR236C	YLR236C	YPD	SGD	MIPS	1.18	1.76	1.22	1.22	1.48	1.37	1.43	0.70	undocumented	New	hypothetical protein	1.832	-1.413																																														
unknown	unknown		G2/M	764	83	YLR254C	YLR254C	YLR254C	YPD	SGD	MIPS	2.40	1.01	1.54	0.65	1.91	2.64	2.24	2.24	undocumented	New	novel	1.905	1.052																										1	c 554 aagACGCGatcgt							1	c 501 TACACCAGCAGT											
glucose repression	(putative) Glc7p regulatory subunit		M/G1	84	322	YLR273C	PIG1	PIG1	YPD	SGD	MIPS	1.03	1.18	1.10	0.91	3.34	1.91	2.53	2.53	viable	New	"Protein that interacts with Gsy2p, possible regulatory subunit for the PP1 family protein phosphatase Glc7p "	2.583	-0.264	2	C 301 TATGCCAGCCTT	c 387 TTTCCCTTTTAGGAAA													2	w 412 tttCGCGAAActg	c 415 tttCGCGAAAtct			1	w 209 attACGCGTtta												1	C 301 TATGCCAGCCTT											
DNA replication	MCM initiator complex		M/G1	11	74	YLR274W	CDC46	CDC46	YPD	SGD	MIPS	1.52	1.67	1.59	0.63	2.08	2.72	2.38	2.38	lethal	Known	aka MCM5; MCM proteins are components of the prereplication complex because association of MCM proteins with replication origins requires both Orc1p and Cdc6 function	6.751	0.385																																														
cell wall biogenesis	endochitinase		G1	232	287	YLR286C	CTS1	CTS1	YPD	SGD	MIPS	1.26	1.04	1.15	0.87	1.26	1.33	1.03	1.03	viable	Known	null mutant is defective in cell separation but has roughly normal level of cellular chitin	11.200	-1.187																																		3	w 529 ATAACCAGCCTC	c 549 GGGACCAGCATT	c 569 TTCACCAGCGGC		1	c 549 GGGACCAGCATT				1	c 251 TTTCCCTTTAAGGAAA	
DNA repair; DNA damage checkpoint	activates exonuclease		S/G2	490	618	YLR288C	MEC3	MEC3	YPD	SGD	MIPS	1.09	1.02	1.04	0.97	1.61	1.05	1.24	0.81	viable	New	Checkpoint protein required for arrest in G2 after DNA damage and for delaying in G1- and S-phase during DNA damage 	1.402	-3.011																																														
unknown	unknown		G2/M	768	71	YLR297W	YLR297W	YLR297W	YPD	SGD	MIPS	1.01	1.02	1.01	1.01	1.90	1.69	1.79	1.79	undocumented	New	Protein of unknown function 	4.424	0.986																					1	w 458 cgcACGCGTatt																								
cell wall biogenesis	"exo-beta-1,3-glucanase"		G1	381	756	YLR300W	EXG1	EXG1	YPD	SGD	MIPS	6.19	1.68	3.22	3.22	1.65	1.54	1.59	0.63	viable	New	"Exo-beta-1,3-glucanase (I/II), major isoform involved in cell wall beta-glucan assembly"	2.926	-1.944	4	w 683 gagACGCGacttc	w 581 catACGCGcattg	c 477 gcaACGCGcctgg	c 617 gaaACGCGcagta																					4	w 683 gagACGCGacttc	w 581 catACGCGcattg	c 477 gcaACGCGcctgg	c 617 gaaACGCGcagta				1	w 665 GATGCCAGCATA											
unknown	unknown		S/G2	487	640	YLR302C	YLR302C	YLR302C	YPD	SGD	MIPS	2.04	1.21	1.57	1.57	1.54	1.00	1.24	0.81	undocumented	New	Protein of unknown function 	1.565	-3.001																																														
methionine biosynthesis	O-acetylhomoserine sulfhydrylase		S/G2	491	655	YLR303W	MET17	MET17	YPD	SGD	MIPS	3.19	1.09	1.86	1.86	1.33	1.30	1.31	0.76	viable	New	"O-acetylhomoserine sulfhydrylase (OAH SHLase), converts O-acetylhomoserine into homocysteine "	4.915	-3.011																																														
"bud site selection, bipolar"	interacts with MAPKKs		G1	251	503	YLR313C	SPH1	SPH1	YPD	SGD	MIPS	2.31	1.44	1.82	1.82	1.73	1.54	1.63	0.61	viable	New	Protein involved in schmoo formation and required for bipolar bud site selection; Spa2 homologue	4.271	-1.262	2	w163 gagACGCGTaaa	w 170 aaaACGCGagacg																		1	w163 gagACGCGTaaa				1	w 170 aaaACGCGagacg																			
unknown	unknown		G1	390	753	YLR326W	YLR326W	YLR326W	YPD	SGD	MIPS	2.96	1.88	2.36	2.36	1.40	1.06	1.22	0.82	undocumented	New	novel	3.358	-2.097	1	w 446 agtACGCGaatat																								1	w 446 agtACGCGaatat																			
cell wall biogenesis	"1,3-beta-D-glucan synthase subunit"		G1	405	779	YLR342W	GLS1	FKS1	YPD	SGD	MIPS	5.22	2.07	3.28	3.28	2.73	1.43	1.97	0.51	viable	Known	"1,3-beta-D-glucan synthase"	3.281	-2.257	1	w 492 gtgACGCGatctg																								1	w 492 gtgACGCGatctg																			
unknown	similar to Gas1p		G1	296	725	YLR343W	YLR343W	YLR343W	YPD	SGD	MIPS	1.16	1.05	1.10	1.10	1.40	1.61	1.50	0.67	viable	New	Protein with strong similarity to Gas1p	1.987	-1.439																																														
nuclear protein targeting	beta-karyopherin		G2/M	793	254	YLR347C	KAP95	KAP95	YPD	SGD	MIPS	1.07	1.05	1.01	0.99	1.41	1.14	1.26	0.79	lethal	New	"Karyopherin-beta, acts to target proteins with nuclear localization (NLS) sequences to the nuclear pore complex "	1.335	0.663																																		1	w 399 ATAACCAGCATT				1	w 399 ATAACCAGCATT						
"bud site selection, bipolar"	unknown		G2/M	639	212	YLR353W	BUD8	BUD8	YPD	SGD	MIPS	1.18	1.16	1.17	1.17	2.17	1.19	1.61	1.61	viable	New	"Protein required for bipolar budding, has an RNA recognition (RRM) domain "	4.286	2.038																										1	c 422 cttACGCGcaata																			
fatty acid metabolism	conversion of 24-carbon to 26-carbon fatty acids		G1	397	759	YLR372W	SUR4	SUR4	YPD	SGD	MIPS	2.48	1.25	1.76	1.76	2.68	1.54	2.03	0.49	undocumented	New	Protein required for the conversion of 24-carbon fatty acids to 26-carbon fatty acids	1.406	-2.156	3	w372 aaaCGCGAAAttt	w 388 atgACGCGagaaa	w 373 aaaACGCGaaatt												1	w372 aaaCGCGAAAttt									2	w 388 atgACGCGagaaa	w 373 aaaACGCGaaatt																				
unknown	similar to Von Willebrand factor		S/G2	494	783	YLR373C	YLR373C	YLR373C	YPD	SGD	MIPS	2.16	1.78	1.96	1.96	1.32	1.16	1.24	0.81	undocumented	New	Protein with weak similarity to Von Willebrand factor	2.620	-3.021																																		2	w 686 AGGACCAGCCAC	c 43 GCTGCCAGCAAA												c 332 AAATATCTGGGG
unknown	unknown		G1	412	747	YLR380W	YLR380W	YLR380W	YPD	SGD	MIPS	1.73	1.56	1.64	1.64	1.69	1.12	1.38	0.73	undocumented	New	Protein of unknown function 	1.965	-2.363	2	c241 aaaCACGAAAcaa	c 340 gggACGCGatggc							1	c241 aaaCACGAAAcaa															1	c 340 gggACGCGatggc																					
"DNA repair, recombination"	unknown		G1	349	502	YLR383W	RHC18	RHC18	YPD	SGD	MIPS	1.89	1.08	1.43	1.43	1.99	1.47	1.71	0.58	undocumented	New	"Protein involved in recombination repair, homologous to S. pombe rad18"	3.979	-1.691	2	w176 aaaACGCGTcgc	c 172 tatACGCGACGCG																		1	w176 aaaACGCGTcgc				1	c 172 tatACGCGACGCG																					w 594 AAATCTCCGGGG
unknown	unknown		G2/M	774	257	YLR413W	YLR413W	YLR413W	YPD	SGD	MIPS	1.00	4.55	2.14	0.47	1.10	1.16	1.13	0.89	undocumented	New	Protein of unknown function 	3.407	0.942																																																
unknown	unknown		S/G2	578	689	YLR437C	YLR437C	YLR437C	YPD	SGD	MIPS	1.61	1.13	1.35	1.35	1.35	1.15	1.24	0.80	undocumented	New	novel	1.958	2.518	2	w 327 ggcACGCGactac	w 191 accACGCGctttt																							2	w 327 ggcACGCGactac	w 191 accACGCGctttt																				
arginine metabolism	ornithine aminotransferase		G2/M	660	253	YLR438W	CAR2	CAR2	YPD	SGD	MIPS	1.53	1.58	1.56	1.56	1.67	1.34	1.12	0.90	viable	New	Ornithine aminotransferase (ornithine--oxo-acid aminotransferase)	3.209	1.919																										2	c 163 ggcACGCGactac	c 299 accACGCGctttt																				w 326 AATTCGGCGGGG
mating	negative regulator of Gpa1		M/G1	56	308	YLR452C	SST2	SST2	YPD	SGD	MIPS	1.12	1.16	1.14	0.88	2.03	1.28	1.26	0.79	viable	Known	Protein involved in desensitization to alpha-factor pheromone 	2.406	-0.030																										1	w 227 aaaACGCGgctgt																					
unknown	unknown		S	475	686	YLR455W	YLR455W	YLR455W	YPD	SGD	MIPS	1.35	1.08	1.12	1.12	1.28	1.04	1.16	0.87	undocumented	New	weak similarity to human G/T mismatch binding protein	4.935	-2.899																																																
unknown	Nap1p-binding protein		G1	202	411	YLR457C	NBP1	NBP1	YPD	SGD	MIPS	1.46	1.20	1.32	1.32	1.08	1.22	1.06	0.94	lethal	New	Nap1p-binding protein 	1.639	-1.059	1	w112 gtgACGCGTcat																			1	w112 gtgACGCGTcat																										
unknown	unknown		G1	265	412	YLR458W	YLR458W	YLR458W		SGD	MIPS	1.01	1.22	1.10	1.10	1.30	1.02	1.13	0.89	undocumented	New	questionable ORF	1.456	-1.315																																																
unknown	unknown		G1	139	577	YLR462W	YLR462W	YLR462W	YPD	SGD	MIPS	1.96	2.50	2.21	2.21	1.29	1.74	1.16	1.16	undocumented	New	Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins)	4.480	-0.659	1	w 544 ctgACGCGccata																								1	w 544 ctgACGCGccata																					
unknown	similar to other subtelomerically-coded proteins		M/G1	100	576	YLR463C	YLR463C	YLR463C	YPD	SGD	MIPS	1.79	1.83	1.81	1.81	1.22	1.34	1.05	1.05	undocumented	New	Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins)	3.808	-0.424	1	C 321 TATGCCAGCCTC																																1	C 321 TATGCCAGCCTC													
unknown	similar to other subtelomerically-coded proteins		G1	122	575	YLR464W	YLR464W	YLR464W	YPD	SGD	MIPS	1.22	2.09	1.31	1.31	1.75	1.53	1.07	0.93	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.986	-0.561	1	w151 tgtCACGAAAtag								1	w151 tgtCACGAAAtag																																					
unknown	unknown		M/G1	91	559	YLR465C	YLR465C	YLR465C	YPD	SGD	MIPS	1.13	1.37	1.24	1.24	1.21	1.09	1.15	0.87	undocumented	New	see comment; questionable ORF	1.528	-0.327																																																
unknown	similar to other subtelomerically-coded proteins		M/G1	102	599	YLR466W	YLR466W	YLR466W	YPD	SGD	MIPS	1.78	1.75	1.76	1.76	1.66	1.40	1.09	0.92	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.096	-0.456	1	C 317 GTCACCAGCGCC								1	w 666 tgtCACGAAAtag																							1	C 317 GTCACCAGCGCC													
unknown	similar to other subtelomerically-encoded proteins		G1	115	596	YLR467W	YLR467W	YLR467W	YPD	SGD	MIPS	1.94	2.09	2.01	2.01	1.31	1.23	1.03	0.97	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	4.062	-0.536	1	w 590 ctgACGCGccata																								1	w 590 ctgACGCGccata																					
secretion	vesicle coat component		S	429	785	YML012W	ERV25	ERV25	YPD	SGD	MIPS	1.98	1.22	1.27	1.27	1.77	1.09	1.27	0.79	viable	New	Component of the COPII coat of certain ER-derived vesicles 	2.164	-2.478	1	w 187 caaACGCGTaca																			1	w 187 caaACGCGTaca																										
unknown	unknown		G1	266	389	YML020W	YML020W	YML020W	YPD	SGD	MIPS	1.67	1.02	1.28	1.28	1.10	1.35	1.22	0.82	undocumented	New	Protein of unknown function 	1.508	-1.315	1	w283 attACGCGTtgc																			1	w283 attACGCGTtgc																										
DNA repair	uracil DNA glycosylase		G1	343	511	YML021C	UNG1	UNG1	YPD	SGD	MIPS									viable	Known	"Uracil-DNA glycolyase, removes uracil from DNA "	1.452	-1.631	1	w 64 gcaACGCGTaat																			1	w 64 gcaACGCGTaat																										
unknown	binds leu-tRNA gene		G1	276	537	YML027W	YOX1	YOX1	YPD	SGD	MIPS	7.26	4.05	5.42	5.42	4.63	2.78	3.59	0.28	viable	New	Homeodomain protein that binds leu-tRNA gene	7.835	-1.364	3	w500 aaaACGCGTaaa	w 439 gagACGCGacgct	w 234 caaACGCGaacaa																	1	w500 aaaACGCGTaaa				2	w 439 gagACGCGacgct	w 234 caaACGCGaacaa																				
unknown	unknown		G2/M	638	228	YML033W	YML033W	YML033W	YPD	SGD	MIPS	1.07	1.16	1.11	0.90	1.80	1.85	1.82	1.82	undocumented	New	has weak similarity to Ydr458p 	6.421	2.039																																																w 631 TATTCGGCGGGG
unknown	unknown		G2/M	628	229	YML034W	YML034W	YML034W	YPD	SGD	MIPS	1.25	1.05	1.15	1.15	1.43	2.60	1.93	1.93	undocumented	New	has weak similarity to Ydr458p 	7.306	2.120																																																c 423 ATTAACCTGGGG
unknown	unknown		G2/M	662	178	YML035C-A		YML035C-A		SGD										undocumented	New		1.509	1.897																																																
unknown	similar to potato sucrose cleavage protein		G2/M	761	63	YML050W	YML050W	YML050W	YPD	SGD	MIPS	1.20	1.41	1.30	0.77	2.42	1.25	1.74	0.57	undocumented	New	Protein with weak similarity to potato sucrose cleavage protein 	1.515	1.086										1	c 105 atgCACGAAAaag																																					
endocytosis (putative)	suppresses rvs167 mutation		G2/M	636	155	YML052W	SUR7	SUR7	YPD	SGD	MIPS									viable	New	Multicopy suppressor of rvs167 mutation 	5.674	2.061																																																
unknown	unknown		S/G2	596	147	YML058W	YML058W	SML1	YPD	SGD	MIPS	1.78	1.96	1.87	0.53	1.30	1.03	1.12	0.89	viable	New	Suppressor of mec lethality	7.896	2.394																																																
DNA repair	8-oxoguanine DNA glycosylase		G1	261	465	YML060W	OGG1	OGG1	YPD	SGD	MIPS	2.53	1.20	1.74	1.74	1.73	1.35	1.53	0.65	viable	New	"DNA glycosylase, excises 7,8-dihydro-8-oxoguanine (8-OxoG) and Fapy residues from DNA"	2.915	-1.300	1	w 135 aagACGCGccttt																								1	w 135 aagACGCGccttt																					
"DNA repair, mitochondrial"	DNA helicase		G1	342	466	YML061C	PIF1	PIF1	YPD	SGD	MIPS	1.47	1.71	1.59	1.59	2.13	1.26	1.64	0.61	viable	New	"Single-stranded DNA-dependent ATPase and 5'-3' DNA helicase required for maintenance and repair of mitochondrial DNA, also functions in nucleus to regulate telomere length "	2.254	-1.631	1	c 216 aagACGCGccttt																								1	c 216 aagACGCGccttt							2	w 413 TTGGCCAGCCTG	c 480 TAGGCCAGCAAG			1	c 480 TAGGCCAGCAAG								c 114 AATAGACTGGGG
cell cycle	"GTP-binding protein, RAS superfamily"		G2/M	714	222	YML064C	TEM1	TEM1	YPD	SGD	MIPS	1.57	1.01	1.25	0.80	2.45	2.09	2.26	2.26	lethal	New	GTP-binding protein of the ras superfamily involved in termination of M-phase 	3.180	1.564																										1	c 364 aggACGCGgtaga																					w 258 AAATATCTGGGG
DNA replication	origin recognition complex 104 kD subunit		S/G2	561	664	YML065W	ORC1	ORC1	YPD	SGD	MIPS	1.01	1.01	1.01	1.01	1.66	1.23	1.16	0.86	lethal	New	"Origin recognition complex, large subunit"	1.553	2.741																																																
unknown	unknown		G2/M	702	37	YML066C	YML066C	YML066C	YPD	SGD	MIPS	1.14	1.67	1.21	1.21	1.45	1.03	1.19	0.84	undocumented	New	Protein of unknown function 	1.998	1.621																																																
unknown	unknown		S/G2	585	149	YML072C	YML072C	YML072C	YPD	SGD	MIPS	1.21	1.36	1.28	1.28	1.56	1.08	1.20	0.83	undocumented	New	similarity to YOR086C and YNL087w	2.319	2.475																																		1	w 303 TTCGCCAGCGCG													c 634 AAACATGTGGGG
unknown	unknown		G1	142	342	YML100W	TSL1	TSL1	YPD	SGD	MIPS	1.97	4.31	2.91	2.91	1.78	1.14	1.25	0.80	undocumented	New	"Component of the trehalose-6-phosphate synthase/phosphatase complex, alternate third subunit with Tps3p "	1.464	-0.673	2	c 398 tgaACGCGatttt	c 527 cccACGCGcacaa																							2	c 398 tgaACGCGatttt	c 527 cccACGCGcacaa						1	c 272 CCCGCCAGCCGG													c 569 TTTGAACTGGGG
chromatin structure	chromatin assembly factor I subunit		G1	191	492	YML102W	CAC2	CAC2	YPD	SGD	MIPS	1.99	2.03	2.01	2.01	1.02	1.28	1.12	0.89	viable	New	"Chromatin assembly complex subunit 1, involved in nucleosome assembly linked with DNA replication, has WD (WD-40) repeats"	3.078	-0.986																																																
cell cycle	Zds1 homolog		G1	378	462	YML109W	ZDS2	ZDS2	YPD	SGD	MIPS	1.08	2.12	1.51	1.51	2.32	1.54	1.89	0.53	viable	New	Multicopy suppressor of sin4 	2.075	-1.921	2	w183 ctgACGCGTtgt	c 161 aagACGCGgcgtg																		1	w183 ctgACGCGTtgt				1	c 161 aagACGCGgcgtg																					
ubiquinone biosynthesis	methyltransferase		M/G1	58	325	YML110C	DBI56	DBI56	YPD	SGD	MIPS	2.05	1.85	1.95	0.51	1.72	1.76	1.01	1.01	viable	New	Potential mitochondrial C-methyltransferase of the ubiquinone biosynthetic pathway 	1.671	-0.070																					1	w 514 acaACGCGTcag				1	w 537 aagACGCGgcgtg																					
aminotriazole resistance	transporter (putative)		G2/M	676	164	YML116W	ATR1	ATR1	YPD	SGD	MIPS	1.33	1.61	1.46	0.68	1.03	1.28	1.15	1.15	viable	New	"Aminotriazole and 4-nitroquinoline-1-oxide (4NQO) resistance protein, member of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family "	1.569	1.814																																																
unknown	unknown		S	428	360	YML117W	YML117W	YML117W	YPD	SGD	MIPS	1.33	1.39	1.36	1.36	1.74	1.27	1.48	0.67	undocumented	New	"Protein of unknown function, contains an ATP/GTP-binding site motif A (P-loop)"	1.430	-2.470	1	w 592 gacACGCGTcag																			1	w 592 gacACGCGTcag																										
unknown	unknown		G2/M	707	235	YML119W	YML119W	YML119W	YPD	SGD	MIPS	1.25	1.02	1.11	0.90	10.93	4.64	7.12	7.12	undocumented	New	"low similarity to MSS1, a protein involved in starch metabolism"	8.303	1.601																																																
oxidative phosphorylation	NADH-ubiquinone-6 oxidoreductase		G2/M	622	128	YML120C	NDI1	NDI1	YPD	SGD	MIPS	1.73	1.10	1.25	0.80	1.17	1.27	1.04	1.04	undocumented	New	NADH-ubiquinone oxidoreductase (rotenone insensitive)	1.447	2.168																																																
transport	inorganic phosphate permease		G2/M	641	140	YML123C	PHO84	PHO84	YPD	SGD	MIPS	1.09	2.27	1.57	0.64	1.26	1.52	1.10	0.91	viable	New	"High-affinity inorganic phosphate/H+ symporter, member of sugar permease family "	1.787	2.017																																																c 165 AATAAAGTGGGG
unknown	similar to NADH-cytochrome b5 reductase		S/G2	560	661	YML125C	YML125C	YML125C	YPD	SGD	MIPS	1.74	1.64	1.03	1.03	1.46	1.10	1.27	0.79	undocumented	New	Protein with similarity to NADH-cytochrome b5 reductase 	2.811	2.750	1	c 17 ttcACGCGgttct																								1	c 17 ttcACGCGgttct																					
unknown	similar to other subtelomerically-encoded proteins		G1	146	517	YML133C	YML133C	YML133C	YPD	SGD	MIPS									undocumented	New	"Protein with similarity to other subtelomerically-encoded proteins including Yer189p, and Yjl225p "	2.287	-0.699	1	w 571 ctgACGCGccat																								1	w 571 ctgACGCGccat																					w 296 TATTCGGCGGGG
cell cycle	G2/M protein kinase		G2/M	647	240	YMR001C	CDC5	CDC5	YPD	SGD	MIPS	1.39	1.09	1.23	0.81	3.35	5.32	4.22	4.22	lethal	Known	"Serine/threonine protein kinase of the polo family of protein kinases, required for exit from mitosis and may be involved in operation of the mitotic spindle"	9.901	1.973	1	CAAAACAAACCCAATAAAGAAAATCCAAAATATAGAAC																														1	CAAAACAAACCCAATAAAGAAAATCCAAAATATAGAAC															
unknown	unknown		S/G2	581	116	YMR002W	YMR002W	YMR002W	YPD	SGD	MIPS	1.12	1.06	1.09	0.92	1.22	1.20	1.01	0.99	undocumented	New	similarity to hypothetical S.pombe and C.elegans proteins	2.265	2.486																																		1	c 306 GACGCCAGCATA													
unknown	unknown		S/G2	526	684	YMR003W	YMR003W	YMR003W	YPD	SGD	MIPS	1.06	1.59	1.30	1.30	1.91	1.03	1.40	0.71	undocumented	New	novel	5.082	3.071	1	w 567 tagACGCGagaaa																								1	w 567 tagACGCGagaaa							1	w 597 CGGACCAGCAGT				1	w 597 CGGACCAGCAGT								w 289 ATTAACCTGGGG
transport	hexose permease		M/G1	57	11	YMR011W	HXT2	HXT2	YPD	SGD	MIPS	2.24	1.52	1.84	0.54	2.10	2.13	2.12	0.47	viable	New	"High-affinity hexose transporter, member of sugar permease family "	4.637	-0.060																					1	w 379 cctACGCGTttt																										
sterol metabolism	C-22 sterol desaturase		G2/M	619	142	YMR015C	ERG5	ERG5	YPD	SGD	MIPS	2.08	1.41	1.22	1.22	1.09	1.08	1.01	1.01	viable	New	Cytochrome P450 (C-22 sterol desaturase)	2.046	2.178																																														
unknown	unknown		G2/M	748	81	YMR031C	YMR031C	YMR031C	YPD	SGD	MIPS	3.51	1.85	2.55	0.39	2.21	2.69	2.44	2.44	undocumented	New	"similarity to YKL050c and human restin, has potential coiled-coil region (GB:Z49213)"	6.658	1.243																																		1	c 456 AAAGCCAGCTAG											
cytokinesis	unknown		G2/M	693	234	YMR032W	CYK2	HOF1	YPD	SGD	MIPS	2.41	1.03	1.58	0.63	4.63	1.98	3.03	3.03	undocumented	New	"has potential coiled-coil region, and is involved in cytokinesis"	10.970	1.691																																		1	w 110 AAAGCCAGCTAG											
unknown	unknown		G1	229	413	YMR048W	YMR048W	YMR048W	YPD	SGD	MIPS	1.69	1.01	1.31	1.31	1.08	1.10	1.01	1.01	undocumented	New	Protein of unknown function 	1.846	-1.170	1	w75 ctgACGCGTaac																			1	w75 ctgACGCGTaac												1	w 596 GGAACCAGCAGA				1	w 596 GGAACCAGCAGA						
"cell cycle, checkpoint"	unknown		S/G2	548	659	YMR055C	BUB2	BUB2	YPD	SGD	MIPS	1.09	1.18	1.13	1.13	1.80	1.13	1.26	0.79	viable	New	Checkpoint protein required for cell cycle arrest in response to loss of microtubule function 	1.433	2.892	1	c 416 aatACGCGccctc																								1	c 416 aatACGCGccctc							1	c 359 GACACCAGCTGC											
transport	cell surface ferroxidase		G2/M	710	131	YMR058W	FET3	FET3	YPD	SGD	MIPS	1.19	2.08	1.32	0.76	1.16	1.29	1.22	1.22	viable	New	Cell surface ferroxidase required for high-affinity ferrous iron uptake 	4.742	1.591																																														
"mitosis, sister chromatid cohesion"	unknown		G1	257	443	YMR076C		PDS5		SGD	MIPS	1.58	1.92	1.10	0.91	3.14	2.78	2.95	0.34	undocumented	New	similar to A. nidulans bimD protein	2.000	-1.287	3	c633 gacCACGAAAcct	w171 gcgACGCGTaaa	w 176 gcgACGCGACGCG						1	c633 gacCACGAAAcct										1	w171 gcgACGCGTaaa				1	w 176 gcgACGCGACGCG																			
"mitosis, chromosome transmission"	unknown		G1	192	445	YMR078C	CTF18	CTF18	YPD	SGD	MIPS	2.82	1.89	1.22	1.22	2.35	1.72	2.01	0.50	viable	New	"Homolog of Rfc1p, Rfc2p, Rfc3p, Rfc4p, and Rfc5p, required for accurate chromosome transmission in mitosis and maintenance of normal telomere length"	2.548	-0.991	1	c 109 acaACGCGactgg																								1	c 109 acaACGCGactgg							2	w 563 GAAACCAGCGTC	c 222 TTGACCAGCGCC			2	w 563 GAAACCAGCGTC	c 222 TTGACCAGCGCC					
unknown	unknown		S	433	774	YMR144W	YMR144W	YMR144W	YPD	SGD	MIPS	2.58	2.01	2.28	2.28	1.02	1.07	1.04	1.04	undocumented	New	weak similarity to Mlp1p	1.756	-2.492	2	w 210 tgaCGCGAAAtcg	w 211 ttgACGCGaaatc													1	w 210 tgaCGCGAAAtcg									1	w 211 ttgACGCGaaatc																			
unknown	similar to rotenone-insensitive NADH-ubiquinone		G2/M	649	118	YMR145C	YMR145C	YMR145C	YPD	SGD	MIPS	1.90	2.56	2.21	0.45	1.40	1.02	1.20	0.84	undocumented	New	Protein with similarity to rotenone-insensitive NADH-ubiquinone oxidoreductase Ndi1p; has 44% identity with Ndi1p over 469 amino acids; even stronger homology to YDL085w	3.228	1.973																																														
unknown	unknown		S/G2	514	671	YMR163C	YMR163C	YMR163C	YPD	SGD	MIPS	1.22	1.05	1.08	0.93	1.74	1.06	1.36	0.74	undocumented	New	novel	2.020	3.124	1	c 322 gacCACGAAAcca								1	c 322 gacCACGAAAcca																							1	w 433 CTGGCCAGCTAA											
transcription	transcriptional regulator		G1	175	499	YMR179W	SPT21	SPT21	YPD	SGD	MIPS	3.06	1.90	2.41	2.41	1.53	1.37	1.45	0.69	viable	New	"required for transcription at HTA2-HTB2 and HHF2-HHT2, but not at the other two histone loci"	6.183	-0.872	4	c264 tatCACGAAAaaa	w237 aaaACGCGTcgc	c 233 ctaACGCGACGCG	c 275 aaaACGCGaccgt					1	c264 tatCACGAAAaaa										1	w237 aaaACGCGTcgc				2	c 233 ctaACGCGACGCG	c 275 aaaACGCGaccgt						1	w 344 CAAACCAGCAAA				1	w 344 CAAACCAGCAAA						
secretion	post-Golgi t-SNARE		S/G2	577	243	YMR183C	SSO2	SSO2	YPD	SGD	MIPS	1.10	1.27	1.07	0.93	1.09	1.34	1.11	1.11	viable	New	Syntaxin homolog (t-SNARE) involved in vesicle transport from Golgi to plasma membrane 	1.783	2.519	1	c 336 tagACGCGcatct																								1	c 336 tagACGCGcatct							1	w 290 GAAGCCAGCTAA											
amino acid metabolism	glycine decarboxylase P subunit		G2/M	642	114	YMR189W	GSD2	GCV2	YPD	SGD	MIPS	1.39	1.24	1.31	0.76	1.56	1.18	1.15	0.87	undocumented	New	"Glycine decarboxylase, pyridoxal phosphate containing subunit (glycine decarboxylase P subunit)"	2.720	2.006																																														
cytoskeleton	spindle pole body associated protein		S/G2	528	670	YMR198W	CIK1	CIK1	YPD	SGD	MIPS	1.47	1.23	1.09	1.09	1.10	1.54	1.30	1.30	viable	Known	Coiled-coil protein of spindle pole body involved in spindle formation and the congression (nuclear migration) step of karyogamy 	3.553	3.055	1	c 700 taaACGCGaaata																								1	c 700 taaACGCGaaata							1	w 686 ACCACCAGCGGC											
cell cycle	G1/S cyclin		G1	304	476	YMR199W	CLN1	CLN1	YPD	SGD	MIPS	1.89	2.25	2.06	2.06	4.95	2.50	3.52	0.28	viable	Known	G1 cyclin	5.364	-1.475	3	w500 aatCGCGAAAaaa	w 686 caaACGCGgcaag	c 375 gaaACGCGcacgc												1	w500 aatCGCGAAAaaa									2	w 686 caaACGCGgcaag	c 375 gaaACGCGcacgc																		
sterol metabolism	C-8 sterol isomerase		G2/M	650	141	YMR202W	ERG2	ERG2	YPD	SGD	MIPS	1.55	1.54	1.00	1.00	1.07	1.49	1.26	0.79	viable	New	"Sterol C8-C7 isomerase (C-8 sterol isomerase), enzyme of the ergosterol biosynthesis pathway "	1.645	1.972																																																
unknown	similar to Gas1p		S/G2	517	714	YMR215W	YMR215W	YMR215W	YPD	SGD	MIPS	1.99	1.12	1.33	1.33	2.57	1.33	1.85	0.54	viable	New	has 43% identity over 241 amino acids with Gas1p 	5.652	3.109	1	c 175 gcgCGCGAAAaaa																																														w 296 TATTCGGCGGGG
pseudohyphal growth	unknown		S	465	775	YMR238W	DFG5	DFG5	YPD	SGD	MIPS	2.08	1.29	1.64	1.64	1.98	1.64	1.80	0.56	viable	New	"Protein required for filamentous growth, cell polarity, and cellular elongation "	3.108	-2.813	1	c 212 tttACGCGgatta																								1	c 212 tttACGCGgatta																				w 119 CCCAATGTAGAAAAGTACATCATATGAAACA	
fatty acid metabolism	long-chain-fatty-acid--CoA ligase		M/G1	14	259	YMR246W	FAA4	FAA4	YPD	SGD	MIPS	1.27	1.69	1.15	0.87	1.14	1.07	1.03	0.97	viable	New	"Acyl-CoA synthase (long-chain fatty acid CoA ligase), contributes to activation of imported myristate "	1.561	0.342	2	w 77 AGAACCAGCATT	w 77 AGAACCAGCATT																							1	c 491 aagACGCGcagcc							1	w 77 AGAACCAGCATT				1	w 77 AGAACCAGCATT								
unknown	major facilitator superfamily		G2/M	734	33	YMR253C	YMR253C	YMR253C	YPD	SGD	MIPS	1.85	1.04	1.33	1.33	1.20	1.35	1.06	1.06	undocumented	New	"Protein of unknown function, member of the major facilitator superfamily (MFS) "	2.062	1.380																																		1	w 353 CAAGCCAGCAAG				1	w 353 CAAGCCAGCAAG								
unknown	unknown		G2/M	753	176	YMR254C	YMR254C	YMR254C	YPD	SGD	MIPS									viable	New	"Protein of unknown function, questionable ORF "	1.544	1.121	1	c 267 aacCACGAAAgta								1	c 267 aacCACGAAAgta																																					
unknown	similar to phosphomannomutase		S/G2	547	355	YMR278W	YMR278W	YMR278W	YPD	SGD	MIPS	1.75	1.28	1.17	0.86	2.03	1.13	1.34	0.75	undocumented	New	Protein with simiarity to phosphomannomutase 	1.330	2.926																																		1	c 596 AGTACCAGCAGC													
unknown	unknown		S	416	631	YMR295C	YMR295C	YMR295C	YPD	SGD	MIPS	1.48	1.27	1.37	1.37	1.33	1.43	1.38	0.73	undocumented	New	similarity to YGR273c	1.619	-2.377	1	c 108 tacCACGAAAgta								1	c 108 tacCACGAAAgta																																					
unknown	similar to Bgl2p and other glucans (GB:Z49212)		G1	339	478	YMR305C	YMR305C	YMR305C	YPD	SGD	MIPS	2.25	1.45	1.81	1.81	3.93	3.57	3.75	0.27	undocumented	New	Protein with similarity to Bgl2p and other glucans	3.824	-1.611	5	w505 tttCGCGAAAgac	w405 ttgCGCGAAAcag	c508 tttCGCGAAAtct	w346 cgcACGCGTttg	c 384 tcaACGCGaattt										3	w505 tttCGCGAAAgac	w405 ttgCGCGAAAcag	c508 tttCGCGAAAtct		1	w346 cgcACGCGTttg				1	c 384 tcaACGCGaattt																					w 445 AATTATCCGGGG
unknown	cell surface glycoprotein		G1	407	767	YMR307W	GAS1	GAS1	YPD	SGD	MIPS	3.60	2.03	2.70	2.70	2.12	2.17	2.14	0.47	viable	Known	Glycophospholipid-anchored surface glycoprotein	2.641	-2.263	5	c505 aaaCGCGAAAatt	w640 gtaACGCGTtat	w586 ttaACGCGTcct	w 439 tttACGCGcacaa	c 504 aaaACGCGaaaat										1	c505 aaaCGCGAAAatt				2	w640 gtaACGCGTtat	w586 ttaACGCGTcct			2	w 439 tttACGCGcacaa	c 504 aaaACGCGaaaat																				
mitochondrial protein targeting	mitochondrial carrier family		S/G2	555	657	YNL003C	PET8	PET8	YPD	SGD	MIPS	1.68	1.45	1.56	0.64	1.60	1.11	1.20	0.83	viable	New	"Protein of the mitochondrial carrier (MCF) family, has similarity to Mrs4p and Mrs3p "	1.526	2.803	1	w 644 cctCACGAAAtag								1	w 644 cctCACGAAAtag																																					
unknown	protease inhibitor		G1	246	343	YNL015W	PBI2	PBI2	YPD	SGD	MIPS	1.33	2.20	1.71	1.71	2.27	1.37	1.76	0.57	viable	New	"Protease B (yscB or Prb1p) inhibitor 2 (I2B), has activity related to vacuolar fusion that is not related to protease activity "	3.064	-1.249																																																
chromatin structure	histone H4		S	418	792	YNL030W	HHF2	HHF2	YPD	SGD	MIPS	3.22	2.88	3.04	3.04	1.98	1.79	1.88	0.53	viable	Known	Histone H4 (HHF1 and HHF2 code for identical proteins)	9.744	-2.399																																																
chromatin structure	histone H3		S	430	793	YNL031C	HHT2	HHT2	YPD	SGD	MIPS	2.95	2.45	2.69	2.69	1.55	1.33	1.44	0.69	viable	Known	Histone H3 (HHT1 and HHT2 code for identical proteins)	8.063	-2.478																																																w 636 TATTCGGCGGGG
TCA cycle	isocitrate dehydrogenase		G2/M	606	119	YNL037C	IDH1	IDH1	YPD	SGD	MIPS	1.24	1.49	1.36	0.74	1.32	1.01	1.16	0.86	viable	New	"Isocitrate dehydrogenase (NAD+) subunit 1, mitochondrial, required for oxidative function of the tricarboxylic acid cycle "	2.259	2.307																																																
unknown	unknown		S/G2	510	705	YNL043C	YNL043C	YNL043C	YPD	SGD	MIPS	1.32	1.05	1.18	0.85	2.30	1.09	1.45	0.69	undocumented	New	novel; questionable ORF	1.850	3.130																																																
unknown	unknown		M/G1	39	271	YNL046W	YNL046W	YNL046W	YPD	SGD	MIPS	2.25	1.13	1.41	0.71	1.45	1.27	1.36	0.74	undocumented	New	novel	2.171	0.110	2	c 102 CGAGCCAGCATT	C 102 CGAGCCAGCATT																															1	C 102 CGAGCCAGCATT				1	c 102 CGAGCCAGCATT								
unknown	unknown		G2/M	745	171	YNL056W	YNL056W	YNL056W	YPD	SGD	MIPS	1.02	1.01	1.01	1.01	1.02	1.01	1.02	0.98	undocumented	New	Protein of unknown function 	1.534	1.278	1	c 355 CCTAAAGCGGGAAATAGTAAACAT																														1	c 355 CCTAAAGCGGGAAATAGTAAACAT	1	w 576 CTGACCAGCGAT				1	w 576 CTGACCAGCGAT								
unknown	unknown		G2/M	752	206	YNL057W	YNL057W	YNL057W	YPD	SGD	MIPS	1.04	1.00	1.02	1.02	1.51	2.75	2.04	2.04	undocumented	New	novel; questionable ORF	4.955	1.193																																																c 389 CTAAATCTGGGG
unknown	unknown		G2/M	737	223	YNL058C	YNL058C	YNL058C	YPD	SGD	MIPS	1.44	1.10	1.14	0.87	2.65	1.84	2.21	2.21	undocumented	New	has similarity to Yil117p 	9.392	1.344	1	w 204 CCTAAAGCGGGAAATAGTAAACAT																														1	w 204 CCTAAAGCGGGAAATAGTAAACAT															
DNA replication (putative)	ribonuclease H		G1	185	518	YNL072W	RNH35	RNH35	YPD	SGD	MIPS	1.67	2.35	1.98	1.98	2.01	1.16	1.53	0.65	viable	New	RNase H of 35 kDa	1.579	-0.952	2	w96 ctaCGCGAAAaat	w 97 gctACGCGaaaaa													1	w96 ctaCGCGAAAaat									1	w 97 gctACGCGaaaaa																					c 543 AAACTTCTGGGG
unknown	unknown		M/G1	38	266	YNL078W	YNL078W	YNL078W	YPD	SGD	MIPS	2.38	1.01	1.54	0.65	1.12	1.56	1.32	0.76	undocumented	New	has 5 potential transmembrane domains	7.368	0.138	1	C 357 CAAACCAGCCAT																								1	w 365 gccACGCGatggc							1	C 357 CAAACCAGCCAT													
DNA repair	MutL homolog; mismatch repair		G1	160	557	YNL082W	PMS1	PMS1	YPD	SGD	MIPS	1.80	1.79	1.80	1.80	1.77	1.23	1.48	0.68	undocumented	Known	"Protein required for mismatch repair, homologous to E. coli MutL "	4.843	-0.777	6	w658 cgtCACGAAAaaa	w601 tgtCACGAAAagt	w467 attCACGAAAtaa	w435 atcCACGAAAatc	w252 aacCACGAAAagt	w401 tatCGCGAAAatt			5	w658 cgtCACGAAAaaa	w601 tgtCACGAAAagt	w467 attCACGAAAtaa	w435 atcCACGAAAatc	w252 aacCACGAAAagt	1	w401 tatCGCGAAAatt																															
DNA replication	polymerase alpha 180 kD subunit		G1	199	415	YNL102W	POL1	POL1	YPD	SGD	MIPS	2.36	1.72	2.01	2.01	2.24	1.13	1.60	0.63	lethal	Known	DNA polymerase alpha 180 kDa subunit 	3.143	-1.024	5	w373 taaCACGAAAaat	w396 tgaCGCGAAAagt	w 580 gagACGCGaagcc	w 397 atgACGCGaaaag	c 382 gttACGCGaagtc				1	w373 taaCACGAAAaat					1	w396 tgaCGCGAAAagt									3	w 580 gagACGCGaagcc	w 397 atgACGCGaaaag	c 382 gttACGCGaagtc					4	w 529 AATGCCAGCTGA	w 476 AAAACCAGCAGA	w 450 ATGGCCAGCTAT	c 363 TGCACCAGCATT	1	w 476 AAAACCAGCAGA								
lipid metabolism	cytochrome b5		G2/M	685	139	YNL111C	CYB5	CYB5	YPD	SGD	MIPS	1.08	1.10	1.01	1.01	1.36	1.29	1.03	0.98	viable	New	Cytochrome b5 	1.456	1.721																																																
cytoskeleton	spindle pole body component		G1	391	733	YNL126W	SPC98	SPC98	YPD	SGD	MIPS	2.62	1.29	1.84	1.84	1.70	1.25	1.46	0.69	lethal	New	Spindle pole body component that interacts with gamma-tubulin	2.570	-2.111	1	c 149 caaACGCGacgca																								1	c 149 caaACGCGacgca																	1	w 453 TTTCCCGTTTAGGAAA			
unknown	similar to C. carbonum toxD gene		M/G1	19	331	YNL134C	YNL134C	YNL134C	YPD	SGD	MIPS	1.43	1.47	1.45	0.69	1.30	1.10	1.19	0.84	undocumented	New	Protein with similarity to C. carbonum toxD gene 	2.140	0.314										1	c 382 ttcCACGAAAtgg																																					
mating	a-factor precursor		G2/M	783	57	YNL145W	MFA2	MFA2	YPD	SGD	MIPS	5.12	5.26	5.19	0.19	1.76	5.89	3.22	3.22	viable	Known	a-factor	3.364	0.812																																												1	c 221 TTACCCAATTAGGAAA	1		
diauxic shift	unknown; response to nutrient limitation		M/G1	6	69	YNL160W	YGP1	YGP1	YPD	SGD	MIPS	8.11	5.00	6.37	0.16	6.38	4.79	5.53	5.53	undocumented	New	Secreted glycoprotein produced in response to nutrient limitation 	9.334	0.496																																																
unknown	unknown		G1	358	459	YNL165W	YNL165W	YNL165W	YPD	SGD	MIPS	1.26	1.18	1.22	1.22	2.45	1.18	1.70	0.59	undocumented	New	weak similarity to YMR316W and YOR385W	1.989	-1.743	1	w147 ataACGCGTcta																			1	w147 ataACGCGTcta																										
unknown	unknown		G1	393	768	YNL166C	YNL166C	YNL166C	YPD	SGD	MIPS	3.06	1.48	2.13	2.13	1.76	1.32	1.52	0.66	undocumented	New	novel	1.780	-2.111	1	w131 tagACGCGTtat																			1	w131 tagACGCGTtat																										
phospholipid metabolism	phosphatidylserine decarboxylase		G1	337	552	YNL169C	PSD1	PSD1	YPD	SGD	MIPS	1.32	1.09	1.20	1.20	1.83	1.12	1.28	0.78	viable	New	"Phosphatidylserine decarboxylase, mitochondrial isozyme, converts phosphatidyl-L-serine to phosphatidylethanolamine "	1.351	-1.611																																		1	w 230 GTAACCAGCACC				1	w 230 GTAACCAGCACC								
unknown	unknown		G2/M	625	172	YNL171C	YNL171C	YNL171C	YPD	SGD	MIPS	1.91	1.01	1.39	0.72	1.78	1.22	1.21	0.83	undocumented	New	"Protein of unknown function, questionable ORF "	1.466	2.143																																														1		
mitosis	anaphase-promoting complex subunit		G2/M	629	211	YNL172W	APC1	APC1	YPD	SGD	MIPS	1.45	1.37	1.03	0.97	1.01	1.10	1.05	1.05	lethal	New	"Component of the anaphase-promoting complex (APC), required for Clb2p degradation and for the metaphase-anaphase transition "	1.721	2.119																																		1	w 314 AAGGCCAGCCTC													
"signaling, pheromone pathway"	unknown		M/G1	80	333	YNL173C	MDG1	MDG1	YPD	SGD	MIPS	1.25	1.49	1.37	0.73	1.74	1.21	1.20	0.83	undocumented	New	G-protein involved in adaptation to pheromone response 	1.521	-0.243	1	C 276 AAGGCCAGCCTC																																1	C 276 AAGGCCAGCCTC													
unknown	unknown		S/G2	539	701	YNL176C	YNL176C	YNL176C	YPD	SGD	MIPS	2.06	1.05	1.40	1.40	1.35	1.41	1.38	0.73	undocumented	New	Protein of unknown function 	2.213	2.994																																																
unknown	unknown		G1	286	455	YNL181W	YNL181W	YNL181W	YPD	SGD	MIPS	1.72	1.59	1.65	1.65	1.90	1.04	1.41	0.71	undocumented	New	Protein of unknown function 	1.755	-1.400	3	w 165 tagACGCGatcga	c 189 gaaACGCGggcac	c 557 tgtACGCGcgaac																						3	w 165 tagACGCGatcga	c 189 gaaACGCGggcac	c 557 tgtACGCGcgaac																			
cytokinesis	chitin synthase 		M/G1	16	273	YNL192W	CHS1	CHS1	YPD	SGD	MIPS	1.45	1.25	1.35	1.35	1.51	1.28	1.39	0.72	viable	Known	chitin synthase I	2.748	0.329																										2	w 286 gtaACGCGataat	c 302 gccACGCGatttc																				
cell size	unknown		S/G2	500	702	YNL197C	WHI3	WHI3	YPD	SGD	MIPS	2.31	1.37	1.78	1.78	1.36	1.12	1.10	0.91	viable	New	"Protein involved in regulation of cell size, has 1 RNA recognition (RRM) domain "	1.691	-3.101	1	c 494 ttaACGCGggtaa																								1	c 494 ttaACGCGggtaa							1	w 151 TTCACCAGCTTT													
unknown	unknown		G1	395	351	YNL208W	YNL208W	YNL208W	YPD	SGD	MIPS	1.44	1.04	1.18	0.85	1.38	1.39	1.38	0.72	undocumented	New	Protein of unknown function 	1.356	-2.134																																		1	c 134 ACAGCCAGCCCC													
transcription	transcriptional repressor and activator		S/G2	497	743	YNL216W	RAP1	RAP1	YPD	SGD	MIPS	1.65	1.29	1.46	1.46	1.07	1.17	1.12	0.89	lethal	New	"DNA-binding protein with repressor and activator activity, also involved in silencing at telomeres and silent mating type loci"	1.622	-3.091																																																
cytoskeleton	spindle pole body component		G1	230	450	YNL225C	CNM67	CNM67	YPD	SGD	MIPS	1.90	1.23	1.53	1.53	1.82	1.16	1.46	0.69	viable	New	Protein involved in nuclear migration 	1.670	-1.174	1	c 150 gcaACGCGaattt																								1	c 150 gcaACGCGaattt																					
drug resistance	unknown		G1	233	604	YNL231C	YNL231C	PDR16	YPD	SGD	MIPS	2.91	1.36	1.99	1.99	2.29	1.92	2.10	0.48	undocumented	New	Protein with weak similarity to Sec14p and Ylr380p 	1.335	-1.188	2	c372 caaCGCGAAAatc	c 364 atgACGCGcaacg													1	c372 caaCGCGAAAatc									1	c 364 atgACGCGcaacg																					
cytokinesis	may link chitin synthase to septins		G1	174	543	YNL233W	BNI4	BNI4	YPD	SGD	MIPS	2.00	1.98	1.99	1.99	2.56	1.47	1.94	0.52	viable	New	Protein that may be involved in linking chitin synthase III to septins of the neck filaments	3.001	-0.866	2	w292 gagACGCGTcaa	c 307 ctgACGCGcctat																		1	w292 gagACGCGTcaa				1	c 307 ctgACGCGcctat																					
DNA replication	polymerase epsilon catalytic subunit		G1	297	481	YNL262W	POL2	POL2	YPD	SGD	MIPS	1.30	2.52	1.81	1.81	1.86	1.20	1.49	0.67	lethal	Known	DNA polymerase epsilon large subunit	5.436	-1.440	2	w199 taaACGCGTgag	w179 gatACGCGTctc																		2	w199 taaACGCGTgag	w179 gatACGCGTctc																								w 503 CCCAAAAGGGAAAGGCTCGCTCTGAAACA	w 454 AGAATCGTGGGG
unknown	interacts with Yip1p; similar to NADH dehydrogenases		G1	382	758	YNL263C	SIF1	YIF1	YPD	SGD	MIPS	1.98	2.02	2.00	2.00	1.76	1.12	1.41	0.71	lethal	New	Protein with similarity to NADH dehydrogenases	1.897	-1.953	2	w265 cttACGCGTtct	w 601 cctACGCGgcctg																		1	w265 cttACGCGTtct				1	w 601 cctACGCGgcctg							2	w 634 GAGACCAGCGTT	w 434 GTTGCCAGCTGA			1	w 634 GAGACCAGCGTT								
unknown	topoisomerase I interacting factor		G1	182	501	YNL273W	TOF1	TOF1	YPD	SGD	MIPS	1.02	1.28	1.12	1.12	2.70	1.01	1.63	0.61	viable	New	Topoisomerase I interacting factor 	1.978	-0.938	2	w158 ttgACGCGTtta	w139 attACGCGTtta																		2	w158 ttgACGCGTtta	w139 attACGCGTtta											1	c 333 AAAACCAGCGTT				1	c 333 AAAACCAGCGTT								
unknown	unknown		S/G2	492	653	YNL276C	YNL276C	YNL276C	YPD	SGD	MIPS	1.44	1.50	1.47	1.47	1.38	1.03	1.16	0.86	viable	New	"Protein of unknown function, questionable ORF "	1.605	-3.011																																		1	w 439 CTTGCCAGCGCT													
cell wall biogenesis	"alpha-1,4-glucan-glucosidase"		S	455	777	YNL283C	WSC2	WSC2	YPD	SGD	MIPS	2.94	2.14	2.51	2.51	2.94	1.23	1.90	0.53	viable	New	Protein required for maintenence of cell wall integrity and for the stress response; similar to WSC4	6.217	-2.660	3	c 605 cacCGCGAAAaaa	c 633 aaaCGCGAAAtgt	c 632 aaaACGCGaaatg												2	c 605 cacCGCGAAAaaa	c 633 aaaCGCGAAAtgt								1	c 632 aaaACGCGaaatg							1	w 690 ACAGCCAGCTAG													
cell cycle	G1/S cyclin		G1	288	421	YNL289W	PCL1	PCL1	YPD	SGD	MIPS	1.38	1.13	1.11	0.90	1.56	1.03	1.23	0.81	viable	Known	G1/S-specific cyclin that can interact with the Cdc28p-like kinase Pho85p 	2.552	-1.410	2	w169 attACGCGTaac	c 642 ggtACGCGgttag																		1	w169 attACGCGTaac				1	c 642 ggtACGCGgttag							1	w 626 TCCGCCAGCCAT													
unknown	similar to Mid2p		G1	317	521	YNL300W	YNL300W	YNL300W	YPD	SGD	MIPS	4.49	8.53	6.19	6.19	1.84	3.57	2.56	0.39	undocumented	New	has 28% similarity to Mid2p over 71 amino acids	5.342	-1.541	5	w433 cgtCACGAAAaag	w347 tgaCACGAAAtgt	w403 tgaCGCGAAAatg	w 404 gtgACGCGaaaat	c 440 gtgACGCGcggtt				2	w433 cgtCACGAAAaag	w347 tgaCACGAAAtgt				1	w403 tgaCGCGAAAatg									2	w 404 gtgACGCGaaaat	c 440 gtgACGCGcggtt						1	c 633 CAAACCAGCGCG				1	c 633 CAAACCAGCGCG								
unknown	similar to Ypt1p and many other ras-like		G1	172	402	YNL304W	YPT11	YNL304W	YPD	SGD	MIPS	1.28	1.22	1.25	1.25	1.44	1.27	1.35	0.74	undocumented	New	Protein with similarity to Ypt1p and many other ras-like GTP-binding proteins 	1.681	-0.836	2	w473 gatCACGAAAatt	w 332 gttACGCGccgcg							1	w473 gatCACGAAAatt															1	w 332 gttACGCGccgcg							1	w 79 TTCGCCAGCGAG													
unknown	binds Sin3p		G1	201	546	YNL309W	STB1	STB1	YPD	SGD	MIPS	1.20	1.75	1.45	1.45	2.69	1.09	1.71	0.59	viable	New	Sin3p-binding protein 	2.981	-1.043	1	w 196 cgtACGCGaggcg																								1	w 196 cgtACGCGaggcg																					
DNA repair	replication factor A 36 kD subunit		G1	221	513	YNL312W	RFA2	RFA2	YPD	SGD	MIPS	1.64	1.79	1.71	1.71	2.72	1.56	2.06	0.48	lethal	Known	DNA replication Factor A; promoter has Mlu1 cell cycle box (MCB) elements	2.484	-1.139	2	w161 gtgACGCGTtaa	w124 ttgACGCGTttc																		2	w161 gtgACGCGTtaa	w124 ttgACGCGTttc											1	w 446 GATACCAGCAAA													
unknown	similar to Akr1p and Ydr126p		M/G1	95	346	YNL326C	YNL326C	YNL326C	YPD	SGD	MIPS	1.90	1.07	1.33	0.75	1.25	1.08	1.16	0.86	viable	New	Protein with similarity to Akr1p and Ydr126p 	1.350	-0.380																																																w 148 CTAAATCTGGGG
cell cycle	unknown		M/G1	75	268	YNL327W	EGT2	EGT2	YPD	SGD	MIPS	2.07	1.24	1.29	0.77	1.42	1.19	1.30	0.77	viable	Known	"involved in mother-daughter cell disjunction, most likely through the metabolism of glucans; null mutant has delayed cell separation"	12.610	-0.202	8	c 200 CAAACCAGCATC	c 306 GGAGCCAGCGCG	c 337 AGAGCCAGCAAG	c 388 GGAACCAGCAGA	C 200 CAAACCAGCATC	C 306 GGAGCCAGCGCG	C 337 AGAGCCAGCAAG	C 388 GGAACCAGCAGA																	1	w 310 cggACGCGctggc							4	C 200 CAAACCAGCATC	C 306 GGAGCCAGCGCG	C 337 AGAGCCAGCAAG	C 388 GGAACCAGCAGA	4	c 200 CAAACCAGCATC	c 306 GGAGCCAGCGCG	c 337 AGAGCCAGCAAG	c 388 GGAACCAGCAGA					
protein folding	mitochondrial chaperonin		M/G1	97	345	YNL328C	MDJ2	MDJ2	YPD	SGD	MIPS	1.27	1.43	1.06	1.06	1.44	1.16	1.29	0.77	viable	New	"Protein of the mitochondrial inner membrane with similarity to E. coli DnaJ and other DnaJ-like proteins, function partially overlaps that of Mdj1p "	2.219	-0.381	8	w 584 CAAACCAGCATC	w 478 GGAGCCAGCGCG	w 447 AGAGCCAGCAAG	w 396 GGAACCAGCAGA	w 584 CAAACCAGCATC	w 478 GGAGCCAGCGCG	w 447 AGAGCCAGCAAG	w 396 GGAACCAGCAGA																	1	c 475 cggACGCGctggc							4	w 584 CAAACCAGCATC	w 478 GGAGCCAGCGCG	w 447 AGAGCCAGCAAG	w 396 GGAACCAGCAGA	4	w 584 CAAACCAGCATC	w 478 GGAGCCAGCGCG	w 447 AGAGCCAGCAAG	w 396 GGAACCAGCAGA					
unknown	unknown		G1	135	594	YNL339C	YNL339C	YNL339C	YPD	SGD	MIPS	1.20	1.84	1.24	1.24	1.48	1.13	1.14	0.87	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.448	-0.644	1	w 255 ctgACGCGccata																								1	w 255 ctgACGCGccata																					c 509 TAAAAGCTGGGG
unknown	unknown		S	474	688	YNR009W	YNR009W	YNR009W	YPD	SGD	MIPS	3.54	1.61	2.39	2.39	1.71	1.22	1.44	0.69	undocumented	New	novel	4.744	-2.897	2	w 242 tcgACGCGccttt	c 251 tcgACGCGACGCG																							2	w 242 tcgACGCGccttt	c 251 tcgACGCGACGCG						1	w 493 AACACCAGCCAG													
mating	a-agglutinin anchor subunit		M/G1	96	307	YNR044W	AGA1	AGA1	YPD	SGD	MIPS	1.26	1.23	1.25	0.80	2.26	1.17	1.39	0.72	undocumented	Known	a-Agglutinin anchor subunit 	3.251	-0.381	1	c 289 cgtACGCGattcg																								1	c 289 cgtACGCGattcg							2	c 267 GATGCCAGCCAC	c 470 GGAACCAGCCGG												
lysine biosynthesis	saccharopine dehydrogenase		G2/M	695	104	YNR050C	LYS9	LYS9	YPD	SGD	MIPS	1.48	1.20	1.33	0.75	1.44	1.03	1.18	0.85	viable	New	"Saccharopine dehydrogenase (NADP+, L-glutamate forming) (saccharopine reductase), seventh step in lysine biosynthesis pathway "	1.480	1.651																																		1	c 596 ATTGCCAGCTTT													
unknown	similar to Pep1p		S	435	354	YNR066C	YNR066C	YNR066C	YPD	SGD	MIPS	1.08	1.17	1.04	1.04	3.52	2.56	3.00	0.33	undocumented	New	Protein with similarity to Pep1p 	1.508	-2.506																																																
unknown	unknown		M/G1	62	267	YNR067C	YNR067C	YNR067C	YPD	SGD	MIPS	1.75	1.37	1.13	0.89	2.50	1.31	1.81	0.55	undocumented	New	"similar to AFC2/YLR144c, which is involved in polarized cortical actin assembly"	8.576	-0.100	3	w 286 AAAGCCAGCAGA	w 286 AAAGCCAGCAGA	C 402 TATGCCAGCAAA						1	w 272 aggCACGAAAtct																							2	w 286 AAAGCCAGCAGA	C 402 TATGCCAGCAAA			1	w 286 AAAGCCAGCAGA								
cell wall biogenesis	chitin synthase 3 subunit		G1	309	535	YOL007C	CSI2	CSI2	YPD	SGD	MIPS	7.34	2.92	4.63	4.63	10.40	4.76	7.04	0.14	viable	New	may be a structural component of the chitin synthase 3 complex	10.520	-1.507	5	w330 ttaCACGAAAagt	w269 agcCACGAAAtgc	w365 gatCGCGAAAaaa	c398 aaaCGCGAAAacc	c 397 aaaACGCGaaaac				2	w330 ttaCACGAAAagt	w269 agcCACGAAAtgc				2	w365 gatCGCGAAAaaa	c398 aaaCGCGAAAacc								1	c 397 aaaACGCGaaaac																					
unknown	similar to phospholipases		M/G1	66	602	YOL011W	YOL011W	YOL011W	YPD	SGD	MIPS	2.31	2.89	2.58	2.58	2.16	1.20	1.61	0.62	undocumented	New	Protein with similarity to phospholipases 	1.673	-0.130	1	w 494 TACGCCAGCATC								1	w 323 ctcCACGAAAata															3	c 469 attACGCGggcag	c 507 ttaACGCGagatg	c 595 gtgACGCGgtatc					1	w 494 TACGCCAGCATC													
chromatin structure	histone-related		S	476	696	YOL012C	HTA3	HTA3	YPD	SGD	MIPS	1.01	2.18	1.47	1.47	1.61	1.39	1.50	0.67	viable	New	Histone-related protein that can suppress histone H4 point mutation	1.891	-2.909	1	w 195 gtgCACGAAAaca								1	w 195 gtgCACGAAAaca																							2	w 460 TCTGCCAGCCGC	c 230 AACACCAGCGGC												
unknown	unknown		G2/M	620	177	YOL014W	YOL014W	YOL014W	YPD	SGD	MIPS	1.66	1.13	1.21	0.83	1.33	1.33	1.33	0.75	viable	New	Protein of unknown function 	1.511	2.169																																																
signaling	calmodulin-dependent protein kinase		G1	383	353	YOL016C	CMK2	CMK2	YPD	SGD	MIPS	1.30	1.28	1.29	1.29	1.59	1.09	1.32	0.76	viable	New	Calcium/calmodulin-dependent serine/threonine protein kinase (CaM kinase) type II 	1.468	-1.985																																																
unknown	unknown		G1	269	526	YOL017W	YOL017W	YOL017W	YPD	SGD	MIPS	1.34	2.48	1.82	1.82	3.02	1.30	1.98	0.51	undocumented	New	similarity to YFR013W	5.782	-1.333	2	w187 taaACGCGTgaa	w174 tttACGCGTtta																		2	w187 taaACGCGTgaa	w174 tttACGCGTtta																									
unknown	unknown		G1	311	755	YOL019W	YOL019W	YOL019W	YPD	SGD	MIPS	4.23	3.27	3.72	3.72	3.05	2.63	2.83	0.35	undocumented	New	similarity to Rim9p and YFR012w	4.819	-1.508	1	c 403 cccACGCGACGCG																								1	c 403 cccACGCGACGCG							2	c 350 GGAGCCAGCCGT	c 598 AAGACCAGCGAT			1	c 598 AAGACCAGCGAT								c 147 TGAATGCTGGGG
unknown	similar to Gas1p		S/G2	586	148	YOL030W	YOL030W	YOL030W	YPD	SGD	MIPS	1.88	1.11	1.30	1.30	1.47	1.23	1.35	0.74	viable	New	strong similarity to Gas1	3.371	2.475	1	w 323 gtaACGCGcttta																								1	w 323 gtaACGCGcttta																					
unknown	unknown		G1	241	551	YOL034W	YOL034W	YOL034W	YPD	SGD	MIPS	1.14	1.56	1.33	1.33	2.07	1.11	1.51	0.66	viable	New	similarity to S.pombe rad18 and rpgL29 genes and other members of the SMC superfamily	1.691	-1.238	3	c400 aatCACGAAAaat	c138 caaCGCGAAAgtt	c 137 ccaACGCGaaagt						1	c400 aatCACGAAAaat					1	c138 caaCGCGAAAgtt									1	c 137 ccaACGCGaaagt							1	c 206 TATGCCAGCTTG													
arginine biosynthesis	arginosuccinate synthetase		S/G2	488	370	YOL058W	ARG1	ARG1	YPD	SGD	MIPS	1.58	1.85	1.71	0.59	1.36	1.44	1.03	1.03	undocumented	New	Argininosuccinate synthetase (citrulline--aspartate ligase)	1.574	-3.011																																																
cytoskeleton	spindle pole body component		G2/M	616	174	YOL069W	NUF2	NUF2	YPD	SGD	MIPS	1.02	1.30	1.13	0.89	1.68	1.27	1.15	0.87	lethal	New	"Coiled-coil protein of the spindle pole body, required for nuclear division "	2.448	2.240																																		2	w 426 GTCACCAGCAGG	w 142 GGTGCCAGCCAT												
unknown	unknown		G2/M	739	89	YOL070C	YOL070C	YOL070C	YPD	SGD	MIPS	1.37	1.30	1.03	1.03	2.05	3.57	2.70	2.70	undocumented	New	"shows some homology to HPC2, which is involved in histone transcription"	2.886	1.337																																		1	c 86 GGTGCCAGCCAT													
unknown	putative protein disulfide isomerase		S/G2	499	371	YOL088C	MPD2	MPD2	YPD	SGD	MIPS	1.25	1.25	1.00	1.00	2.00	1.16	1.31	0.76	viable	New	Protein disulfide isomerase-related protein 	1.471	-3.101																																																
DNA repair	MutS homolog; mismatch repair		G1	312	528	YOL090W	MSH2	MSH2	YPD	SGD	MIPS	3.11	2.50	2.79	2.79	4.01	1.35	2.33	0.43	viable	Known	"Component with Msh3p and Msh6p of DNA mismatch binding factor, involved in repair of single base mismatches and short insertions/deletions"	8.095	-1.509	3	w168 gtcACGCGTaaa	w138 aagACGCGTgaa	c 299 ggtACGCGcatag																	2	w168 gtcACGCGTaaa	w138 aagACGCGTgaa			1	c 299 ggtACGCGcatag							1	w 36 GAAACCAGCAAG				1	w 36 GAAACCAGCAAG								
DNA replication	"replication factor C, 37 kDa subunit"		G1	132	374	YOL094C	RFC4	RFC4	YPD	SGD	MIPS	1.30	1.20	1.04	1.04	1.48	1.02	1.23	0.81	lethal	New	"Replication factor C, 37 kDa subunit "	1.357	-0.620	1	w139 taaACGCGTttt																			1	w139 taaACGCGTttt																										
unknown	unknown		M/G1	21	261	YOL101C	YOL101C	YOL101C	YPD	SGD	MIPS	1.84	1.27	1.21	1.21	1.11	1.14	1.12	0.89	undocumented	New	Protein of unknown function 	1.937	0.307	1	w 446 AGTACCAGCTGT																																1	w 446 AGTACCAGCTGT													
unknown	suppresses bud emergence defect		S/G2	495	742	YOL112W	MSB4	MSB4	YPD	SGD	MIPS	1.25	1.27	1.26	1.26	1.26	1.22	1.02	0.98	undocumented	New	Multicopy suppressor of bud emergence mutants 	1.326	-3.051	1	c 270 ataACGCGaagca																								1	c 270 ataACGCGaagca																					
unknown	similar to human DS-1 protein		S/G2	556	165	YOL114C	YOL114C	YOL114C	YPD	SGD	MIPS	1.85	1.05	1.33	0.75	1.80	1.08	1.29	0.77	undocumented	New	Protein with similarity to human DS-1 protein 	1.505	2.803	1	c 123 agaCACGAAAtgt								1	c 123 agaCACGAAAtgt																																						
unknown	similar to mammalian monocarboxylate		G2/M	732	112	YOL119C	YOL119C	YOL119C	YPD	SGD	MIPS	1.72	2.13	1.91	0.52	1.02	1.16	1.09	0.92	undocumented	New	Protein with weak similarity to mammalian monocarboxylate transporter proteins 	1.711	1.396										1	w 475 ccgCACGAAAaca																																						
unknown	similar to glycophospholipid-anchored surface glycoprotein GAS1		G2/M	682	262	YOL132W	YOL132W	YOL132W	YPD	SGD	MIPS	2.22	1.27	1.68	0.60	1.98	1.12	1.33	0.75	viable	New	Protein with similarity to glycophospholipid-anchored surface glycoprotein GAS1 	1.359	1.752																																																	
unknown	unknown		G2/M	724	15	YOL150C	YOL150C	YOL150C	YPD	SGD	MIPS	1.22	1.20	1.01	1.01	2.04	1.34	1.65	0.60	undocumented	New	Protein of unknown function 	1.416	1.445																										1	c 63 aaaACGCGaagca																						
unknown	major facilitator superfamily		G2/M	697	192	YOL158C	YOL158C	YOL158C	YPD	SGD	MIPS	1.54	1.75	1.64	0.61	1.21	1.18	1.01	0.99	undocumented	New	members of family 2 of the multidrug permeases all have 14 predicted membrane-spanning regions	3.267	1.641										1	w 628 agtCACGAAAtga																							1	w 659 TCCGCCAGCAAA														
drug resistance	unknown		M/G1	82	22	YOR018W	ROD1	ROD1	YPD	SGD	MIPS	1.09	1.02	1.03	0.97	1.91	1.08	1.43	0.70	viable	New	Protein that mediates resistance to o-dinitrobenzene (O-DNB) 	2.336	-0.253																										1	w 49 tcaACGCGatttc																						
unknown	unknown		G2/M	719	40	YOR023C	YOR023C	YOR023C	YPD	SGD	MIPS	1.64	1.06	1.24	1.24	1.14	1.16	1.01	0.99	undocumented	New	Protein of unknown function 	1.322	1.524																										1	w 643 gttACGCGccgga																						
silencing	unknown		G2/M	652	231	YOR025W	HST3	HST3	YPD	SGD	MIPS	1.31	1.11	1.09	0.92	2.31	3.39	2.80	2.80	viable	New	has 54% identity to Sir2p over 37 amino acids; null mutant has silencing defect	8.396	1.961																																		1	c 546 AGCACCAGCATC														
DNA repair	exonuclease; also recombination		G1	165	453	YOR033C	EXO1	DHS1	YPD	SGD	MIPS	2.49	1.18	1.72	1.72	1.51	1.23	1.36	0.73	viable	New	Mismatch repair and recombination exonuclease that interacts with Msh2p 	2.848	-0.806	2	w257 cttACGCGTctt	c 314 aaaACGCGaactt																		1	w257 cttACGCGTctt				1	c 314 aaaACGCGaactt																						
unknown	unknown		G2/M	736	160	YOR049C	YOR049C	YOR049C	YPD	SGD	MIPS	1.18	1.04	1.06	0.94	1.34	1.01	1.15	0.87	undocumented	New	Protein of unknown function 	1.486	1.363																																		1	c 155 ACAACCAGCAGT				1	c 155 ACAACCAGCAGT									
unknown	unknown		M/G1	40	31	YOR052C	YOR052C	YOR052C	YPD	SGD	MIPS	1.05	1.49	1.25	0.80	1.69	1.14	1.22	0.82	undocumented	New	Protein of unknown function 	1.711	0.103	1	w 368 CTTGCCAGCTTA																																1	w 368 CTTGCCAGCTTA														
mitosis	spindle midzone component		G2/M	687	187	YOR058C	ASE1	ASE1	YPD	SGD	MIPS	1.07	1.37	1.13	0.88	1.55	1.96	1.13	1.13	viable	Known	"Microtubule-associated protein localized to the spindle midzone, required for anaphase spindle elongation "	4.248	1.701	1	w 250 CCCAATGAGGTAAAAGGTAAATAA																														1	w 250 CCCAATGAGGTAAAAGGTAAATAA	1	w 614 AAAACCAGCTAA														
unknown	unknown		M/G1	2	73	YOR066W	YOR066W	YOR066W	YPD	SGD	MIPS	2.18	2.27	2.23	0.45	1.11	1.77	1.40	1.40	undocumented	New	similar to YKR077W	6.828	0.546	4	w 262 ACAGCCAGCAAA	w 262 ACAGCCAGCAAA	C 125 GCAACCAGCTCT	w 378 TTTCCCTAATAGGAAA																					2	w 421 gtaACGCGctagt	c 429 gttACGCGgcgac						2	w 262 ACAGCCAGCAAA	C 125 GCAACCAGCTCT			1	w 262 ACAGCCAGCAAA									
unknown	unknown		S	464	735	YOR073W	YOR073W	YOR073W	YPD	SGD	MIPS	1.86	1.08	1.42	1.42	1.60	1.04	1.29	0.78	undocumented	New	novel	2.881	-2.795																																																	
DNA replication	thymidylate synthase		G1	243	504	YOR074C	CDC21	CDC21	YPD	SGD	MIPS	2.55	3.24	2.88	2.88	3.63	1.08	1.98	0.51	undocumented	Known	"Thymidylate synthase, converts dUMP to dTMP"	4.771	-1.243	2	w120 gcgACGCGTtag	w 125 aagACGCGACGCG																		1	w120 gcgACGCGTtag				1	w 125 aagACGCGACGCG							1	w 684 TCCGCCAGCTTC														
secretion	ER membrane t-SNARE		G1	281	390	YOR075W	UFE1	UFE1	YPD	SGD	MIPS	1.12	1.27	1.19	1.19	1.65	1.14	1.37	0.73	lethal	New	Syntaxin homolog (t-SNARE) of the endoplasmic reticulum required for targeting of vesicles to the ER 	1.457	-1.376	2	w510 gaaACGCGTcaa	w473 ttaACGCGTcac																		2	w510 gaaACGCGTcaa	w473 ttaACGCGTcac											1	c 188 GATACCAGCAAA														
unknown	unknown		G1	369	632	YOR083W	YOR083W	YOR083W	YPD	SGD	MIPS	1.41	1.53	1.04	1.04	1.28	1.05	1.11	0.90	undocumented	New	has 48% identity to Ykr091p over 31 amino acids	1.436	-1.845																																																
unknown	unknown		G1	389	799	YOR084W	YOR084W	YOR084W	YPD	SGD	MIPS	1.21	11.42	3.07	3.07	1.54	1.18	1.35	0.74	undocumented	New	Protein of unknown function 	2.825	-2.084																																																
unknown	unknown		G2/M	680	173	YOR104W	YOR104W	YOR104W	YPD	SGD	MIPS	1.41	1.18	1.29	0.78	1.53	1.29	1.09	0.92	undocumented	New	novel	1.360	1.762																					1	w 514 tatACGCGTgtt												2	c 481 TTTACCAGCCAT	c 524 TACGCCAGCCAA												
unknown	unknown		G2/M	612	169	YOR105W	YOR105W	YOR105W	YPD	SGD	MIPS	1.20	1.21	1.00	1.00	1.05	1.19	1.12	0.89	undocumented	New	Protein of unknown function 	1.590	2.280																																																
unknown	unknown		G1	356	458	YOR114W	YOR114W	YOR114W	YPD	SGD	MIPS	1.43	1.79	1.60	1.60	3.27	1.39	2.13	0.47	undocumented	New	novel	4.105	-1.733	3	c294 aagCACGAAAcgc	c301 aaaCGCGAAAaaa	c 300 gaaACGCGaaaaa						1	c294 aagCACGAAAcgc					1	c301 aaaCGCGAAAaaa									1	c 300 gaaACGCGaaaaa																					
unknown	unknown		G1	285	376	YOR115C	YOR115C	YOR115C	YPD	SGD	MIPS	1.42	1.05	1.16	1.16	1.06	1.02	1.04	0.96	undocumented	New	Protein of unknown function 	1.321	-1.392	1	c 134 ttgACGCGagttt																								1	c 134 ttgACGCGagttt							1	w 156 AGAACCAGCGTA				1	w 156 AGAACCAGCGTA								
unknown	isoamyl acetate hydrolytic enzyme		M/G1	70	19	YOR126C	IAH2	IAH1	YPD	SGD	MIPS	1.83	1.35	1.57	0.64	1.30	1.12	1.08	0.93	viable	New	Isoamyl acetate-hydrolyzing esterase enzyme 	1.702	-0.161																																																
bud site selection	putative GTPase-activating protein (GAP) for GAP for Cdc42p or Rho1p		M/G1	28	21	YOR127W	RGA1	RGA1	YPD	SGD	MIPS	1.47	1.16	1.13	0.89	1.80	1.32	1.54	0.65	viable	New	Rho-type GTPase-activating protein (GAP) for Cdc42p 	1.481	0.250																																																
unknown	unknown		G2/M	618	674	YOR129C	YOR129C	YOR129C	YPD	SGD	MIPS	1.34	1.45	1.04	1.04	1.32	1.25	1.29	0.78	undocumented	New	novel	1.409	2.190																																		1	w 425 AGTACCAGCAAA													
unknown	unknown		G1	166	452	YOR144C	YOR144C	YOR144C	YPD	SGD	MIPS	2.66	1.07	1.69	1.69	1.88	1.09	1.43	0.70	undocumented	New	weak similarity to human DNA-binding protein PO-GA and to bacterial H+-transporting ATP synthases	1.830	-0.810	1	w150 caaACGCGTaac																			1	w150 caaACGCGTaac																										
unknown	unknown		S/G2	588	133	YOR152C	YOR152C	YOR152C	YPD	SGD	MIPS	1.15	1.32	1.07	0.94	1.75	1.23	1.47	0.68	undocumented	New	Protein of unknown function 	1.425	2.458																																																
drug resistance	transporter		G2/M	611	150	YOR153W	PDR5	PDR5	YPD	SGD	MIPS	1.63	1.15	1.37	1.37	1.23	1.72	1.46	0.69	viable	New	"Multidrug resistance protein of the ATP-binding cassette (ABC) superfamily, probable drug-efflux pump "	5.116	2.282																																																
heme biosynthesis	ferrochelatase (protoheme ferrolyase)		G1	354	395	YOR176W	HEM15	HEM15	YPD	SGD	MIPS	2.77	1.00	1.66	1.66	2.17	1.05	1.51	0.66	viable	New	"Ferrochelatase (protoheme ferrolyase), last step in heme biosynthesis pathway, catalyzes insertion of ferrous iron into protoporphyrin IX "	2.696	-1.711	2	w 566 tcgACGCGcaatg	w 167 aggACGCGaagga																							2	w 566 tcgACGCGcaatg	w 167 aggACGCGaagga						2	c 296 ATTGCCAGCGGA	c 395 ATGGCCAGCATC			1	c 395 ATGGCCAGCATC								w 501 GTTTATCTGGGG
polarized growth	unknown		S	483	746	YOR188W	MSB1	MSB1	YPD	SGD	MIPS	1.75	1.72	1.73	1.73	2.16	1.15	1.37	0.73	viable	New	Protein that may play a role in polarity establishment and bud formation 	3.043	-2.980																																																
mitosis	unknown; synthetic lethal with kar3		G1	376	435	YOR195W	SLK19	SLK19	YPD	SGD	MIPS	2.21	1.66	1.91	1.91	2.80	1.47	2.03	0.49	viable	New	Protein involved with Kar3p in control of spindle dynamics	2.660	-1.921	2	w 462 tccCGCGAAAaca	c 425 ataACGCGaagaa													1	w 462 tccCGCGAAAaca									1	c 425 ataACGCGaagaa																					
transcription	"shared subunit of RNA polymerases I, II, and III"		G2/M	770	79	YOR229W	WTM2	WTM2	YPD	SGD	MIPS	3.06	2.00	2.47	0.40	1.23	1.76	1.20	1.20	viable	New	Transcriptional modulator protein involved in meiotic regulation and silencing (GB:AF001451)	5.155	0.963																																																
meiosis	transcription factor		M/G1	88	326	YOR230W	WTM1	WTM1	YPD	SGD	MIPS	1.42	1.39	1.40	0.71	1.09	2.34	1.60	1.60	viable	New	Transcriptional modulator involved in meiotic regulation and silencing (GB:AF001451)	1.835	-0.316	2	c 496 GAAGCCAGCACA	C 496 GAAGCCAGCACA																							1	w 477 ggaACGCGccggg							1	C 496 GAAGCCAGCACA				1	c 496 GAAGCCAGCACA						
RNA processing	U3 snRNA		S/G2	562	615	YOR235W	YOR235W	SNR17A	YPD	SGD	MIPS	1.68	1.40	1.10	0.91	1.22	1.11	1.17	0.86	undocumented	New	questionable ORF	1.636	2.728																																		1	w 256 GAGGCCAGCACA				1	w 256 GAGGCCAGCACA						
sporulation	unknown; similar to class II family of aminoacyl-tRNA synthetases		M/G1	51	263	YOR242C	YOR242C	SSP2	YPD	SGD	MIPS	1.28	1.01	1.13	1.13	1.34	1.17	1.07	0.93	undocumented	New	Protein with similarity to class II family of aminoacyl-tRNA synthetases 	6.810	0.004	1	C 671 AGAGCCAGCCAA																								1	c 74 aatACGCGagaat							1	C 671 AGAGCCAGCCAA											
unknown	unknown; similar to Svs1p; suppressor of Rad53 lethality		G1	357	766	YOR247W	YOR247W	SRL1	YPD	SGD	MIPS	4.89	5.02	4.95	4.95	3.80	2.56	3.12	0.32	undocumented	New	similar to SVS1	2.970	-1.733	4	w543 caaCACGAAAcgc	w589 agaCGCGAAAgac	w 590 aagACGCGaaaga	c 190 aatACGCGagaaa					1	w543 caaCACGAAAcgc					1	w589 agaCGCGAAAgac									2	w 590 aagACGCGaaaga	c 190 aatACGCGagaaa				1	w 563 CCTTTTTCGGAATATGTCAACAA													
unknown	unknown		G1	353	770	YOR248W	YOR248W	YOR248W	YPD	SGD	MIPS	4.88	5.10	4.99	4.99	4.27	2.00	2.92	0.34	undocumented	New	novel; questionable ORF	2.855	-1.701	1	c 527 aatACGCGagaaa																								1	c 527 aatACGCGagaaa							1	c 150 TGAACCAGCTCG											
mRNA 3'-end processing	cleavage/polyadenylation factor CF IA component		S	419	362	YOR250C	CLP1	CLP1	YPD	SGD	MIPS	1.33	1.23	1.28	0.78	2.19	1.32	1.29	0.78	undocumented	New	"Subunit of cleavage and polyadenylation factor IA,required for 3'-end processing of pre-mRNA "	1.664	-2.413																																		1	c 90 TTTGCCAGCAGT											
unknown	similar to secretory protein Ssp134p		G2/M	683	124	YOR256C	YOR256C	YOR256C	YPD	SGD	MIPS	1.00	1.11	1.05	0.95	2.16	1.31	1.28	0.78	undocumented	New	Protein with similarity to secretory protein Ssp134p 	4.576	1.732																																														
unknown	unknown		G2/M	655	50	YOR258W	YOR258W	YOR258W	YPD	SGD	MIPS	1.52	1.14	1.32	0.76	1.79	1.32	1.17	0.86	undocumented	New	Protein of unknown function 	1.754	1.940																																														
unknown	similar to adenosine A1 receptors		M/G1	37	270	YOR263C	YOR263C	YOR263C	YPD	SGD	MIPS	1.59	1.50	1.03	0.97	1.29	1.27	1.28	0.78	undocumented	New	novel; questionable ORF	3.690	0.139																																														
unknown	unknown		M/G1	25	272	YOR264W	YOR264W	YOR264W	YPD	SGD	MIPS	1.21	1.10	1.15	0.87	1.58	1.02	1.27	0.79	undocumented	New	novel	3.269	0.292	7	w 344 AAAGCCAGCGCT	w 266 ATAACCAGCAAA	c 417 TCGGCCAGCAAT	w 344 AAAGCCAGCGCT	w 318 TTGACCAGCCTT	w 266 ATAACCAGCAAA	C 417 TCGGCCAGCAAT																										4	w 344 AAAGCCAGCGCT	w 318 TTGACCAGCCTT	w 266 ATAACCAGCAAA	C 417 TCGGCCAGCAAT	3	w 344 AAAGCCAGCGCT	w 266 ATAACCAGCAAA	c 417 TCGGCCAGCAAT				
vacuolar acidification	vacuolar H+-ATPase 95 kD subunit		G1	114	255	YOR270C	VPH1	VPH1	YPD	SGD	MIPS	1.52	1.00	1.23	1.23	1.80	1.19	1.23	0.81	viable	New	"Vacuolar H-ATPase (V-ATPase) 94 kDa subunit of membrane (V0) sector, essential for vacuolar acidification and vacuolar H-ATPase (V-ATPase) activity "	1.336	-0.526																																														
unknown	similar to members of major facilitator superfamily		G2/M	726	163	YOR273C	YOR273C	YOR273C	YPD	SGD	MIPS	1.42	1.04	1.17	0.86	1.23	1.12	1.17	0.85	undocumented	New	Protein with similarity to members of major facilitator superfamily (MFS) multidrug-resistance (MFS-MDR) protein family 	2.891	1.428																																														
unknown	similar to phosphoglycerate mutases		G1	365	375	YOR283W	YOR283W	YOR283W	YPD	SGD	MIPS	1.05	1.30	1.17	0.86	1.15	1.02	1.06	0.94	undocumented	New	Protein with similarity to phosphoglycerate mutases 	1.414	-1.816																																														
unknown	meiosis (putative)		G2/M	626	49	YOR298W	YOR298W	YOR298W	YPD	SGD	MIPS	1.95	1.21	1.27	0.79	2.24	1.06	1.45	0.69	undocumented	New	Protein of unknown function 	2.957	2.130																																														
secretion	unknown; suppresses ypt1 null		G1	143	298	YOR307C	SLY41	SLY41	YPD	SGD	MIPS	1.67	1.20	1.42	1.42	1.20	1.09	1.14	0.88	viable	New	Protein involved in secretory pathway 	4.219	-0.687																																														
unknown	unknown		G1	126	297	YOR308C	YOR308C	YOR308C	YPD	SGD	MIPS	1.16	1.09	1.03	1.03	1.87	1.19	1.26	0.80	undocumented	New	Protein of unknown function 	4.945	-0.585	1	c 407 ggaACGCGagggg																								1	c 407 ggaACGCGagggg																			
sporulation	putative cell wall component		G2/M	721	182	YOR313C	SPS4	SPS4	YPD	SGD	MIPS	1.55	1.35	1.07	0.93	1.04	1.22	1.08	0.92	viable	New	"Protein expressed in mid-late (8-14 hr) sporulation, possible cell wall component "	1.976	1.464																					1	w 226 cagACGCGTtgc				1	w 201 ttgACGCGcgcca																					
unknown	unknown		G2/M	718	183	YOR314W	YOR314W	YOR314W	YPD	SGD	MIPS	1.84	1.02	1.37	0.73	1.49	1.27	1.09	0.92	undocumented	New	novel	2.546	1.547																										1	w 569 acaACGCGctcta																					
unknown	unknown		G2/M	633	184	YOR315W	YOR315W	YOR315W	YPD	SGD	MIPS	1.19	1.03	1.07	0.93	3.06	1.47	2.12	2.12	undocumented	New	novel	3.634	2.095																										1	c 93 taaACGCGcctaa																					c 137 TCTATCCTGGGG
fatty acid metabolism	long chain fatty acyl:CoA synthetase		M/G1	78	344	YOR317W	FAA1	FAA1	YPD	SGD	MIPS	2.03	1.69	1.85	1.85	1.51	1.10	1.29	0.78	viable	New	"Long-chain fatty acid CoA ligase (fatty acid activator 1), can incorporate exogenous myristate into myristoyl-CoA and other fatty acids to the CoA derivatives"	1.467	-0.233	1	w 628 TTTGCCAGCTGC														1	c 238 atcCGCGAAAgga									1	c 275 aaaACGCGcgaga							1	w 628 TTTGCCAGCTGC													
unknown	unknown		G1	292	636	YOR320C	YOR320C	YOR320C	YPD	SGD	MIPS	2.77	1.05	1.70	1.70	1.55	1.05	1.28	0.78	undocumented	New	Protein of unknown function 	3.850	-1.425	1	w 195 agcACGCGaccgt																								1	w 195 agcACGCGaccgt							1	c 108 TCCACCAGCCTG													
protein glycosylation	dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase		G1	256	771	YOR321W	PMT3	PMT3	YPD	SGD	MIPS	3.26	2.43	2.81	2.81	1.40	1.39	1.39	0.72	viable	New	"Mannosyltransferase (dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase), involved inititation of O-glycosylation"	1.702	-1.277	1	w 148 gcgACGCGaggaa																								1	w 148 gcgACGCGaggaa																					
proline biosynthesis	gamma-glutamyl phosphate reductase		S/G2	534	708	YOR323C	PRO2	PRO2	YPD	SGD	MIPS	1.11	1.06	1.09	1.09	1.48	1.00	1.22	0.82	lethal	New	"Gamma-glutamyl phosphate reductase (phosphoglutamate dehydrogenase), proline biosynthetic enzyme "	2.082	3.030	3	w 444 caaCACGAAAtcc	w 296 ggtACGCGTaca	w 211 tcaACGCGcatgg						1	w 444 caaCACGAAAtcc										1	w 296 ggtACGCGTaca				1	w 211 tcaACGCGcatgg																					
unknown	unknown		S/G2	527	707	YOR324C	YOR324C	YOR324C	YPD	SGD	MIPS	1.28	1.03	1.15	0.87	2.28	1.12	1.60	0.63	undocumented	New	Protein of unknown function 	3.430	3.062																																																
vacuolar acidification	vacuolar H+-ATPase V1 domain 27 KD subunit		S/G2	558	372	YOR332W	VMA4	VMA4	YPD	SGD	MIPS	1.12	1.18	1.15	0.87	1.87	1.33	1.19	0.84	viable	New	"Vacuolar H-ATPase (V-ATPase) hydrophilic subunit (subunit E), 27 kDa subunit of V1 sector "	1.429	2.766																																																
transcription	Ty1 enhancer activator		S/G2	572	35	YOR337W	TEA1	TEA1	YPD	SGD	MIPS	1.04	2.48	1.60	1.60	1.22	1.49	1.35	0.74	viable	New	Ty1 enhancer activator of the Gal4p-type family of DNA-binding proteins 	1.547	2.569	1	w 454 attACGCGacggt																								1	w 454 attACGCGacggt																					
unknown	unknown		M/G1	46	379	YOR342C	YOR342C	YOR342C	YPD	SGD	MIPS	1.50	1.15	1.31	1.31	2.17	1.00	1.47	0.68	undocumented	New	Protein of unknown function 	1.503	0.041	4	w 697 GGAGCCAGCACT	c 307 AAGACCAGCATT	w 697 GGAGCCAGCACT	C 307 AAGACCAGCATT											2	c 492 aaaCGCGAAAagc	c 592 aggCGCGAAAtac								2	w 460 taaACGCGcatct	c 491 aaaACGCGaaaag						2	w 697 GGAGCCAGCACT	C 307 AAGACCAGCATT			2	w 697 GGAGCCAGCACT	c 307 AAGACCAGCATT							
respiration (putative)	unknown; suppresses nam9-1		G1	218	378	YOR355W	GDS1	GDS1	YPD	SGD	MIPS	1.46	1.98	1.16	1.16	1.27	1.03	1.14	0.87	viable	New	"Protein that suppresses nam9-1 glycerol deficient phenotype when overexpressed, involved in nuclear control of mitochondria "	1.629	-1.124																																																
unknown	unknown		G1	413	724	YOR372C	YOR372C	YOR372C	YPD	SGD	MIPS	1.85	1.10	1.43	1.43	1.19	1.24	1.02	1.02	undocumented	New	novel	1.371	-2.363	3	c436 cacCACGAAAgct	w179 cctCGCGAAAaga	c 454 cgaACGCGcacag						1	c436 cacCACGAAAgct					1	w179 cctCGCGAAAaga									1	c 454 cgaACGCGcacag							1	c 405 CGAGCCAGCTGG													
unknown	unknown		G2/M	720	251	YOR383C	YOR383C	YOR383C	YPD	SGD	MIPS	1.28	1.07	1.17	0.85	1.62	1.08	1.22	0.82	undocumented	New	Protein of unknown function 	2.223	1.475																																		1	c 576 AAAACCAGCATC				1	c 576 AAAACCAGCATC								
unknown	unknown		S/G2	485	34	YOR391C	YOR391C	YOR391C	YPD	SGD	MIPS	1.18	1.91	1.27	1.27	1.03	1.05	1.04	0.96	undocumented	New	Protein of unknown function 	2.426	-3.000																																																
unknown	unknown		M/G1	71	382	YPL014W	YPL014W	YPL014W	YPD	SGD	MIPS	2.29	1.52	1.23	1.23	1.06	1.38	1.14	1.14	undocumented	New	Protein of unknown function 	1.591	-0.161																					1	w 289 tttACGCGTcac																										
unknown	unknown		S/G2	598	51	YPL021W	SRD2	ECM23	YPD	SGD	MIPS	1.28	1.04	1.11	0.90	1.71	2.46	1.20	1.20	undocumented	New	Protein with similarity to Srd1p 	2.258	2.393																																																
unknown	unknown		S/G2	566	38	YPL025C	YPL025C	YPL025C	YPD	SGD	MIPS	1.76	1.89	1.82	0.55	1.47	1.41	1.02	0.98	undocumented	New	Protein of unknown function 	1.653	2.663																																		3	w 618 AGTACCAGCCAA	c 16 AGAGCCAGCAGA	c 545 ACCACCAGCGTA		1	c 16 AGAGCCAGCAGA								
unknown	unknown; styryl dye vacuolar localization		G1	408	761	YPL032C	SVL3	SVL3	YPD	SGD	MIPS	2.47	1.06	1.52	1.52	3.25	1.21	1.64	0.61	undocumented	New	Protein involved in vacuolar uptake of endocytosed vital dyes	2.123	-2.313																																																
H+ homeostasis	plasma membrane H+-ATPase		G2/M	716	199	YPL036W	PMA2	PMA2	YPD	SGD	MIPS	1.85	1.18	1.48	0.68	1.90	1.55	1.72	1.72	viable	New	H+-transporting P-type ATPase of the plasma membrane; almost identical to PMA1	3.777	1.553																																																
unknown	unknown		S	421	361	YPL054W	LEE1	LEE1	YPD	SGD	MIPS	1.33	1.40	1.37	1.37	2.74	1.27	1.87	0.54	undocumented	New	Protein of unknown function 	1.734	-2.413	1	c 348 aagCACGAAAata								1	c 348 aagCACGAAAata																																					
sphingolipid metabolism	suppresses cls2-2and rvs161		G1	204	556	YPL057C	SUR1	SUR1	YPD	SGD	MIPS	1.92	2.13	2.02	2.02	1.91	1.61	1.76	0.57	undocumented	New	Protein required for the synthesis of mannosylated sphingolipids 	3.412	-1.065	2	w630 tccCACGAAAtcc	c 534 gcgACGCGACGCG							1	w630 tccCACGAAAtcc															1	c 534 gcgACGCGACGCG																					
drug resistance	transporter		G2/M	696	179	YPL058C	PDR12	PDR12	YPD	SGD	MIPS	2.11	1.29	1.28	0.78	1.57	1.18	1.15	0.87	undocumented	New	"Protein with similarity to Pdr5p and Snq2p, member of the ATP-binding cassette (ABC) superfamily "	2.589	1.641																																																
ethanol utilization	acetaldehyde dehydrogenase		G2/M	757	120	YPL061W	ALD6	ALD6	YPD	SGD	MIPS	2.58	2.09	2.32	0.43	1.71	1.28	1.48	1.48	undocumented	New	Cytosolic acetaldehyde dehydrogenase 	6.189	1.098																																		2	w 648 GCAACCAGCACG	w 554 ATGGCCAGCACC			2	w 648 GCAACCAGCACG	w 554 ATGGCCAGCACC							
glycolysis	transcriptional activator		S/G2	571	134	YPL075W	GCR1	GCR1	YPD	SGD	MIPS	1.42	1.11	1.13	0.88	1.70	1.04	1.33	0.75	viable	New	"Protein required for expression of glycolytic genes, causes same spectrum of enzymatic changes as does Gcr2p "	1.946	2.579																																		1	w 350 ATTACCAGCACA													
unknown	similar to Ybr177p		G2/M	743	14	YPL095C	YPL095C	YPL095C	YPD	SGD	MIPS	1.05	1.19	1.06	1.06	1.06	1.27	1.09	0.91	undocumented	New	Protein with similarity to Ybr177p 	1.692	1.286																																																
arginine metabolism	arginase		G2/M	644	137	YPL111W	CAR1	CAR1	YPD	SGD	MIPS	1.32	1.11	1.09	1.09	1.02	1.52	1.24	0.81	viable	New	"Arginase, present in a complex with ornithine carbamyltransferase where it acts as a allosteric regulator "	1.456	1.994	1	w 513 CCTATTCTAGCAACCTTACATGAAACA														1	w 273 cgcCGCGAAAata																															
unknown	"similar to Hda1p, Rpd3p, Hos2p, and Hos1p"		S/G2	511	681	YPL116W	HOS3	HOS3	YPD	SGD	MIPS	1.50	1.40	1.45	1.45	1.96	1.73	1.07	0.94	undocumented	New	similarity to Histone deacetylase	3.070	3.129	1	c 110 ccaCACGAAAaga								1	c 110 ccaCACGAAAaga																																					
nuclear protein targeting	spindle pole body associated protein		G1	379	548	YPL124W	NIP29	NIP29	YPD	SGD	MIPS	2.71	2.32	2.51	2.51	2.63	1.05	1.66	0.60	undocumented	New	Nuclear import protein 	2.158	-1.931	2	w116 aaaCGCGAAAagt	w 117 caaACGCGaaaag													1	w116 aaaCGCGAAAagt									1	w 117 caaACGCGaaaag																					
chromatin structure	histone H1		S	448	788	YPL127C	HHO1	HHO1	YPD	SGD	MIPS	1.13	3.96	2.12	2.12	1.61	1.41	1.51	0.66	viable	New	Histone H1	8.513	-2.615	2	c 184 cgaCGCGAAAatg	c 178 aaaACGCGACGCG													1	c 184 cgaCGCGAAAatg									1	c 178 aaaACGCGACGCG																					w 635 TATTCGGCGGGG
telomere length regulation	telomere TTAGGG repeat-binding factor		S/G2	550	709	YPL128C	TBF1	TBF1	YPD	SGD	MIPS	1.29	1.59	1.43	1.43	2.37	1.03	1.52	0.66	lethal	New	Teleomere binding protein that binds to TTAGGG repeats	2.411	2.880																																																
unknown	"similar to transcription factors, has Zn[2]-Cys[6]"		S/G2	538	621	YPL133C	YPL133C	YPL133C	YPD	SGD	MIPS	1.20	1.28	1.04	0.97	1.35	1.33	1.01	1.01	undocumented	New	"Protein with similarity to transcription factors, has Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-terminal region "	1.354	2.996																																																
unknown	similar to Kin4p		S/G2	594	216	YPL141C	YPL141C	YPL141C	YPD	SGD	MIPS	1.10	1.03	1.06	0.94	2.52	1.18	1.46	1.46	undocumented	New	Serine/threonine protein kinase with similarity to Kin4p	3.542	2.411																																																c 695 TTTTAAGTGGGG
"cell cycle, checkpoint"	protein kinase		G1	209	523	YPL153C	SPK1	RAD53	YPD	SGD	MIPS	1.01	1.94	1.40	1.40	1.47	1.24	1.35	0.74	lethal	Known	Serine/threonine/tyrosine protein kinase with a checkpoint function in S and G2	6.135	-1.077	2	w225 tagACGCGTaat	w202 gtgACGCGTctc																		2	w225 tagACGCGTaat	w202 gtgACGCGTctc											1	c 534 CACACCAGCGGT													
cytoskeleton (putative)	kinesin-related protein		S/G2	593	217	YPL155C	KIP2	KIP2	YPD	SGD	MIPS	1.02	1.30	1.13	1.13	1.46	1.51	1.48	1.48	viable	New	functions antagonistically with Kar3p at the spindle poles to influence cytoplasmic microtubule numbers	2.696	2.412																																																
unknown	unknown		M/G1	36	280	YPL158C	YPL158C	YPL158C	YPD	SGD	MIPS	1.24	1.07	1.08	0.93	1.52	1.20	1.35	0.74	undocumented	New	weak similarity to human nucleolin	7.995	0.158	1	C 302 TTCGCCAGCCAT																																1	C 302 TTCGCCAGCCAT													
vanadate resistance	unknown		G1	249	470	YPL163C	SVS1	SVS1	YPD	SGD	MIPS	11.24	1.14	3.58	3.58	7.19	2.86	4.53	0.22	viable	New	Suppressor of Vanadate Sensitivity; similar to YOR247	6.967	-1.258	2	c214 aaaCACGAAAtta	c232 gaaCACGAAAtgc							2	c214 aaaCACGAAAtta	c232 gaaCACGAAAtgc																																				
mating	alpha factor precursor		M/G1	33	310	YPL187W	MFALPHA1	MF(ALPHA)1	YPD	SGD	MIPS	1.41	1.00	1.19	0.84	1.29	1.25	1.02	0.98	viable	New	Mating pheromone alpha-1 factor 	2.416	0.174																																																
unknown	unknown		G1	340	542	YPL208W	YPL208W	YPL208W	YPD	SGD	MIPS	3.62	1.70	2.48	2.48	2.13	1.12	1.38	0.73	undocumented	New	similar to YHL039W	3.444	-1.611	2	c519 ataCACGAAAata	w89 aaaACGCGTgaa							1	c519 ataCACGAAAata										1	w89 aaaACGCGTgaa																										
"mitosis, chromosome segregation"	protein kinase		G1	299	419	YPL209C	IPL1	IPL1	YPD	SGD	MIPS	1.79	1.19	1.23	1.23	1.31	1.23	1.27	0.79	lethal	New	Serine/threonine protein kinase involved in chromosome segregation	1.864	-1.446	1	w171 ttcACGCGTttt																			1	w171 ttcACGCGTttt																										
unknown	unknown; bypass of PAM1		G1	187	601	YPL221W	YPL221W	BOP1	YPD	SGD	MIPS	1.94	1.51	1.71	1.71	1.83	1.37	1.58	0.63	undocumented	New	"strong similarity to YGL139W, YAL053W and YOR365C "	1.509	-0.963	2	w612 gaaCACGAAAact	c 690 cgaACGCGgtgta							1	w612 gaaCACGAAAact															1	c 690 cgaACGCGgtgta																					
secretion	post-Golgi t-SNARE		G1	170	296	YPL232W	SSO1	SSO1	YPD	SGD	MIPS	1.62	1.21	1.40	1.40	1.63	1.02	1.26	0.79	viable	New	Syntaxin homolog (t-SNARE) involved in vesicle transport from Golgi to plasma membrane 	1.826	-0.825	1	w 231 gaaACGCGaatac																								1	w 231 gaaACGCGaatac							1	w 337 AGAGCCAGCCTT													
"mitosis, chromosome segregation"	unknown		G1	347	547	YPL241C	CIN2	CIN2	YPD	SGD	MIPS	1.36	2.04	1.67	1.67	1.29	1.10	1.08	0.92	viable	New	Protein involved in chromosome segregation	2.854	-1.671	2	w88 ccgACGCGTcta	w 65 aaaACGCGaagaa																		1	w88 ccgACGCGTcta				1	w 65 aaaACGCGaagaa																					
cytoskeleton	IQGAP homolog		G2/M	673	218	YPL242C	IQG1	IQG1	YPD	SGD	MIPS	1.10	1.33	1.21	1.21	1.30	1.71	1.49	1.49	lethal	New	"required for cell division, but not for the progression of the budding or the nuclear cycle"	3.086	1.824	1	w 185 CCTAAAAGAGGAAAGTGTAAACAT														1	c 283 aagCGCGAAAcaa															1	w 185 CCTAAAAGAGGAAAGTGTAAACAT															w 554 TAAACCGTGGGG
unknown	unknown		S	458	637	YPL250C	YPL250C	YPL250C	YPD	SGD	MIPS	1.17	1.63	1.18	1.18	1.65	1.37	1.51	0.66	undocumented	New	Protein of unknown function 	1.561	-2.705	1	w 311 agcACGCGcgcga																								1	w 311 agcACGCGcgcga							1	w 482 ATAACCAGCCCA													
nuclear fusion (putative)	Kar3p interactor		S	471	692	YPL253C	VIK1	VIK1	YPD	SGD	MIPS	1.34	1.25	1.30	1.30	1.33	1.18	1.25	0.80	undocumented	New	Probable coiled-coil protein that interacts with Kar3p 	2.239	-2.877	1	c 237 tatCGCGAAAcga														1	c 237 tatCGCGAAAcga																															w 631 TATTCGGCGGGG
cell cycle and meiosis	unknown		G1	254	764	YPL255W	BBP1	BBP1	YPD	SGD	MIPS	2.88	2.52	2.69	2.69	1.56	1.33	1.44	0.69	lethal	New	Bbp1p-depleted cells arrest with a G2 DNA content and a nonuniform morphology	1.557	-1.273	6	w121 aatCACGAAAaac	c539 gtaCACGAAAttc	c582 agtCACGAAAcgc	c514 catCGCGAAAttt	w 154 ctgACGCGacccg	c 588 gaaACGCGccaaa			3	w121 aatCACGAAAaac	c539 gtaCACGAAAttc	c582 agtCACGAAAcgc			1	c514 catCGCGAAAttt									2	w 154 ctgACGCGacccg	c 588 gaaACGCGccaaa																				
cell cycle	G1/S cyclin		G1	294	536	YPL256C	CLN2	CLN2	YPD	SGD	MIPS	8.18	3.94	5.68	5.68	8.25	4.00	5.74	0.17	viable	Known	G1 cyclin	10.900	-1.429	3	w135 taaCGCGAAAacg	w128 aaaACGCGTgaa	w 136 ttaACGCGaaaac												1	w135 taaCGCGAAAacg				1	w128 aaaACGCGTgaa				1	w 136 ttaACGCGaaaac							2	w 590 TCAGCCAGCTCA	c 226 AGAACCAGCGGC			1	c 226 AGAACCAGCGGC								
unknown	major facilitator superfamily		S/G2	533	619	YPL264C	YPL264C	YPL264C	YPD	SGD	MIPS	1.12	1.05	1.03	0.97	2.59	1.21	1.46	0.68	undocumented	New	"Protein of unknown function, member of the major facilitator superfamily (MFS) "	1.669	3.036	1	w 51 attCACGAAAgct								1	w 51 attCACGAAAgct																																				
transport	dicarboxylic amino acid permease		G2/M	643	122	YPL265W	DIP5	DIP5	YPD	SGD	MIPS	2.81	1.16	1.81	0.55	1.09	2.51	1.52	1.52	undocumented	New	Dicarboxylic amino acid permease 	1.491	2.005																																		1	c 567 ACTGCCAGCGAC												
unknown	unknown		G1	208	519	YPL267W	YPL267W	YPL267W	YPD	SGD	MIPS	5.20	3.96	4.54	4.54	3.00	1.45	2.08	0.48	undocumented	New	weak similarity to C.elegans transcription factor unc-86	4.936	-1.070	3	c146 ctaCGCGAAAtat	w129 ttgACGCGTctt	c 138 tcaACGCGctacg												1	c146 ctaCGCGAAAtat				1	w129 ttgACGCGTctt				1	c 138 tcaACGCGctacg																				
cytoskeleton	cytoplasmic microtubule orientation		S	436	620	YPL269W	KAR9	KAR9	YPD	SGD	MIPS	1.10	1.71	1.37	1.37	1.79	1.02	1.32	0.76	viable	New	"Protein of the cell cortex required for the congression (nuclear migration) step of karyogamy, involved in proper orientation of cytoplasmic microtubules "	2.398	-2.514	1	w 259 aagACGCGgcaaa																								1	w 259 aagACGCGgcaaa																				
unknown	similar to Gap1p and other amino acid permeases		S	459	641	YPL274W	YPL274W	YPL274W	YPD	SGD	MIPS	1.59	1.57	1.01	1.01	1.49	1.21	1.11	0.90	undocumented	New	Protein with similarity to Gap1p and other amino acid permeases 	2.111	-2.705																																		1	w 580 TCTGCCAGCTTA												w 513 CCTATTCTAGCAACCTTACATGAAACA
unknown	similar to other subtelomerically-encoded protein		M/G1	87	567	YPL283C	YPL283C	YPL283C	YPD	SGD	MIPS	1.22	1.34	1.05	1.05	1.55	1.12	1.32	0.76	undocumented	New	Protein with similarity to other subtelomerically-encoded protein (YPL283 and YGR296W code for identical proteins)	2.422	-0.295																										1	w 255 ctgACGCGccata																				
unknown	similar to mouse REX1 encoded transcription factor		G2/M	645	41	YPR013C	YPR013C	YPR013C	YPD	SGD	MIPS	1.57	1.49	1.03	0.97	1.84	1.07	1.31	0.76	undocumented	New	Protein with similarity to mouse REX1 encoded transcription factor (SP:P22227)	1.421	1.984																																															
unknown	unknown		G2/M	630	175	YPR014C	YPR014C	YPR014C	YPD	SGD	MIPS	1.47	1.42	1.02	0.98	1.73	1.23	1.46	0.68	undocumented	New	Protein of unknown function 	1.722	2.118																																															
chromatin structure	chromatin assembly factor I subunit		G1	173	406	YPR018W	RLF2	RLF2	YPD	SGD	MIPS	1.49	1.22	1.11	1.11	1.62	2.70	2.10	0.48	viable	New	"Aka CAC1; Chromatin Assembly Complex, subunit #1: Encodes the largest (p90) subunit of a three-subunit protein complex (yeast CAF-I) involved in DNA-replication-linked nucleosome assembly. Homologous to the p150 subunit of human Chromatin Assembly Factor-I (CAF-I)."	3.116	-0.864	1	w235 ctcACGCGTtcg																			1	w235 ctcACGCGTtcg																									
DNA replication	MCM initiator complex		G2/M	794	96	YPR019W	CDC54	CDC54	YPD	SGD	MIPS	1.20	1.33	1.05	0.95	1.43	1.66	1.54	1.54	lethal	New	aka MCM4; MCM proteins are components of the prereplication complex because association of MCM proteins with replication origins requires both Orc1p and Cdc6 function	4.048	0.654																																															
cytoskeleton (putative)	actin-related protein		S	468	668	YPR034W	ARP7	ARP7	YPD	SGD	MIPS	1.11	1.40	1.25	1.25	1.50	1.03	1.21	0.83	undocumented	New	Protein with weak similarity to actin and actin-related protein Arp4p and Arp1p	1.417	-2.855	1	c 150 gaaACGCGgccat																								1	c 150 gaaACGCGgccat							1	c 408 CTAACCAGCTCG												
unknown	similar to C. elegans protein		G2/M	609	167	YPR045C	YPR045C	YPR045C	YPD	SGD	MIPS	1.31	1.08	1.10	1.10	2.88	1.08	1.76	0.57	undocumented	New	"Protein of unknown function, has similarity to C. elegans protein U13070 "	1.638	2.294																										1	c 615 agaACGCGacgaa																				
signaling (putative)	pheromone pathway		G1	398	748	YPR075C	OPY2	OPY2	YPD	SGD	MIPS	1.89	1.24	1.53	1.53	2.35	1.01	1.54	0.65	undocumented	New	Protein that imparts Far- phenotype (GB:AF016263)	2.433	-2.184	2	w190 gaaACGCGTtaa	w167 acaACGCGTtac																		2	w190 gaaACGCGTtaa	w167 acaACGCGTtac																								
unknown	unknown		G1	385	749	YPR076W	YPR076W	YPR076W	YPD	SGD	MIPS	1.07	1.40	1.22	1.22	1.71	1.27	1.47	0.68	undocumented	New	Protein of unknown function 	2.115	-2.017	1	c 676 gatACGCGagagc																								1	c 676 gatACGCGagagc							1	w 355 ATCACCAGCTGC												
staurosporine resistance	protein kinase		G1	387	398	YPR106W	ISR1	ISR1	YPD	SGD	MIPS	1.07	1.27	1.17	1.17	1.49	1.01	1.23	0.81	undocumented	New	"Serine-threonine protein kinase, involved in staurosporine resistance "	5.016	-2.075																																		1	w 175 CAAACCAGCTAG												
mRNA 3'-end processing	cleavage/polyadenylation specificity factor subunit		S	440	363	YPR107C	YTH1	YTH1	YPD	SGD	MIPS	1.41	1.08	1.23	0.81	1.96	1.23	1.26	0.79	lethal	New	Component of polyadenylation factor I 	1.639	-2.565	1	w 202 tttACGCGccgtc																								1	w 202 tttACGCGccgtc																				
cell cycle	M phase; protein kinase		S/G2	604	660	YPR111W	DBF20	DBF20	YPD	SGD	MIPS	1.52	1.16	1.33	0.75	2.40	1.39	1.31	0.76	viable	New	"Cell cycle protein kinase related to Dbf2p, involved in termination of M-phase "	2.573	2.309																																																
cell cycle	G2/M cyclin		G2/M	661	239	YPR119W	CLB2	CLB2	YPD	SGD	MIPS	1.54	1.43	1.49	0.67	3.95	3.23	3.57	3.57	viable	Known	B-type cyclin	10.050	1.897	2	TTGCACTTTCCTAAACGGGCTCAATATGTCAACAACGAAG	ATATAGCGACCGAATCAGGAAAAG   GTCAACAACGAAG																													2	TTGCACTTTCCTAAACGGGCTCAATATGTCAACAACGAAG	ATATAGCGACCGAATCAGGAAAAGGTCAACAACGAAG														
cell cycle	G1/S cyclin		G1	213	541	YPR120C	CLB5	CLB5	YPD	SGD	MIPS	5.76	2.78	4.00	4.00	1.31	1.11	1.21	0.83	viable	Known	B-type cyclin involved in S-phase initiation	4.832	-1.104	2	w204 gctACGCGTcat	w163 agtACGCGTggt																		2	w204 gctACGCGTcat	w163 agtACGCGTggt																									
unknown	similar to ADP/ATP carrier proteins		G2/M	654	135	YPR128C	YPR128C	YPR128C	YPD	SGD	MIPS	1.25	1.14	1.05	0.95	1.30	1.09	1.19	0.84	undocumented	New	Protein with similarity to ADP/ATP carrier proteins and members of the mitochondrial carrier family (MCF)	1.859	1.950																																																
DNA replication	polymerase alpha binding protein		G1	223	558	YPR135W	POB1	CTF4	YPD	SGD	MIPS	1.53	1.63	1.03	1.03	1.71	1.06	1.34	0.74	viable	New	"Protein required for DNA synthesis, binds polymerase alpha"	4.140	-1.155	3	w126 gcgACGCGTaat	w 131 ttaACGCGACGCG	c 396 ttaACGCGcttgt																	1	w126 gcgACGCGTaat				2	w 131 ttaACGCGACGCG	c 396 ttaACGCGcttgt																				
transport	ammonia permease		G2/M	679	136	YPR138C	MEP3	MEP3	YPD	SGD	MIPS	1.63	1.30	1.46	0.69	1.28	1.03	1.12	0.90	viable	New	Ammonia permease of high capacity and low affinity 	1.589	1.762																																		1	c 466 CAAACCAGCTAC													
mating; nuclear fusion; mitosis	kinesin-like protein		G1	400	727	YPR141C	KAR3	KAR3	YPD	SGD	MIPS	2.07	1.13	1.53	1.53	2.17	1.11	1.55	0.64	viable	Known	"Kinesin-like protein involved in mitosis and essential for the congression (nuclear migration) step of karyogamy, probable coiled-coil protein "	2.796	-2.220	2	c161 taaCGCGAAAaaa	c 160 ttaACGCGaaaaa													1	c161 taaCGCGAAAaaa									1	c 160 ttaACGCGaaaaa							1	c 346 GAGGCCAGCAGA				1	c 346 GAGGCCAGCAGA								
"secretion, non-classical"	unknown		G2/M	684	203	YPR149W	NCE102	NCE102	YPD	SGD	MIPS	3.76	2.94	3.33	0.30	1.30	4.33	2.37	2.37	undocumented	New	negative regulator of CTS1 expression	8.962	1.722																																																
ATP synthesis	regulates Atp6p and Atp8p synthesis		S/G2	532	247	YPR155C	NCA2	NCA2	YPD	SGD	MIPS	1.14	1.16	1.15	0.87	2.59	1.44	1.34	0.75	undocumented	New	Protein required for control of mitochondrial synthesis of Atp6p and Atp8p 	1.347	3.038																																																
unknown	major facilitator superfamily		G2/M	659	219	YPR156C	YPR156C	YPR156C	YPD	SGD	MIPS	1.51	1.25	1.10	1.10	1.78	1.69	1.73	1.73	undocumented	New	"Member of major facilitator superfamily (MFS) multidrug-resistance proteins family 1, most similar to YGR138C"	7.421	1.919										1	c 103 gacCACGAAAttt																																					
unknown	unknown		G2/M	671	189	YPR157W	YPR157W	YPR157W	YPD	SGD	MIPS	1.44	1.14	1.12	0.89	1.01	1.56	1.24	1.24	undocumented	New	Protein of unknown function 	3.311	1.845																										1	c 600 gctACGCGgattt																					
cell wall biogenesis	glucan synthase subunit		S	442	776	YPR159W	KRE6	KRE6	YPD	SGD	MIPS	2.66	1.22	1.80	1.80	3.09	1.26	1.57	0.64	viable	Known	"Glucan synthase subunit required for synthesis of beta-1,6-glucan "	2.139	-2.579	1	w 299 gagACGCGaatgc																								1	w 299 gagACGCGaatgc																					
glycogen metabolism	glycogen phosphorylase		G1	206	335	YPR160W	GPH1	GPH1	YPD	SGD	MIPS	1.48	1.19	1.32	0.76	1.34	1.37	1.01	1.01	viable	New	"Glycogen phosphorylase, releases alpha-D-glucose-1-phosphate from glycogen "	1.539	-1.067																																		1	w 469 GCAGCCAGCACC				1	w 469 GCAGCCAGCACC								
sulfate assimilation	3'-phosphoadenylylsulfate reductase		S/G2	531	649	YPR167C	MET16	MET16	YPD	SGD	MIPS	2.73	1.07	1.71	1.71	1.44	1.15	1.29	0.78	undocumented	New	"3'-Phosphoadenylylsulfate reductase, part of the sulfate assimilation pathway "	1.788	3.047																																		1	w 38 AAGGCCAGCAAA				1	w 38 AAGGCCAGCAAA							w 588 CCCAATGTAGAAAAGTACATCATATGAAACA	
unknown	similar to C. elegans nuclear lamin		G1	222	544	YPR174C	YPR174C	YPR174C	YPD	SGD	MIPS	2.08	2.43	2.25	2.25	2.43	1.41	1.85	0.54	undocumented	New	Protein with weak similarity to C. elegans nuclear lamin and Nbp1	3.609	-1.147	3	w151 tcaCGCGAAAaat	w140 ataACGCGTcac	w 152 gtcACGCGaaaaa												1	w151 tcaCGCGAAAaat				1	w140 ataACGCGTcac				1	w 152 gtcACGCGaaaaa																					w 131 TTCAACGCGGGG
DNA replication	polymerase epsilon 80 kDa subunit		G1	205	545	YPR175W	DPB2	DPB2	YPD	SGD	MIPS	1.78	2.04	1.91	1.91	3.16	1.02	1.80	0.56	lethal	Known	DNA polymerase epsilon 80 kDa subunit	4.357	-1.066	5	c339 aaaCGCGAAAaat	w375 caaACGCGTtta	w295 gggACGCGTcga	c 282 aagACGCGatttt	c 338 caaACGCGaaaaa										1	c339 aaaCGCGAAAaat				2	w375 caaACGCGTtta	w295 gggACGCGTcga			2	c 282 aagACGCGatttt	c 338 caaACGCGaaaaa																				
unknown	similar to other subtelomerically-encoded proteins		G1	154	580	YPR202W	YPR202W	YPR202W	YPD	SGD	MIPS	1.76	2.69	2.17	2.17	1.58	1.19	1.15	0.87	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.287	-0.736																																															c 243 CCTTTTTCAGTTTCTATTTTTAACACTGAAACT	
unknown	similar to other subtelomerically-encoded proteins		G1	138	598	YPR203W	YPR203W	YPR203W	YPD	SGD	MIPS	1.42	3.00	2.07	2.07	1.46	1.47	1.00	1.00	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.364	-0.647	1	w42 tgtCACGAAAtag								1	w42 tgtCACGAAAtag																																					w 573 CAAAACCTGGGG
unknown	similar to other subtelomerically-encoded proteins		M/G1	113	597	YPR204W	YPR204W	YPR204W	YPD	SGD	MIPS	2.17	2.38	2.27	2.27	1.55	1.37	1.06	0.94	undocumented	New	Protein with similarity to other subtelomerically-encoded proteins	3.184	-0.526																1	w 125 taaCGCGAAAaag									1	w 126 gtaACGCGaaaaa																					
			G1	130	573		YEL077C	YEL077C		SGD	MIPS	2.03	1.15	1.33	1.33	1.18	1.25	1.22	0.82	undocumented	New	"Protein with similarity to subtelomerically-encoded proteins including Yil177p, Yhl049p, and Yjl225p "	4.545	-0.599																																																
