TargetID	ProbeID	1632405013_R006_C012.AVG_Beta	1632405013_R006_C012.Signal CY3	1632405013_R006_C012.Signal CY5	1632405013_R006_C012.Detection Pval	1632405013_R006_C012.Avg_NBEADS	1632405013_R006_C012.BEAD_STDERR	1632405013_R007_C001.AVG_Beta	1632405013_R007_C001.Signal CY3	1632405013_R007_C001.Signal CY5	1632405013_R007_C001.Detection Pval	1632405013_R007_C001.Avg_NBEADS	1632405013_R007_C001.BEAD_STDERR	1632405013_R007_C002.AVG_Beta	1632405013_R007_C002.Signal CY3	1632405013_R007_C002.Signal CY5	1632405013_R007_C002.Detection Pval	1632405013_R007_C002.Avg_NBEADS	1632405013_R007_C002.BEAD_STDERR	1632405013_R007_C003.AVG_Beta	1632405013_R007_C003.Signal CY3	1632405013_R007_C003.Signal CY5	1632405013_R007_C003.Detection Pval	1632405013_R007_C003.Avg_NBEADS	1632405013_R007_C003.BEAD_STDERR	1632405013_R007_C008.AVG_Beta	1632405013_R007_C008.Signal CY3	1632405013_R007_C008.Signal CY5	1632405013_R007_C008.Detection Pval	1632405013_R007_C008.Avg_NBEADS	1632405013_R007_C008.BEAD_STDERR	1632405013_R007_C009.AVG_Beta	1632405013_R007_C009.Signal CY3	1632405013_R007_C009.Signal CY5	1632405013_R007_C009.Detection Pval	1632405013_R007_C009.Avg_NBEADS	1632405013_R007_C009.BEAD_STDERR	1632405013_R007_C010.AVG_Beta	1632405013_R007_C010.Signal CY3	1632405013_R007_C010.Signal CY5	1632405013_R007_C010.Detection Pval	1632405013_R007_C010.Avg_NBEADS	1632405013_R007_C010.BEAD_STDERR	1632405013_R007_C011.AVG_Beta	1632405013_R007_C011.Signal CY3	1632405013_R007_C011.Signal CY5	1632405013_R007_C011.Detection Pval	1632405013_R007_C011.Avg_NBEADS	1632405013_R007_C011.BEAD_STDERR	1632405013_R007_C012.AVG_Beta	1632405013_R007_C012.Signal CY3	1632405013_R007_C012.Signal CY5	1632405013_R007_C012.Detection Pval	1632405013_R007_C012.Avg_NBEADS	1632405013_R007_C012.BEAD_STDERR	1632405013_R008_C001.AVG_Beta	1632405013_R008_C001.Signal CY3	1632405013_R008_C001.Signal CY5	1632405013_R008_C001.Detection Pval	1632405013_R008_C001.Avg_NBEADS	1632405013_R008_C001.BEAD_STDERR	SEARCH_KEY	PROBE_ID	GID	ACCESSION	SYMBOL	GENE_ID	CHROMOSOME	REFSEQ	CPG_COORDINATE	DIST_TO_TSS	CPG_ISLAND	INPUT_SEQUENCE	SYNONYM	ANNOTATION	PRODUCT
AATK_E63_R	2976	0.6471396	1565.675	3054.818	0.003259504	25	150.3024	0.9334571	1174.235	17874.86	3.453864E-37	26	1072.609	0.9519143	1181.764	25374.05	3.678E-38	29	1389.735	0.6346983	535.5005	1104.159	0.5190871	26	73.50702	0.9286466	1293.295	18133.38	3.678E-38	29	1030.149	0.9256327	1292.284	17329.43	3.678E-38	37	1057.103	0.9480707	1082.28	21584.83	3.678E-38	25	1292.325	0.94101	1380.849	23622.54	3.678E-38	27	924.4706	0.9089342	1092.156	11898.99	2.487839E-18	33	672.6069	0.9353248	1189.097	18642.78	3.678E-38	30	724.1157	AATK	AATK_E63_R	89041906	XM_927215.1	AATK	9625	17	36.1	76709831	63	N	GGGCAGAAGCCAGCTTGATGGCAGACACCTCGCCACCAGTAGCAGGCGTGGGAGAGTC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	apoptosis-associated tyrosine kinase
AATK_P519_R	3	0.2261689	6827.32	2024.659	4.105647E-11	34	342.6199	0.959187	741.0735	19766.88	3.678E-38	36	1335.881	0.9683374	765.6169	26473.12	3.678E-38	30	1730.598	0.2967239	5158.4	2218.607	0.0001016097	24	298.9232	0.9422528	815.2721	14934.37	4.522298E-27	29	740.5596	0.9394666	1011.326	17247.56	3.678E-38	31	957.4497	0.9415608	1060.887	18703.98	2.688047E-34	41	1285.918	0.9553203	1142.659	26569.93	3.678E-38	29	1134.836	0.9292322	914.9717	13327.32	3.046555E-22	20	1106.471	0.9336873	882.3101	13831	3.183533E-23	22	654.8022	AATK	AATK_P519_R	89041906	XM_927215.1	AATK	9625	17	36.1	76710413	-519	Y	GGGGACGTGCCCAGTGGGTCCTCGAAGAAGGCAGGACAGAAGGCGG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	apoptosis-associated tyrosine kinase
AATK_P709_R	10	0.02373276	8443.151	207.6814	1.331754E-10	34	388.9555	0.8872375	716.3707	6423.365	3.790087E-05	26	283.4205	0.9113896	648.7682	7701.347	2.247416E-07	33	251.2722	0.03575671	5595.916	211.2197	0.003621846	31	207.3747	0.8595164	753.489	5221.874	0.0006161311	28	155.5173	0.8007707	986.4294	4366.732	0.00137289	31	196.6054	0.843747	882.235	5303.95	0.002113667	30	304.909	0.831225	1092.751	5874.356	0.00347597	30	157.7471	0.8280569	795.5894	4313.05	0.005922547	24	397.1025	0.796769	709.6235	3174.135	0.05438877	27	134.4331	AATK	AATK_P709_R	89041906	XM_927215.1	AATK	9625	17	36.1	76710603	-709	Y	ACGGGTGGCCCGTGGCCCAGCAGCGGCTCCATGGCCAGCGAGGCGG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	apoptosis-associated tyrosine kinase
ABCA1_E120_R	5366	0.05193593	2609.942	148.4534	0.1449373	41	79.98244	0.04015642	8681.396	367.3822	4.232913E-08	33	302.6514	0.03174281	10856.38	359.1879	1.747785E-13	20	572.4532	0.1771145	2598.868	580.8932	0.1679659	17	105.3202	0.03418034	8977.574	321.2552	3.852678E-09	22	413.6518	0.03116324	10211.08	331.6624	1.666926E-13	27	386.4176	0.03125376	10359.53	337.446	1.352111E-09	24	794.2106	0.0267799	11406.23	316.6146	3.363894E-08	25	400.6451	0.04008691	8078.477	341.5411	1.741773E-07	35	411.537	0.03128767	11267.03	367.1346	2.935745E-14	33	714.7705	ABCA1	ABCA1_E120_R	21536375	NM_005502.2	ABCA1	19	9	36.1	106730137	120	Y	ACCGGGGAAAAAACAAGGAGCAAAGCGCCCTGAGAACCGGCTCTGTTG	TGD, ABC1, CERP, ABC-1, HDLDT1	cholesterol efflux regulatory protein; ATP-binding cassette 1; high density lipoprotein deficiency, Tangier type, 1; membrane-bound; ATP binding cassette transporter 1; ATP-binding cassette transporter-1; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: anion transporter activity; go_function: sterol transporter activity; go_process: transport; go_process: lipid metabolism; go_process: steroid metabolism; go_process: cholesterol metabolism	ATP-binding cassette, sub-family A member 1
ABCA1_P45_F	4214	0.06637983	3098.816	227.4339	0.05876184	28	110.7935	0.06439999	7525.214	524.865	1.875367E-06	28	414.0118	0.07551257	8601.354	710.7307	3.428377E-09	24	473.9919	0.07151056	2362.37	189.6473	0.2909814	23	107.3396	0.05810342	7224.368	451.8233	2.907079E-06	34	305.7484	0.07039636	7323.875	562.1899	1.822863E-07	26	374.7556	0.06188658	8244.174	550.4584	1.68855E-06	29	393.9166	0.07742	8327.98	707.2495	5.375101E-05	27	560.4176	0.0943924	6829.147	722.2321	4.960544E-06	33	332.2126	0.04572527	9588.271	464.2256	1.435501E-10	34	377.8167	ABCA1	ABCA1_P45_F	21536375	NM_005502.2	ABCA1	19	9	36.1	106730302	-45	Y	AGTTCCTTTTATAGATTCGGCTGCACCGAGCGCAGAGGTTACTATCGGTCAAAGCCT	TGD, ABC1, CERP, ABC-1, HDLDT1	cholesterol efflux regulatory protein; ATP-binding cassette 1; high density lipoprotein deficiency, Tangier type, 1; membrane-bound; ATP binding cassette transporter 1; ATP-binding cassette transporter-1; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: anion transporter activity; go_function: sterol transporter activity; go_process: transport; go_process: lipid metabolism; go_process: steroid metabolism; go_process: cholesterol metabolism	ATP-binding cassette, sub-family A member 1
ABCB4_E429_F	2983	0.7053176	1368.167	3514.034	0.001568149	35	179.2961	0.9458683	791.7153	15581.35	3.841202E-27	31	1138.682	0.9612931	736.4714	20773.93	3.678E-38	31	1466.608	0.7809175	577.471	2414.839	0.2006529	30	104.6022	0.9549245	751.2097	18032.89	3.678E-38	32	1120.155	0.9334429	942.6276	14622.53	1.531625E-30	36	1094.704	0.9645818	678.1749	21192.87	3.678E-38	26	1006.56	0.9615314	751.4149	21281.29	1.175156E-29	18	1382.049	0.9363545	611.9916	10474.83	3.711561E-13	21	1108.502	0.9612022	754.291	21164.76	3.678E-38	27	1042.068	ABCB4	ABCB4_E429_F	9961251	NM_018850.1	ABCB4	5244	7	36.1	86947255	429	N	TTCCTTGGACTTCTCAGTCTATTCTCGCCACTTCTGTCATGTCAGTCAGTCACAC	MDR3, PGY3, ABC21, MDR2/3, PFIC-3	isoform C is encoded by transcript variant C; multiple drug resistance 3; P-glycoprotein-3/multiple drug resistance-3; P glycoprotein 3/multiple drug resistance 3; multidrug resistance protein 3; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: ATPase activity, coupled to transmembrane movement of substances; go_process: transport; go_process: lipid metabolism; go_process: response to drug; go_process: response to xenobiotic stimulus	ATP-binding cassette, subfamily B, member 4 isoform C
ABCB4_P51_F	23	0.6299564	1557.341	2821.431	0.006127513	35	125.2113	0.9255807	1003.112	13719.81	8.966686E-22	30	1272.913	0.9449996	1043.79	19652.24	3.678E-38	21	1070.72	0.2781624	585.3594	264.1055	0.7143447	38	33.01179	0.9356047	983.8918	15747.95	1.017336E-30	24	1027.263	0.9193675	1339.34	16411.28	3.678E-38	26	898.1487	0.9393894	978.4312	16714.36	3.412232E-27	23	1059.428	0.9486161	1099.034	22135.81	4.084496E-33	23	680.8739	0.9101926	893.8333	10072.44	7.335863E-13	21	870.0527	0.9516689	918.793	20060.65	3.678E-38	22	570.8983	ABCB4	ABCB4_P51_F	9961251	NM_018850.1	ABCB4	5244	7	36.1	86947735	-51	N	TCTGTCCTTTCCTCCTCTTCCGCCTTTGTCCATTGTCAAAAGCATGGCCTGG	MDR3, PGY3, ABC21, MDR2/3, PFIC-3	isoform C is encoded by transcript variant C; multiple drug resistance 3; P-glycoprotein-3/multiple drug resistance-3; P glycoprotein 3/multiple drug resistance 3; multidrug resistance protein 3; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: ATPase activity, coupled to transmembrane movement of substances; go_process: transport; go_process: lipid metabolism; go_process: response to drug; go_process: response to xenobiotic stimulus	ATP-binding cassette, subfamily B, member 4 isoform C
ABCB4_P892_F	21	0.3904342	1154.292	803.3889	0.3655385	25	71.70512	0.891407	1363.882	12016.55	7.175685E-18	38	837.5191	0.9141375	1463.714	16648.12	6.888697E-37	31	739.5228	0.526852	1599.246	1892.117	0.1216856	30	100.4957	0.8773319	1239.681	9581.5	1.964731E-12	37	476.6433	0.8108553	1844.344	8335.319	1.471743E-12	30	456.4286	0.9234511	1119.974	14717.21	1.441868E-21	33	840.5057	0.4862568	2125.749	2106.666	0.1257292	34	187.5855	0.8760196	1428.124	10797.4	3.881132E-16	27	836.3634	0.9158586	1320.013	15456.5	1.484782E-30	25	632.1327	ABCB4	ABCB4_P892_F	9961251	NM_018850.1	ABCB4	5244	7	36.1	86948576	-892	N	GAATTAGGCTTCCAGCTCTGGCCACGTGACTTCAGCTTCTCATTCTGTATTCCTAT	MDR3, PGY3, ABC21, MDR2/3, PFIC-3	isoform C is encoded by transcript variant C; multiple drug resistance 3; P-glycoprotein-3/multiple drug resistance-3; P glycoprotein 3/multiple drug resistance 3; multidrug resistance protein 3; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: ATPase activity, coupled to transmembrane movement of substances; go_process: transport; go_process: lipid metabolism; go_process: response to drug; go_process: response to xenobiotic stimulus	ATP-binding cassette, subfamily B, member 4 isoform C
ABCC2_E16_R	67	0.7986791	694.8408	3153.287	0.02112379	35	173.0364	0.9466684	632.0922	12995.07	1.478047E-18	37	672.1516	0.9656261	538.8276	17945.86	3.678E-38	29	1370.527	0.4531223	3492.459	2976.577	0.0009057069	22	296.6556	0.961634	579.9113	17041.81	3.10515E-34	28	966.8904	0.9648779	478.0047	15879.02	6.661615E-34	24	1018.178	0.9636307	551.6235	17265.21	1.355729E-27	27	1320.624	0.9373363	837.9318	14029.77	3.412681E-13	30	530.8599	0.9307536	850.8422	12780.46	2.787008E-20	33	708.4025	0.9690933	543.441	20175.37	3.678E-38	19	1225.167	ABCC2	ABCC2_E16_R	4557480	NM_000392.1	ABCC2	1244	10	36.1	101532577	16	N	AATAGAAGAGTCTTCGTTCCAGACGCAGTCCAGGAATCATGCTGGAGAAGTTCT	DJS, MRP2, cMRP, ABC30, CMOAT, KIAA1010	canalicular multispecific organic anion transporter; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: transporter activity; go_function: organic anion transporter activity; go_function: ATPase activity, coupled to transmembrane movement of substances; go_process: transport	ATP-binding cassette, sub-family C (CFTR/MRP), member 2
ABCC2_P88_F	3072	0.6139634	1479.168	2511.552	0.01545039	18	112.8662	0.9613041	579.6793	16884.97	4.863883E-31	33	1086.95	0.9662861	590.994	19804.85	3.678E-38	21	1066.008	0.6965542	1073.087	2692.8	0.08904614	29	149.5509	0.9607379	499.9073	14679.63	4.582556E-25	17	861.2632	0.9533002	615.1006	14597.61	4.188227E-29	30	894.626	0.9625973	571.5303	17282.51	1.026465E-27	34	829.2595	0.9623518	628.1496	18612.73	2.134901E-22	29	846.2363	0.9464612	579.2619	12008.02	3.729889E-17	36	700.7635	0.9678798	579.4534	20473.98	3.678E-38	31	1055.516	ABCC2	ABCC2_P88_F	4557480	NM_000392.1	ABCC2	1244	10	36.1	101532473	-88	N	GTTGGGATGAAAGGTCATCCTTTACGGAGAACATCAGAATGGTAGATAATTCC	DJS, MRP2, cMRP, ABC30, CMOAT, KIAA1010	canalicular multispecific organic anion transporter; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: transporter activity; go_function: organic anion transporter activity; go_function: ATPase activity, coupled to transmembrane movement of substances; go_process: transport	ATP-binding cassette, sub-family C (CFTR/MRP), member 2
ABCC5_P444_F	27	0.03455167	5968.385	217.1766	1.916741E-05	29	165.7462	0.0615489	11949.15	790.2509	3.741919E-16	22	778.5303	0.04175226	14149.74	620.8822	5.254783E-24	30	808.2573	0.02954132	6236.654	192.8914	0.0009886246	21	318.964	0.06861602	12027.18	893.4217	6.363528E-18	31	543.2817	0.07151683	10850.39	843.4591	9.313943E-17	27	594.0787	0.05543134	12749.3	754.0522	1.780711E-15	28	855.8165	0.07181907	14160.34	1103.41	6.42914E-14	32	808.8145	0.07195977	9164.553	718.3687	2.271131E-10	29	565.7715	0.05106246	17526.02	948.4585	2.180642E-37	25	943.728	ABCC5	ABCC5_P444_F	66529004	NM_005688.2	ABCC5	10057	3	36.1	185218865	-444	Y	GCTCATGGTTCGACCCTGCAGTCTGCGCAGATACCGCCTTTCTCACTTTAACAC	MRP5, SMRP, ABC33, MOATC, MOAT-C, pABC11, EST277145	isoform 1 is encoded by transcript variant 1; canalicular multispecific organic anion transporter C; go_component: integral to membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: multidrug transporter activity; go_function: organic anion transporter activity; go_function: ATPase activity, coupled to transmembrane movement of substances; go_process: transport; go_process: transport	ATP-binding cassette, sub-family C, member 5 isoform 1
ABCG2_P178_R	3089	0.04712874	8458.115	423.2819	3.447418E-11	40	329.9531	0.0700599	14404.26	1092.723	3.257727E-24	29	1271.235	0.08078493	18203.44	1608.592	3.678E-38	33	1073.54	0.04798704	6916.624	353.679	0.0001336931	42	293.5917	0.07950496	14865.99	1292.642	1.465356E-28	35	966.6783	0.07635111	17618.52	1464.657	3.678E-38	27	1120.627	0.09232987	15109.77	1547.166	5.743399E-24	27	1463.094	0.0869365	19466.47	1863.004	1.001137E-27	37	1035.875	0.1211234	10181.47	1416.953	1.870619E-14	48	832.3375	0.05073529	20443.89	1098.008	3.678E-38	34	875.4792	ABCG2	ABCG2_P178_R	62526032	NM_004827.2	ABCG2	9429	4	36.1	89299213	-178	Y	CCGGCTGAAAGCGCACACGTGTCCTGCCGCGCTGAGCCGCCAGCAGGACTGG	MRX, MXR, ABCP, BCRP, BMDP, MXR1, ABC15, BCRP1, CDw338, EST157481, MGC102821	breast cancer resistance protein; placenta specific MDR protein; mitoxantrone resistance protein; ATP-binding cassette sub-family G (WHITE) member 2; ABC transporter; ATP-binding cassette transporter G2; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: transporter activity; go_function: transporter activity; go_function: xenobiotic-transporting ATPase activity; go_process: transport; go_process: response to drug	ATP-binding cassette, sub-family G, member 2
ABCG2_P310_R	2985	0.05140254	4264.589	236.5081	0.004475801	18	152.3603	0.05335362	7871.472	449.2775	7.064469E-07	30	561.7601	0.04951129	10967.88	576.5297	2.54957E-14	24	345.0646	0.2235902	2081.606	628.258	0.2565411	23	190.0674	0.05120341	8746.342	477.4078	5.410638E-09	41	444.2684	0.047858	8689.447	441.7885	4.835841E-10	35	486.3752	0.04501485	8341.718	397.9147	2.025082E-06	21	575.3334	0.05196555	9456.283	523.818	5.186035E-06	29	512.4238	0.06808239	6810.451	504.8515	1.142411E-05	27	571.5258	0.05674003	10830.2	657.4855	6.845621E-14	30	493.9537	ABCG2	ABCG2_P310_R	62526032	NM_004827.2	ABCG2	9429	4	36.1	89299345	-310	Y	CGAACGGAATGAACCAGAGTGATTAACTACGAGAATCACCAGGCGCTCATTGGGC	MRX, MXR, ABCP, BCRP, BMDP, MXR1, ABC15, BCRP1, CDw338, EST157481, MGC102821	breast cancer resistance protein; placenta specific MDR protein; mitoxantrone resistance protein; ATP-binding cassette sub-family G (WHITE) member 2; ABC transporter; ATP-binding cassette transporter G2; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: transporter activity; go_function: transporter activity; go_function: xenobiotic-transporting ATPase activity; go_process: transport; go_process: response to drug	ATP-binding cassette, sub-family G, member 2
ABL1_P53_F	2249	0.6385159	2207.001	4075.025	1.314779E-05	27	343.9603	0.09129152	8425.845	856.5314	1.618047E-08	20	477.5936	0.1089375	9363.226	1156.933	8.291704E-12	31	447.63	0.7735816	609.1866	2423.008	0.1933957	22	97.63921	0.1502508	8059.977	1442.829	1.506686E-09	40	257.0269	0.2429655	7464.687	2427.839	7.740554E-12	25	403.1727	0.1443557	8658.95	1477.722	1.310049E-08	25	574.3456	0.1139884	10215.85	1327.169	5.910381E-08	23	395.4901	0.1216938	7616.546	1069.167	5.724746E-08	27	640.6779	0.1179346	8502.333	1150.156	9.820332E-10	24	457.581	ABL1	ABL1_P53_F	62362413	NM_005157.3	ABL1	25	9	36.1	132579036	-53	Y	TCCGGAGAGCAAAGCAGAGAAGCGAGAGCGGCCACTAGTTCGGCAGGAAATTTG	ABL, JTK7, p150, c-ABL, v-abl	isoform a is encoded by transcript variant a; Abelson murine leukemia viral (v-abl) oncogene homolog 1; proto-oncogene tyrosine-protein kinase ABL1; bcr/c-abl oncogene protein; abl protein; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: mismatch repair; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: S-phase-specific transcription in mitotic cell cycle; go_process: DNA damage response, signal transduction resulting in induction of apoptosis	v-abl Abelson murine leukemia viral oncogene homolog 1 isoform a
ABL2_P459_R	4216	0.08007813	5337.894	473.3624	7.739927E-05	22	240.672	0.08421223	12115.94	1123.33	1.746379E-17	14	660.5483	0.09026888	11599.79	1160.922	1.178948E-17	24	603.7207	0.06254464	3533.385	242.4102	0.08800377	31	188.7499	0.09108271	10025.19	1014.647	5.929108E-13	26	601.1081	0.1203183	8962.672	1239.545	1.288816E-12	28	659.6757	0.1302755	9693.666	1466.987	1.852292E-10	37	758.4681	0.1251034	12553.54	1809.357	2.666185E-12	18	750.2264	0.1362754	6517.241	1044.044	4.786516E-06	29	552.206	0.1097666	8336.65	1040.246	3.504169E-09	30	451.312	ABL2	ABL2_P459_R	6382061	NM_007314.1	ABL2	27	1	36.1	177465818	-459	Y	GAGTGAGTCGAGGGCTCAGTGCCACCGCGTGCGCAGCTCAGGTGCAGGCACAGGT	ARG, ABLL	isoform b is encoded by transcript variant b; Abelson murine leukemia viral (v-abl) oncogene homolog 2; Abelson-related gene; go_component: cytoplasm; go_component: phosphoinositide 3-kinase complex; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: phosphatidylinositol 3-kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	v-abl Abelson murine leukemia viral oncogene homolog 2 isoform b
ABO_E110_F	2986	0.01879611	16535.4	318.6706	3.678E-38	31	872.7682	0.06862421	8567.466	638.6229	2.222005E-08	30	549.0437	0.07571674	11152.87	921.8286	9.988529E-16	22	510.6388	0.05667979	11456.6	694.3831	3.816445E-12	34	579.3932	0.06836448	9572.881	709.8071	3.340647E-11	35	332.309	0.07983005	9211.069	807.789	3.754302E-12	27	491.9624	0.0821117	10242.74	925.232	1.793694E-10	15	575.423	0.07213651	11476.33	899.9988	3.98394E-09	41	451.4009	0.06304497	9365.021	636.8737	1.251673E-10	32	573.4867	0.09028658	9000.167	903.1668	2.97187E-10	30	301.8867	ABO	ABO_E110_F	58331215	NM_020469.2	ABO	28	9	36.1	135140341	110	Y	CCGGCTGTCGGGTGCACCCCGCATTCCCTGCGGTAGCGGCTCCCTC	GTB, NAGAT, A3GALNT, A3GALT1	histo-blood group A2 transferase; histo-blood group protein; alpha-3-galactosyltransferase; A1-specific alpha 1->3 N-acetylgalactosaminyltransferase; A3-specific alpha 1->3 N-acetylgalactosaminyltransferase; Ax-specific alpha 1->3 N-acetylgalactosaminyltransferase; cis-AB-specific alpha 1->3 N-acetylgalactosaminyltransferase; B3-specific alpha 1->3 galactosyltransferase; B(A)-specific alpha 1->3 galactosyltransferase; O-specific alpha 1->3 N-acetylgalactosaminyltransferase; ABO glycosyltransferase; alpha-3-galactosylaminyltransferase; ABO blood group transferase A; alpha 1-3-N-acetylgactosaminyltransferase; ABO glycosyltransferase A3; ABO blood transferase; ABO blood group transferase B; alpha 1-3-galactosyltransferase; A transferase; B transferase; B(A) glycosyltransferase; ABO glycosyltransferase Ael; Ael glycosyltransferase; ABO blood group protein; ABO alpha 1-3 galactosyltransferase; B(A) alpha-1,3-galactosyltransferase; ABO transferase; go_component: membrane; go_component: Golgi stack; go_component: extracellular region; go_component: integral to membrane; go_component: integral to Golgi membrane; go_function: metal ion binding; go_function: transferase activity; go_function: manganese ion binding; go_function: transferase activity, transferring hexosyl groups; go_function: fucosylgalactoside 3-alpha-galactosyltransferase activity; go_function: glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity; go_function: glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity; go_process: biosynthesis; go_process: carbohydrate metabolism; go_process: protein amino acid glycosylation	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
ABO_P312_F	30	0.1798557	7417.654	1648.603	1.132168E-11	25	348.8183	0.09912299	6048.15	676.4775	0.0001296278	36	262.0507	0.06784096	7367.923	543.5028	1.264813E-06	19	299.3013	0.134904	5422.522	861.1884	0.001358852	26	296.593	0.1143399	6375.989	836.0586	1.471575E-05	29	264.2494	0.105359	6460.171	772.5705	2.719583E-06	24	487.3961	0.07576075	5989.733	499.1811	0.001077675	19	377.457	0.08241887	8546.479	776.6431	2.713874E-05	32	330.5626	0.0964773	5676.472	616.8062	0.0002916683	33	237.944	0.09746452	5376.106	591.363	0.0007061143	20	173.0174	ABO	ABO_P312_F	58331215	NM_020469.2	ABO	28	9	36.1	135140763	-312	Y	CTTGACACCCTGTCTCCCGGGCGGGGGCGACCCCCTGACATCCTGCT	GTB, NAGAT, A3GALNT, A3GALT1	histo-blood group A2 transferase; histo-blood group protein; alpha-3-galactosyltransferase; A1-specific alpha 1->3 N-acetylgalactosaminyltransferase; A3-specific alpha 1->3 N-acetylgalactosaminyltransferase; Ax-specific alpha 1->3 N-acetylgalactosaminyltransferase; cis-AB-specific alpha 1->3 N-acetylgalactosaminyltransferase; B3-specific alpha 1->3 galactosyltransferase; B(A)-specific alpha 1->3 galactosyltransferase; O-specific alpha 1->3 N-acetylgalactosaminyltransferase; ABO glycosyltransferase; alpha-3-galactosylaminyltransferase; ABO blood group transferase A; alpha 1-3-N-acetylgactosaminyltransferase; ABO glycosyltransferase A3; ABO blood transferase; ABO blood group transferase B; alpha 1-3-galactosyltransferase; A transferase; B transferase; B(A) glycosyltransferase; ABO glycosyltransferase Ael; Ael glycosyltransferase; ABO blood group protein; ABO alpha 1-3 galactosyltransferase; B(A) alpha-1,3-galactosyltransferase; ABO transferase; go_component: membrane; go_component: Golgi stack; go_component: extracellular region; go_component: integral to membrane; go_component: integral to Golgi membrane; go_function: metal ion binding; go_function: transferase activity; go_function: manganese ion binding; go_function: transferase activity, transferring hexosyl groups; go_function: fucosylgalactoside 3-alpha-galactosyltransferase activity; go_function: glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity; go_function: glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity; go_process: biosynthesis; go_process: carbohydrate metabolism; go_process: protein amino acid glycosylation	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
ACTG2_E98_R	2988	0.3840137	504.651	376.9471	0.731316	37	33.60377	0.9359139	568.7991	9767.154	1.483307E-10	28	534.9871	0.9510915	516.9675	11997.76	5.981923E-17	29	404.7334	0.4907494	483.6162	562.4135	0.6690177	33	44.33934	0.9367455	478.9286	8573.434	1.160623E-08	25	683.0687	0.9194708	685.1373	8964.589	3.017996E-11	25	414.8104	0.9368282	531.5205	9365.353	3.314403E-08	24	622.3268	0.9440455	560.6418	11146.12	3.539224E-08	40	366.5453	0.8818343	525.9402	4671.201	0.004859814	31	424.2734	0.9500028	478.7249	10996.42	7.356157E-14	30	353.1213	ACTG2	ACTG2_E98_R	63054873	NM_001615.3	ACTG2	72	2	36.1	73973699	98	N	CCTCTCATACCCTCGGTAAGTACTGTACGGCTTTTGCCACCTCTTCCTTTCC	ACT, ACTE, ACTA3, ACTL3, ACTSG	smooth muscle gamma actin; alpha-actin 3; actin-like protein; go_function: protein binding	actin, gamma 2 propeptide
ACTG2_P346_F	33	0.5566555	1903.189	2515.168	0.005541901	35	194.7092	0.9277787	1086.591	15243.34	5.40513E-27	26	1242.099	0.936031	1244.043	19666.8	3.678E-38	23	1231.878	0.4918521	790.8939	862.3238	0.5155429	39	72.47231	0.9326133	1001.299	15241.69	7.137099E-29	41	700.392	0.8904745	1530.397	13255.61	2.055035E-27	22	1098.903	0.9158379	1277.431	14988.99	8.30334E-23	25	1035.293	0.907732	1572.432	16453.38	1.417578E-19	25	986.9011	0.8785653	1382.028	10722.29	8.360154E-16	27	664.136	0.9393054	1047.164	17753.41	3.678E-38	30	878.7485	ACTG2	ACTG2_P346_F	63054873	NM_001615.3	ACTG2	72	2	36.1	73973255	-346	N	GGGCGTCCCAGGCAGACCCAGGGGCCGCATGCAGCAGGGCCTGAGGAGG	ACT, ACTE, ACTA3, ACTL3, ACTSG	smooth muscle gamma actin; alpha-actin 3; actin-like protein; go_function: protein binding	actin, gamma 2 propeptide
ACTG2_P455_R	36	0.53729	961.013	1232.028	0.2898675	21	85.19739	0.971472	337.8153	14909.03	2.07231E-23	34	934.2847	0.9774403	352.172	19591.16	3.678E-38	33	1030.756	0.8876225	281.7043	3014.922	0.1494299	29	152.2143	0.972308	294.1462	13839.07	1.346305E-21	25	890.0847	0.9666539	327.7059	12398.54	5.280815E-20	29	823.6255	0.9687808	340.5089	13669.7	1.048659E-16	31	989.9048	0.9768378	344.5509	18748.38	4.829924E-22	21	786.8496	0.9478264	374.4332	8618.936	1.498581E-08	34	623.0159	0.9733172	307.9142	14879.63	8.167032E-25	31	591.4224	ACTG2	ACTG2_P455_R	63054873	NM_001615.3	ACTG2	72	2	36.1	73973146	-455	N	GCACGCAGGATTTCTTTCCTGGGTACGGAAGGCATTTCTCTTCAGCTTTCATTGG	ACT, ACTE, ACTA3, ACTL3, ACTSG	smooth muscle gamma actin; alpha-actin 3; actin-like protein; go_function: protein binding	actin, gamma 2 propeptide
ACVR1_E328_R	5829	0.7944822	661.9554	2945.535	0.03466339	21	112.4035	0.9350681	796.6943	12913.07	8.646332E-19	39	545.7635	0.9305663	1011.673	14898.88	4.48921E-28	28	663.6616	0.577879	295.2182	541.0493	0.7172793	25	23.10892	0.923119	959.2567	12718.62	3.566928E-20	23	946.0274	0.9351068	933.4443	14891.87	1.262135E-31	22	771.9781	0.8981746	1348.435	12776.26	5.440997E-17	37	705.3798	0.9251053	1243.018	16589.07	3.824789E-19	26	697.8964	0.9272097	704.4027	10246.57	7.993617E-13	42	607.3412	0.9397072	938.8214	16190.77	6.460789E-32	28	1053.843	ACVR1	ACVR1_E328_R	10862690	NM_001105.2	ACVR1	90	2	36.1	158402708	328	N	GCACGAAGCGTTGCCAGTCTGGGACCGGCTTCCAGTGAGGACAGCATTGTTT	ALK2, SKR1, ACTRI, ACVRLK2	hydroxyalkyl-protein kinase; activin A receptor, type II-like kinase 2; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	activin A type I receptor precursor
ACVR1_P983_F	5799	0.7664424	838.5004	3079.781	0.01814376	31	134.2846	0.9630045	647.5121	19457.96	3.678E-38	34	1292.405	0.9652503	736.2924	23229.91	3.678E-38	22	1443.168	0.8438286	481.3253	3141.03	0.1051912	30	134.4288	0.9542006	690.0463	16460.11	2.398138E-32	26	1102.093	0.9551758	684.3091	16713.14	3.678E-38	29	812.179	0.9433028	951.3547	17491.98	1.1486E-29	27	1177.721	0.9577249	768.1327	19667.2	2.269096E-25	26	1888.091	0.9117422	900.6031	10336.67	1.566739E-13	29	688.2592	0.9660954	626.3937	20698.27	3.678E-38	29	1362.356	ACVR1	ACVR1_P983_F	10862690	NM_001105.2	ACVR1	90	2	36.1	158404019	-983	N	GTAAGCACTGGCCTCTCTCGGGTCTCGCCTTTCTATTGTCCCACCCTGCAGGG	ALK2, SKR1, ACTRI, ACVRLK2	hydroxyalkyl-protein kinase; activin A receptor, type II-like kinase 2; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	activin A type I receptor precursor
ACVR1B_E497_R	5834	0.5335257	3052.848	3606.041	2.816693E-06	26	312.6579	0.04856194	7041.368	364.4995	1.644855E-05	28	465.7269	0.04101558	8372.332	362.36	4.50528E-08	24	325.5518	0.145128	4429.5	768.9536	0.01112066	24	277.1288	0.04192064	7463.572	330.9431	1.885775E-06	25	408.034	0.1116019	7038.216	896.7138	1.472506E-07	33	407.0828	0.04232525	6506.667	291.9872	0.000519019	26	621.0285	0.03771224	9284.039	367.7623	1.20566E-05	23	385.6922	0.1506051	4369.876	792.5477	0.005254562	29	266.0541	0.03347134	9504.153	332.5963	4.095714E-10	27	440.8551	ACVR1B	ACVR1B_E497_R	33598913	NM_004302.3	ACVR1B	91	12	36.1	50632250	497	Y	CCTTCACCGTGTCCAGGGGCGGGGGGCTTTCTTCCCTCCCTCC	ALK4, SKR2, ACTRIB, ACVRLK4	isoform a precursor is encoded by transcript variant 1; serine(threonine) protein kinase receptor R2; activin receptor-like kinase 4; activin A receptor, type II-like kinase 4; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	activin A type IB receptor isoform a precursor
ACVR1B_P572_R	5801	0.04997215	6654.959	355.3157	6.071949E-07	31	297.2623	0.1604658	9682.857	1869.863	3.181498E-13	22	810.3029	0.1422406	11070.62	1852.402	3.958585E-18	22	1261.202	0.02890454	6931.747	209.2991	0.0001852584	27	322.5271	0.203436	9542.235	2462.549	2.158323E-15	28	730.6509	0.2407886	8975.461	2878.339	3.065974E-17	29	1169.495	0.1683598	10969.2	2240.882	8.684752E-15	25	761.0124	0.1990716	13620.87	3410.338	2.040366E-17	31	882.0079	0.1993053	7982.03	2011.743	1.303974E-10	34	478.1442	0.2112247	13361.73	3604.891	2.770471E-31	32	800.4471	ACVR1B	ACVR1B_P572_R	33598913	NM_004302.3	ACVR1B	91	12	36.1	50631181	-572	Y	CCCAATCAGAGTGCCTCACACGGCACCCTCACCCATACTGTCATC	ALK4, SKR2, ACTRIB, ACVRLK4	isoform a precursor is encoded by transcript variant 1; serine(threonine) protein kinase receptor R2; activin receptor-like kinase 4; activin A receptor, type II-like kinase 4; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	activin A type IB receptor isoform a precursor
ACVR1C_P115_R	5815	0.02723022	7249.04	205.7177	7.608474E-08	22	349.1219	0.04265894	11170.19	502.1976	1.666748E-13	27	681.2949	0.04468872	15831.31	745.2542	1.314197E-30	32	718.58	0.1597577	732.0426	158.1987	0.7051871	35	29.39884	0.04602708	11562.65	562.6968	1.030452E-15	26	1133.862	0.03608997	15184.69	572.2773	2.442563E-31	18	930.6101	0.04588833	11824.24	573.5004	5.688478E-13	24	617.394	0.05722425	14706.66	898.7288	1.463809E-14	28	749.4897	0.0676904	8679.444	637.4322	3.447363E-09	31	694.3109	0.04615493	15458.38	752.8436	1.933181E-28	30	590.1182	ACVR1C	ACVR1C_P115_R	21687097	NM_145259.1	ACVR1C	130399	2	36.1	158193760	-115	Y	AGGCAGGCAAAGGCGGCCCTGTGCCCGGCAGTGAGATCGCCCAGAGCTGG	ALK7, ACVRLK7	activin receptor-like kinase 7; go_component: membrane; go_component: integral to membrane; go_component: activin receptor complex; go_function: ATP binding; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: protein-tyrosine kinase activity; go_function: activin receptor activity, type I; go_function: protein serine/threonine kinase activity; go_function: transforming growth factor beta receptor activity; go_process: cell differentiation; go_process: regulation of apoptosis; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	activin A receptor, type IC
ACVR1C_P363_F	5816	0.07436972	2253.793	189.1154	0.2186387	24	119.5358	0.1478491	4888.66	865.538	0.001633783	27	420.1533	0.1750252	6022.365	1298.91	1.083262E-05	16	328.442	0.265399	290.77	141.1786	0.7995335	34	16.02421	0.1411518	5158.208	864.1869	0.0005428859	26	305.9789	0.1761727	5364.89	1168.648	3.598332E-05	32	485.1841	0.2125792	5093.026	1401.956	0.00106279	20	288.3957	0.1503361	6373.063	1145.318	0.001297438	30	246.9638	0.1600939	4885.078	950.2023	0.001026021	25	254.7241	0.2240551	6534.415	1915.696	1.843855E-07	31	309.1177	ACVR1C	ACVR1C_P363_F	21687097	NM_145259.1	ACVR1C	130399	2	36.1	158194008	-363	Y	GGTCCTTAAGTCCAACCAGGTTGCGCTGTGAGAGCCCCGCGGGCTTCCTAC	ALK7, ACVRLK7	activin receptor-like kinase 7; go_component: membrane; go_component: integral to membrane; go_component: activin receptor complex; go_function: ATP binding; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: protein-tyrosine kinase activity; go_function: activin receptor activity, type I; go_function: protein serine/threonine kinase activity; go_function: transforming growth factor beta receptor activity; go_process: cell differentiation; go_process: regulation of apoptosis; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	activin A receptor, type IC
ACVR2B_E27_R	5842	0.07420915	2132.627	178.962	0.2547599	21	99.87183	0.02404133	9528.344	237.1803	2.022435E-09	21	472.6551	0.02610952	11281.66	305.1367	1.980013E-14	28	846.912	0.1296307	842.8353	140.4237	0.6838071	31	33.72108	0.01997169	9702.241	199.7569	2.239688E-10	22	548.158	0.03416712	9023.867	322.7642	1.56111E-10	25	516.9886	0.0295845	9241.294	284.7827	1.322452E-07	23	876.725	0.03161208	12941.36	425.7224	1.21509E-10	30	439.6142	0.04504185	7182.125	343.471	5.442285E-06	25	458.1217	0.04328432	8702.712	398.2578	1.19955E-08	34	323.6315	ACVR2B	ACVR2B_E27_R	10862697	NM_001106.2	ACVR2B	93	3	36.1	38470841	27	Y	TGACGGCGCCCTGGGTGGCCCTCGCCCTCCTCTGGGGATCGCTGTGCGCCG	ActR-IIB, MGC116908	activin A type IIB receptor; go_component: membrane; go_component: cell surface; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	activin A type IIB receptor precursor
ACVR2B_P676_F	5823	0.1290926	2503.339	385.8871	0.1199626	27	129.7498	0.2059587	7048.734	1854.241	7.604165E-08	25	503.8976	0.2138206	8314.244	2288.458	5.323509E-12	22	514.6514	0.1412996	1794.205	311.6923	0.3982321	35	61.94083	0.273988	6204.993	2379.427	8.563735E-08	28	419.3296	0.2420336	5501.32	1788.612	2.170809E-06	26	568.1373	0.2338479	7328.057	2267.22	1.026318E-07	35	313.869	0.2830818	7586.581	3035.118	9.057454E-07	31	380.5432	0.2578382	5468.286	1934.506	8.417754E-06	40	237.6041	0.2751037	6431.217	2478.647	2.742928E-08	38	333.2348	ACVR2B	ACVR2B_P676_F	10862697	NM_001106.2	ACVR2B	93	3	36.1	38470138	-676	Y	CTAATTGCGAGTGCAGTGGCCACAGGCTCCCGGGCAAAGTGGTCAGGAGCCC	ActR-IIB, MGC116908	activin A type IIB receptor; go_component: membrane; go_component: cell surface; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	activin A type IIB receptor precursor
ADAMTS12_E52_R	2989	0.04188695	5110.925	227.8121	0.0003875689	31	225.7434	0.1130775	13053.73	1677.024	8.484495E-22	36	971.9405	0.1009589	17308.9	1954.953	3.678E-38	23	775.3176	0.03563585	3909.624	148.1664	0.06201192	28	220.7477	0.1040701	15045.87	1759.325	5.311725E-31	21	561.3995	0.182963	12852.72	2900.564	2.530723E-31	27	1117.898	0.09829587	15557.13	1706.802	7.851822E-26	35	731.8865	0.1038058	16423.71	1913.935	2.797419E-20	28	638.8342	0.14429	7649.311	1306.69	1.768769E-08	36	559.3081	0.07193792	18616.54	1450.797	3.678E-38	29	583.3234	ADAMTS12	ADAMTS12_E52_R	51558723	NM_030955.2	ADAMTS12	81792	5	36.1	33927829	52	Y	AGATGCAGGGGTGCATGGTCAGGCGCGAGAAGGCAGCGACTGCAAAGCTGCC	.	a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12; go_component: extracellular matrix (sensu Metazoa); go_function: zinc ion binding; go_function: metal ion binding; go_function: metalloendopeptidase activity; go_process: proteolysis	ADAM metallopeptidase with thrombospondin type 1 motif, 12 preproprotein
ADAMTS12_P250_R	40	0.03998479	4555.745	193.9125	0.002285903	27	215.1456	0.02748131	9668.378	276.0336	9.078777E-10	34	468.311	0.03280955	11458.48	392.0927	4.008918E-15	30	572.2603	0.03612923	5550.421	211.7975	0.003954033	27	232.7363	0.03374644	10357.1	365.2145	3.346929E-12	35	532.6469	0.04061919	11566.79	493.9598	7.097483E-18	33	583.675	0.03843076	10605.58	427.8669	3.226994E-10	24	349.0322	0.03232642	13288.29	447.2537	3.066832E-11	28	448.3299	0.04572533	8303.685	402.6736	5.241461E-08	25	363.3164	0.02585569	12473.26	333.7189	2.145369E-17	27	651.2352	ADAMTS12	ADAMTS12_P250_R	51558723	NM_030955.2	ADAMTS12	81792	5	36.1	33928131	-250	Y	CGAACGCCAGGCCCAGCTGGCCGAGCCGGCCAAATAGGGGAGACCCGG	.	a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12; go_component: extracellular matrix (sensu Metazoa); go_function: zinc ion binding; go_function: metal ion binding; go_function: metalloendopeptidase activity; go_process: proteolysis	ADAM metallopeptidase with thrombospondin type 1 motif, 12 preproprotein
ADCYAP1_E163_R	2990	0.07711767	4007.093	343.1959	0.006582202	31	184.0509	0.07110507	8197.368	635.1471	1.005249E-07	22	417.9682	0.06045856	11737.36	761.7224	6.624667E-17	18	793.3167	0.05059505	3491.4	191.3905	0.09815221	27	178.8488	0.07005927	9817.485	747.157	7.736454E-12	30	455.998	0.09742085	9877.104	1076.889	1.271045E-14	37	434.0537	0.1004881	8497.956	960.5121	1.690577E-07	34	486.6057	0.06752426	10882.88	795.3137	3.872834E-08	24	603.0059	0.09237553	8163.557	841.0422	1.425524E-08	26	533.4454	0.09053205	12339.44	1238.272	1.213738E-19	23	774.1832	ADCYAP1	ADCYAP1_E163_R	10947062	NM_001117.2	ADCYAP1	116	18	36.1	895550	163	Y	GCTGGGGCTTCCCAGGCACAGACGCTTCCTCACGGTCTCCTTCCTGCA	PACAP, MGC126852	go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_function: neuropeptide hormone activity; go_process: pregnancy; go_process: cell-cell signaling; go_process: adenylate cyclase activation	adenylate cyclase activating polypeptide precursor
ADCYAP1_P398_F	42	0.09364945	3149.088	335.7148	0.04393197	29	99.94734	0.1224751	6812.484	964.7675	4.828538E-06	26	253.0626	0.1202873	7678.883	1063.644	4.356239E-08	37	327.3281	0.04568195	3756.797	184.6198	0.07190129	32	142.5897	0.116771	6653.027	892.8123	4.640556E-06	18	333.7648	0.1723002	5926.865	1254.597	3.322583E-06	28	398.1633	0.1007243	6457.453	734.474	0.0001931611	30	365.348	0.1241405	7675.256	1102.03	9.703896E-05	32	410.3596	0.124187	5622.667	811.4531	0.0001934073	22	347.4363	0.09307376	7223.956	751.6246	1.163388E-06	35	329.5106	ADCYAP1	ADCYAP1_P398_F	10947062	NM_001117.2	ADCYAP1	116	18	36.1	894989	-398	Y	TGCCTCTCGGGTGGTGACTCCAGCGCAGGAACTTGAAGAAGCGCTTTG	PACAP, MGC126852	go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_function: neuropeptide hormone activity; go_process: pregnancy; go_process: cell-cell signaling; go_process: adenylate cyclase activation	adenylate cyclase activating polypeptide precursor
ADCYAP1_P455_R	41	0.1299952	4947.251	754.1548	0.0001142599	26	174.9095	0.0822119	9595.736	868.5065	8.050643E-11	26	461.6115	0.05880891	12202.32	768.6921	2.85803E-18	36	651.0767	0.5803491	2597.168	3730.003	0.001237062	35	335.7652	0.06972079	9844.787	745.3229	6.763693E-12	29	426.2935	0.1067328	9268.35	1119.385	4.270114E-13	40	573.0444	0.06423317	9950.749	689.9064	1.709851E-09	38	794.0011	0.08769176	12577.48	1218.569	2.436331E-11	33	570.5028	0.08297383	7509.731	688.5392	4.270951E-07	23	692.3855	0.05059533	12959.39	695.9562	7.072309E-20	40	534.9578	ADCYAP1	ADCYAP1_P455_R	10947062	NM_001117.2	ADCYAP1	116	18	36.1	894932	-455	Y	TCCTGCTGCTCCCGCTGGTTCCTGCGGCTTCTGCTCAGACACCAACGCCA	PACAP, MGC126852	go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_function: neuropeptide hormone activity; go_process: pregnancy; go_process: cell-cell signaling; go_process: adenylate cyclase activation	adenylate cyclase activating polypeptide precursor
AFF3_P122_F	5475	0.1390233	4921.509	810.8314	0.0001024847	29	198.4235	0.2283325	8063.44	2415.521	7.501396E-11	38	428.1068	0.2245441	9828.229	2874.857	1.73041E-17	23	450.7097	0.1951545	4522.629	1120.87	0.004967152	24	262.6059	0.2522269	7091.934	2425.868	1.404881E-09	36	339.9109	0.2699241	6345.429	2383.007	3.687672E-09	20	589.7837	0.2619741	7800.462	2804.395	1.983503E-09	34	520.9373	0.2582607	8769.144	3088.082	2.19307E-08	32	410.3058	0.211785	6491.636	1771.103	3.300396E-07	22	393.2979	0.2447257	9294.775	3044.116	4.209324E-16	25	434.3361	AFF3	AFF3_P122_F	68348715	NM_001025108.1	AFF3	3899	2	36.1	100125591	-122	N	GTGACTAAACCAGATACCCAACCGGCCAACTCTCACTTGTGGCAGGGCCT	LAF4, MLLT2-like	isoform 2 is encoded by transcript variant 2; MLLT2-related protein; lymphoid nuclear protein 4; lymphoid nuclear protein related to AF4; go_component: nucleus; go_function: DNA binding; go_function: catalytic activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	AF4/FMR2 family, member 3 isoform 2
AFF3_P808_F	5371	0.8243758	581.9361	3200.992	0.02425479	16	199.5649	0.9705697	429.0586	17447.61	1.39351E-32	32	1243.44	0.9801009	419.7183	25598	3.678E-38	27	1483.303	0.813032	417.0983	2248.606	0.2659582	35	82.42139	0.9741526	389.2401	18438.76	3.678E-38	20	1184.122	0.9728684	460.6893	20104.87	3.678E-38	32	1543.486	0.9728553	430.8847	19026.71	3.448739E-33	36	1433.736	0.9799223	424.8656	25616.81	3.678E-38	23	1237.895	0.9559101	465.2259	12254.62	1.550281E-17	26	732.3163	0.9804757	418.7483	26050.69	3.678E-38	28	1170.943	AFF3	AFF3_P808_F	68348715	NM_001025108.1	AFF3	3899	2	36.1	100126277	-808	N	CCATACTCTCCTGGTTTTTGTCAGGCGGTCTCTCACACTGGCAGGCTTCCATT	LAF4, MLLT2-like	isoform 2 is encoded by transcript variant 2; MLLT2-related protein; lymphoid nuclear protein 4; lymphoid nuclear protein related to AF4; go_component: nucleus; go_function: DNA binding; go_function: catalytic activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	AF4/FMR2 family, member 3 isoform 2
AFP_P824_F	5798	0.8227965	425.6642	2440.779	0.1240784	23	145.4068	0.9508203	508.4278	11763.09	5.844989E-15	44	741.9064	0.9552292	559.6671	14074.66	1.528924E-23	29	619.0822	0.774894	599.4485	2407.748	0.1979253	26	129.6813	0.9479402	484.2874	10639.09	3.724318E-13	28	526.7095	0.9470071	605.2172	12602.54	1.264503E-21	25	631.2268	0.9580986	502.0875	13767.07	2.356903E-17	27	727.3903	0.9588771	621.2726	16818.17	2.756928E-18	26	548.7295	0.9276662	731.3152	10661.45	6.334975E-14	21	622.3151	0.9583224	537.5146	14658.82	7.621497E-25	22	792.9931	AFP	AFP_P824_F	4501988	NM_001134.1	AFP	174	4	36.1	74519973	-824	N	CCCCCAGTGATTCTAATGTGTAGCCAAGATCGGGAACCCTTGTAGACAGGGAT	FETA, HPAFP	alpha-fetoglobulin; alpha-1-fetoprotein; go_component: extracellular space; go_function: carrier activity; go_function: metal ion binding; go_function: copper ion binding; go_function: nickel ion binding; go_process: transport; go_process: immune response	alpha-fetoprotein precursor
AGTR1_P154_F	4222	0.0987034	1880.807	216.9235	0.3196421	30	78.41471	0.08546166	3587.547	344.5934	0.05421646	33	208.81	0.07811761	4098.298	355.7515	0.02179505	30	182.0321	0.05680269	2445.052	153.2721	0.280657	23	117.5444	0.09537664	3582.622	388.2678	0.04484797	23	214.6313	0.1539387	4246.203	790.7808	0.003131199	25	235.7236	0.1195385	3224.61	451.3755	0.1267307	21	354.7218	0.08133122	4017.387	364.5189	0.1090358	30	240.3811	0.1302928	2863.75	444.006	0.1325865	26	231.1351	0.07384925	4018.655	328.4126	0.02517946	32	99.9386	AGTR1	AGTR1_P154_F	14043060	NM_000685.3	AGTR1	185	3	36.1	149898201	-154	Y	GGTGAACGCTGATCTGATAGTTGACACGGGACGACTGTGGCATCATCCT	AT1, AG2S, AT1B, AT2R1, HAT1R, AGTR1A, AGTR1B, AT2R1A, AT2R1B	type-1B angiotensin II receptor; angiotensin receptor 1B; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: bradykinin receptor activity; go_function: rhodopsin-like receptor activity; go_function: C-X-C chemokine receptor activity; go_function: angiotensin type II receptor activity; go_process: fluid secretion; go_process: circulation; go_process: signal transduction; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	angiotensin II receptor, type 1
AGTR1_P41_F	4219	0.2326727	2297.433	726.9613	0.09751844	45	84.29441	0.08614653	7545.117	720.6848	8.639504E-07	32	372.8244	0.05377537	8873.143	509.9572	2.463929E-09	33	396.8904	0.7755813	1660.722	6084.979	3.798616E-05	24	380.1691	0.06204467	7811.908	523.3636	2.359236E-07	31	348.2469	0.1321305	8191.793	1262.4	8.773986E-11	38	378.0648	0.04936593	8114.881	426.5945	3.853922E-06	22	439.068	0.04761443	9429.621	476.4326	6.291236E-06	40	298.6363	0.06731156	7470.293	546.3434	8.715115E-07	32	283.34	0.04897805	9096.154	473.606	1.445202E-09	20	435.8577	AGTR1	AGTR1_P41_F	14043060	NM_000685.3	AGTR1	185	3	36.1	149898314	-41	Y	GGAGGAGGGAATGCAAAACAGAGCCTCGTCCCCGGAACCCAAGAAGCAGCAACGC	AT1, AG2S, AT1B, AT2R1, HAT1R, AGTR1A, AGTR1B, AT2R1A, AT2R1B	type-1B angiotensin II receptor; angiotensin receptor 1B; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: bradykinin receptor activity; go_function: rhodopsin-like receptor activity; go_function: C-X-C chemokine receptor activity; go_function: angiotensin type II receptor activity; go_process: fluid secretion; go_process: circulation; go_process: signal transduction; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	angiotensin II receptor, type 1
AGXT_E115_R	2991	0.5501875	1868.292	2407.513	0.007915058	26	174.7406	0.9470885	813.1821	16345.47	6.417862E-30	30	1374.712	0.9633614	807.0035	23848.38	3.678E-38	27	1208.899	0.5639988	1380.038	1914.536	0.1497432	30	107.7809	0.9495998	877.7324	18421.65	3.678E-38	24	1596.444	0.9492464	977.3651	20150.01	3.678E-38	24	1494.75	0.9304305	1090.578	15922.92	4.710794E-25	26	1736.884	0.9519739	1037.599	22549.48	3.627535E-34	26	1481.612	0.9274653	898.6236	12768.91	2.145606E-20	22	913.5266	0.96234	780.2749	22493.98	3.678E-38	34	1114.81	AGXT	AGXT_E115_R	4557288	NM_000030.1	AGXT	189	2	36.1	241456950	115	N	GGTTCCCGAGCGGCAGGTTGGGTGCGGACCATGGCCTCTCACAAGCTGCTGGTGAC	AGT, SPT, AGT1, SPAT, TLH6, AGXT1	alanine-glyoxylate aminotransferase, liver-specific peroxisomal; serine-pyruvate aminotransferase; go_component: mitochondrion; go_component: peroxisome; go_component: peroxisome; go_function: transferase activity; go_function: transaminase activity; go_function: serine-pyruvate transaminase activity; go_function: alanine-glyoxylate transaminase activity; go_process: metabolism	alanine-glyoxylate aminotransferase
AGXT_P180_F	50	0.4262659	2676.041	2062.509	0.002357865	31	140.8334	0.9448777	1108.042	20707.62	3.678E-38	15	1265.384	0.9447832	1383.959	25391.15	3.678E-38	29	696.9478	0.1357145	2236.068	366.8214	0.2796488	31	102.7602	0.9377477	1007.284	16679.74	1.683506E-34	24	1384.718	0.9072537	1555.407	16193.37	3.678E-38	28	1319.859	0.9517943	917.0408	20080.89	3.678E-38	32	1253.315	0.9478536	1251.848	24572.24	3.678E-38	20	1570.327	0.9194697	809.9938	10390.02	1.942262E-13	18	969.6429	0.9645108	778.7449	23882.16	3.678E-38	30	1163.682	AGXT	AGXT_P180_F	4557288	NM_000030.1	AGXT	189	2	36.1	241456655	-180	N	GAGCTAAGCAGAATAAGAGGGGCTGGACGTGCAGGACTCAGAGTGGGAGCG	AGT, SPT, AGT1, SPAT, TLH6, AGXT1	alanine-glyoxylate aminotransferase, liver-specific peroxisomal; serine-pyruvate aminotransferase; go_component: mitochondrion; go_component: peroxisome; go_component: peroxisome; go_function: transferase activity; go_function: transaminase activity; go_function: serine-pyruvate transaminase activity; go_function: alanine-glyoxylate transaminase activity; go_process: metabolism	alanine-glyoxylate aminotransferase
AHR_E103_F	28	0.09531942	3099.976	337.1575	0.04803368	23	221.1515	0.04337492	7220.174	331.9085	1.023845E-05	28	562.9963	0.04003932	8934.097	376.8062	3.447198E-09	28	404.6609	0.04878518	3699.746	194.8785	0.0762027	31	209.4872	0.03510152	8207.711	302.2217	1.163708E-07	21	503.8097	0.03745493	9569.239	376.2532	5.722506E-12	29	518.9251	0.04238975	8158.01	365.5506	4.081212E-06	30	429.3439	0.03834305	9893.464	398.4579	2.256543E-06	34	611.3178	0.06109632	5599.392	370.8707	0.0007170236	27	514.5007	0.03777616	10872.28	430.7632	1.955779E-13	27	461.5619	AHR	AHR_E103_F	5016091	NM_001621.2	AHR	196	7	36.1	17304874	103	Y	CGGACCGCCAGCTCAGAACAGGGGCAGCCGTGTAGCCGAACGGAAGCTGG	.	go_component: nucleus; go_function: protein binding; go_function: transcription factor activity; go_function: ligand-dependent nuclear receptor activity; go_process: apoptosis; go_process: cell cycle; go_process: signal transduction; go_process: response to stress; go_process: response to xenobiotic stimulus; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	aryl hydrocarbon receptor
AHR_P166_R	3092	0.03368311	5085.333	180.7462	0.0004891831	24	316.1881	0.03177724	8120.63	269.8025	5.460746E-07	32	252.8347	0.05696465	7727.525	472.8266	4.105102E-07	30	337.1982	0.04733513	3129.63	160.4709	0.1504275	33	117.9788	0.07243263	6087.646	483.1859	0.0001134262	30	297.8339	0.05126248	7720.066	422.5363	5.840607E-08	34	360.5591	0.07348167	8268.912	663.7339	1.063761E-06	22	402.7523	0.05951636	8153.238	522.2874	0.0001218243	29	323.3689	0.08226498	6935.616	630.6666	4.700964E-06	22	385.9303	0.03675687	8334.877	321.8706	7.946879E-08	21	293.6457	AHR	AHR_P166_R	5016091	NM_001621.2	AHR	196	7	36.1	17304605	-166	Y	TTGCCTATGCACGAAGATGGCTACCGGCGGGGGGGGGCGTCCTTACGTCCTACGTC	.	go_component: nucleus; go_function: protein binding; go_function: transcription factor activity; go_function: ligand-dependent nuclear receptor activity; go_process: apoptosis; go_process: cell cycle; go_process: signal transduction; go_process: response to stress; go_process: response to xenobiotic stimulus; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	aryl hydrocarbon receptor
AIM2_E208_F	1228	0.8409795	931.9208	5457.313	8.576327E-06	26	233.4702	0.8654771	1653.109	11278.95	1.166637E-16	38	584.0649	0.8724153	1801.558	13002.72	4.029651E-24	26	455.2004	0.906857	698.2307	7771.713	4.674891E-06	23	342.1207	0.8655228	1660.057	11328.09	4.06198E-18	22	578.4117	0.8111657	2164.589	9727.876	2.33773E-17	27	695.2808	0.9062392	1294.585	13479.26	1.17532E-18	33	555.5069	0.8708184	1759.663	12536.07	3.483677E-12	34	469.0438	0.8390125	1774.216	9767.777	2.620765E-14	29	785.3624	0.9019253	1262.168	12526.91	2.766537E-20	28	422.1485	AIM2	AIM2_E208_F	4757733	NM_004833.1	AIM2	9447	1	36.1	157313063	208	N	GGTGCTTACCTCCTGATCCCTGGGGCGATCAGCAAACCGGGTCTGCCACC	PYHIN4	go_process: immune response	absent in melanoma 2
AIM2_P624_F	5378	0.2751026	4758.711	1843.908	3.569756E-06	23	257.4254	0.8021281	2768.792	11629.43	8.606074E-21	29	688.7255	0.8482375	2307.492	13456.06	1.569643E-27	23	716.2837	0.03179014	4712.662	158.0186	0.01916782	19	204.1161	0.7476881	2858.615	8767.408	2.085432E-14	38	633.6464	0.7327018	3766.987	10599.96	8.341317E-26	35	676.1901	0.8566507	1861.223	11720.2	1.160124E-15	21	975.7799	0.8327408	2886.944	14871.24	5.568068E-19	31	860.2539	0.7711096	2366.653	8309.915	3.640698E-12	34	467.0428	0.8751271	1982.016	14591.06	8.747722E-30	22	729.3281	AIM2	AIM2_P624_F	4757733	NM_004833.1	AIM2	9447	1	36.1	157313895	-624	N	GTCAGCAGTCAGCCAAGTTTTCGACCATCTTGGCTTTAACCAGTTGCGGCC	PYHIN4	go_process: immune response	absent in melanoma 2
AKT1_P310_R	3101	0.07155217	12529.43	973.3052	9.056673E-27	17	1155.869	0.09966081	12554.05	1400.709	1.725533E-19	27	701.8022	0.08407656	14622.82	1351.471	2.598348E-28	21	1361.171	0.03391748	8730.702	310.0306	7.700102E-07	21	344.8967	0.08605078	12476.77	1184.137	4.020823E-20	46	715.2889	0.09825335	14366.36	1576.239	4.035237E-32	30	850.4933	0.1044014	13029.76	1530.558	4.239863E-18	21	928.7747	0.08169399	16091.78	1440.447	1.736394E-18	28	782.6409	0.1068286	11082.89	1337.54	1.109434E-16	28	908.8551	0.1008349	13311.53	1504.006	1.461326E-23	25	594.8929	AKT1	AKT1_P310_R	62241014	NM_001014432.1	AKT1	207	14	36.1	104333435	-310	Y	TGCCGTGACCCTAGCAGAAGGGGCCCGAGACAGGTCAGGGACGAATCCCG	PKB, RAC, PRKBA, MGC99656, RAC-ALPHA	murine thymoma viral (v-akt) oncogene homolog-1; rac protein kinase alpha; protein kinase B; RAC-alpha serine/threonine-protein kinase; go_component: nucleus; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein kinase activity; go_function: identical protein binding; go_function: receptor signaling protein serine/threonine kinase activity; go_process: anti-apoptosis; go_process: response to heat; go_process: signal transduction; go_process: signal transduction; go_process: nitric oxide biosynthesis; go_process: protein amino acid phosphorylation; go_process: insulin receptor signaling pathway; go_process: protein amino acid phosphorylation; go_process: G-protein coupled receptor protein signaling pathway; go_process: insulin-like growth factor receptor signaling pathway	v-akt murine thymoma viral oncogene homolog 1
ALK_E183_R	31	0.0999757	4692.112	532.3131	0.000558048	30	218.0681	0.09260987	10623.29	1094.439	1.302042E-13	31	827.1042	0.08008028	13854.11	1214.725	4.885091E-25	34	679.352	0.1385429	4680.576	768.8308	0.007126728	38	222.1163	0.1066621	10629.55	1281.079	3.822441E-15	30	846.6458	0.1025026	12073.24	1390.297	1.63419E-22	25	818.1852	0.1145419	10577.34	1381.209	4.808368E-12	28	1032.311	0.08955291	14689.37	1454.704	1.316663E-15	29	734.838	0.142797	7582.652	1279.813	2.66872E-08	24	669.5023	0.09275147	14560.99	1498.849	6.902265E-28	28	525.1404	ALK	ALK_E183_R	29029631	NM_004304.3	ALK	238	2	36.1	29997753	183	Y	TTCGCAGGCACTGGAGCGGCCCCGGCGGCAGCAGCTGAGGGCGTTCAGG	CD246	ALK tyrosine kinase receptor precursor; CD246 antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: brain development; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: protein amino acid N-linked glycosylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	anaplastic lymphoma kinase Ki-1
ALK_P28_F	3111	0.03962358	7262.7	303.7731	4.407336E-08	36	316.1642	0.03350496	12874.43	449.7776	1.023911E-17	30	1100.758	0.03111232	17286.17	558.2941	9.46372E-36	26	846.1063	0.04594889	3461.705	171.5384	0.1038967	39	176.721	0.03705543	14015.91	543.1996	5.633554E-23	32	1166.62	0.04768589	16412.01	826.8174	7.295539E-38	28	1349.114	0.05162345	14848.08	813.6761	4.517257E-21	35	921.9838	0.05189842	18285.06	1006.385	1.61255E-22	20	693.0393	0.05942394	11719.19	746.7154	8.256613E-17	34	900.5702	0.02843149	17079.47	502.7314	1.045829E-33	30	765.5356	ALK	ALK_P28_F	29029631	NM_004304.3	ALK	238	2	36.1	29997964	-28	Y	AGCCGCTGGATCGCATCTGCCTGGGCGCCCGCCACTTGCAGCTGGCTGAGCCG	CD246	ALK tyrosine kinase receptor precursor; CD246 antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: brain development; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: protein amino acid N-linked glycosylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	anaplastic lymphoma kinase Ki-1
ALOX12_E85_R	75	0.4354961	603.2559	542.5386	0.6483912	40	29.72465	0.7909923	2457.584	9679.208	1.262305E-14	32	661.3303	0.7338552	3838.071	10858.65	9.389292E-24	29	470.4878	0.05678889	3035.262	188.768	0.1607773	39	131.5715	0.7324891	3277.724	9248.766	8.287402E-17	27	410.2704	0.7279299	2703.603	7501.105	1.270029E-12	33	660.8029	0.7249731	3515.692	9530.992	2.063907E-14	36	501.3329	0.6661478	4752.55	9682.478	1.997385E-12	36	527.9687	0.7837555	1989.867	7574.502	1.074325E-09	30	609.5656	0.2895978	7113.137	2940.459	1.427753E-10	32	491.6095	ALOX12	ALOX12_E85_R	4502050	NM_000697.1	ALOX12	239	17	36.1	6840213	85	Y	GGGGCCTGGCTCTTCTCCGGGTCGTACAACCGCGTGCAGCTTTGGCTGGTCGG	LOG12	12(S)-lipoxygenase; platelet-type 12-lipoxygenase/arachidonate 12-lipoxygenase; go_component: cytosol; go_component: sarcolemma; go_function: iron ion binding; go_function: metal ion binding; go_function: lipoxygenase activity; go_function: oxidoreductase activity; go_function: hepoxilin-epoxide hydrolase activity; go_function: potassium channel inhibitor activity; go_function: arachidonate 12-lipoxygenase activity; go_function: arachidonate 12-lipoxygenase activity; go_process: cell motility; go_process: anti-apoptosis; go_process: anti-apoptosis; go_process: electron transport; go_process: superoxide release; go_process: fatty acid oxidation; go_process: leukotriene biosynthesis; go_process: arachidonic acid metabolism; go_process: regulation of membrane potential; go_process: negative regulation of cell volume; go_process: positive regulation of cell growth; go_process: positive regulation of cell adhesion; go_process: positive regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: oxygen and reactive oxygen species metabolism	arachidonate 12-lipoxygenase
ALOX12_P223_R	3001	0.1535978	4245.824	788.6427	0.001000933	34	146.0093	0.6887856	3514.277	7999.186	3.926654E-13	33	562.4417	0.7227535	3841.888	10276.1	7.901658E-22	18	834.925	0.04957772	5604.299	297.5584	0.003002106	32	192.5048	0.7142743	2844.013	7359.62	4.993442E-11	32	800.9622	0.6445104	4133.345	7675.147	4.207493E-17	23	542.5424	0.7099381	3589.379	9029.904	1.873941E-13	18	525.1129	0.6832219	4393.234	9690.937	8.01405E-12	23	841.2429	0.7245243	2703.336	7373.011	8.584457E-11	37	544.8803	0.356777	7091.554	3988.944	6.754533E-13	26	588.9373	ALOX12	ALOX12_P223_R	4502050	NM_000697.1	ALOX12	239	17	36.1	6839905	-223	Y	CCGTTGGCCTCACCCTGGCTCGGGCCCCTTTATCATCCTGCAGCTACG	LOG12	12(S)-lipoxygenase; platelet-type 12-lipoxygenase/arachidonate 12-lipoxygenase; go_component: cytosol; go_component: sarcolemma; go_function: iron ion binding; go_function: metal ion binding; go_function: lipoxygenase activity; go_function: oxidoreductase activity; go_function: hepoxilin-epoxide hydrolase activity; go_function: potassium channel inhibitor activity; go_function: arachidonate 12-lipoxygenase activity; go_function: arachidonate 12-lipoxygenase activity; go_process: cell motility; go_process: anti-apoptosis; go_process: anti-apoptosis; go_process: electron transport; go_process: superoxide release; go_process: fatty acid oxidation; go_process: leukotriene biosynthesis; go_process: arachidonic acid metabolism; go_process: regulation of membrane potential; go_process: negative regulation of cell volume; go_process: positive regulation of cell growth; go_process: positive regulation of cell adhesion; go_process: positive regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: oxygen and reactive oxygen species metabolism	arachidonate 12-lipoxygenase
ALPL_P278_F	5846	0.05667563	3148.429	195.168	0.05696907	35	113.7718	0.04652683	10959.08	539.6525	4.248308E-13	27	640.1134	0.02761091	15787.24	451.117	2.628031E-29	24	775.7236	0.03011005	6194.154	195.4008	0.001079643	32	198.8267	0.03579147	11158.81	417.9276	2.784466E-14	40	595.9268	0.04914042	10100.81	527.1777	9.868975E-14	24	831.712	0.03371715	13577	477.2406	8.153494E-17	23	785.3492	0.04516717	14659.84	698.1957	4.289409E-14	26	750.8383	0.04938419	9466.796	496.992	1.516225E-10	25	653.2917	0.03848338	12046.29	486.1385	1.248366E-16	32	653.9532	ALPL	ALPL_P278_F	13787192	NM_000478.2	ALPL	249	1	36.1	21708178	-278	Y	TGCCGACGGTAAAGACAAAACAGGAGACGCGCGCAAGGAGCAGGTCAGAGCCCAGGC	HOPS, TNAP, TNSALP, AP-TNAP	alkaline phosphomonoesterase; glycerophosphatase; tissue-nonspecific ALP; go_component: membrane; go_component: integral to membrane; go_function: hydrolase activity; go_function: magnesium ion binding; go_function: alkaline phosphatase activity; go_process: metabolism; go_process: ossification	tissue non-specific alkaline phosphatase precursor
ALPL_P433_F	5851	0.2812628	3803.375	1527.505	0.0003975274	28	180.6254	0.4963743	4124.773	4163.944	7.945462E-07	26	193.3774	0.6309298	3407.102	5995.431	2.249805E-09	29	266.577	0.4429394	1586.122	1340.698	0.2129174	35	82.01138	0.4899721	3990.728	3929.869	1.178759E-06	33	267.6909	0.5496852	3958.377	4953.936	1.47845E-09	26	331.3288	0.4606465	5167.749	4499.035	7.87991E-08	25	238.3383	0.454513	5252.554	4459.877	1.034303E-05	23	352.6032	0.511584	4011.011	4306.016	2.651352E-07	25	233.4063	0.6723316	2699.035	5743.245	1.902722E-07	25	350.1739	ALPL	ALPL_P433_F	13787192	NM_000478.2	ALPL	249	1	36.1	21708023	-433	Y	GAGAGACAGGGACACGTGGGCAGAGACGGATAAAGACAGAGACCCAGAGAAAGCC	HOPS, TNAP, TNSALP, AP-TNAP	alkaline phosphomonoesterase; glycerophosphatase; tissue-nonspecific ALP; go_component: membrane; go_component: integral to membrane; go_function: hydrolase activity; go_function: magnesium ion binding; go_function: alkaline phosphatase activity; go_process: metabolism; go_process: ossification	tissue non-specific alkaline phosphatase precursor
AOC3_P890_R	4223	0.1285478	4036.541	610.1805	0.003035926	29	165.8773	0.6000819	3516.796	5427.045	6.459973E-08	31	456.0638	0.6607193	3458.677	6930.212	1.663729E-11	31	399.6545	0.1831716	2914.733	676.0457	0.109011	43	123.1329	0.6252766	2531.889	4391.663	3.79445E-05	27	415.0093	0.5581843	3525.796	4580.784	6.870803E-08	42	415.6755	0.6404416	2744.944	5067.384	3.533977E-05	32	297.0663	0.648553	3631.986	6886.928	1.208202E-06	27	272.9154	0.5552602	3629.587	4656.41	3.0055E-07	25	255.3562	0.6387053	3532.933	6422.385	2.30948E-10	29	342.1349	AOC3	AOC3_P890_R	6806883	NM_003734.2	AOC3	8639	17	36.1	38255837	-890	N	AATCCTGTGGCCTGCCTCCCCGACCTGGCAGCCTGTGTCCCGGACTTAC	HPAO, VAP1, VAP-1	vascular adhesion protein 1; copper amine oxidase; go_component: plasma membrane; go_component: integral to membrane; go_function: protein binding; go_function: metal ion binding; go_function: copper ion binding; go_function: amine oxidase activity; go_function: oxidoreductase activity; go_function: electron transporter activity; go_process: cell adhesion; go_process: amine metabolism; go_process: inflammatory response	amine oxidase, copper containing 3 precursor
APBA1_E99_R	2994	0.0617209	5485.205	367.4001	6.668676E-05	34	270.2872	0.2696847	6421.302	2408.132	1.017534E-07	24	395.5539	0.2863655	6848.442	2788.254	7.392584E-10	34	324.4364	0.034027	4958.917	178.2035	0.01235214	21	246.3202	0.3167261	6232.653	2935.45	6.944798E-09	15	425.1656	0.255101	6788.006	2358.894	4.458768E-10	27	341.2379	0.265513	7370.686	2700.612	1.691664E-08	22	421.8418	0.230386	8407.409	2546.715	3.487694E-07	21	425.4077	0.2833146	5920.011	2379.785	2.842717E-07	25	297.9224	0.2601438	7169.86	2556.184	6.942529E-10	35	268.3381	APBA1	APBA1_E99_R	22035547	NM_001163.2	APBA1	320	9	36.1	71476943	99	Y	CGGGAGCAGGCGGCGCTAGTGACAGCGCTGGTGCCAAGCCTGGGAATA	X11, X11A, MINT1, D9S411E, X11ALPHA	phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; neuronal munc18-1-interacting protein 1; neuron-specific X11 protein; adaptor protein X11alpha; go_component: synaptic vesicle; go_function: protein binding; go_function: protein binding; go_process: cell adhesion; go_process: protein transport; go_process: axon cargo transport; go_process: synaptic transmission; go_process: protein complex assembly; go_process: protein complex assembly; go_process: nervous system development; go_process: intracellular protein transport	amyloid beta A4 precursor protein-binding, family A, member 1
APBA1_P644_F	56	0.1168885	3482.776	474.2157	0.01665849	21	126.8053	0.05788616	8700.813	540.7471	1.918045E-08	33	412.4764	0.05684393	10610.17	645.501	1.386811E-13	22	737.6913	0.1128009	3134.184	411.2028	0.1146752	33	134.6302	0.07402074	9084.415	734.1819	3.360569E-10	27	368.8812	0.07174502	9109.2	711.7811	1.160597E-11	33	500.9512	0.07339318	9056.296	725.2371	5.131591E-08	27	497.9924	0.07511667	9827.674	806.3004	8.749153E-07	36	683.1901	0.09328985	6366.614	665.3388	2.979378E-05	29	446.1937	0.07649463	9558.22	799.9975	3.10548E-11	27	435.8724	APBA1	APBA1_P644_F	22035547	NM_001163.2	APBA1	320	9	36.1	71477686	-644	Y	GAGTGACTCCCGAGCTTTCCCGCTTCCCAGGCCCCTTAGATATCG	X11, X11A, MINT1, D9S411E, X11ALPHA	phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; neuronal munc18-1-interacting protein 1; neuron-specific X11 protein; adaptor protein X11alpha; go_component: synaptic vesicle; go_function: protein binding; go_function: protein binding; go_process: cell adhesion; go_process: protein transport; go_process: axon cargo transport; go_process: synaptic transmission; go_process: protein complex assembly; go_process: protein complex assembly; go_process: nervous system development; go_process: intracellular protein transport	amyloid beta A4 precursor protein-binding, family A, member 1
APBA2_P227_F	61	0.2927665	4498.456	1903.578	8.145012E-06	27	310.871	0.8383	2499.701	13477.61	8.498507E-26	31	957.974	0.8075273	3132.056	13560.22	4.641785E-31	41	552.8595	0.7248049	778.8203	2314.624	0.182568	28	166.4083	0.8931586	1656.977	14687.74	2.98079E-29	27	789.2482	0.776143	3328.11	11885.73	4.144767E-29	21	1141.729	0.8333744	2625.8	13633.03	8.739657E-23	47	798.438	0.9009773	2050.766	19569.17	1.627408E-28	26	813.5679	0.7441496	2898.991	8722.668	1.627185E-14	24	820.108	0.8483936	2164.068	12669.79	1.270167E-23	26	571.1165	APBA2	APBA2_P227_F	22035549	NM_005503.2	APBA2	321	15	36.1	27000918	-227	N	TGAAGACTTGGGGGAGAATCACGGTCAACTTGTGACGCTTGGTT	X11L, MINT2, LIN-10, HsT16821, MGC99508, D15S1518E, MGC:14091	neuronal munc18-1-interacting protein 2; phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; X11-like protein; neuron-specific X11L protein; adapter protein X11beta; amyloid beta A4; go_function: protein binding; go_process: protein transport; go_process: nervous system development	amyloid beta A4 precursor protein-binding, family A, member 2
APBA2_P305_R	62	0.5878114	587.0541	979.7899	0.5020586	20	120.9779	0.8835117	1134.909	9366.235	6.742076E-11	29	687.1075	0.8908528	1376.917	12054.51	1.171346E-19	27	383.8875	0.4159147	596.0298	495.628	0.6580976	19	66.74242	0.8876366	1064.602	9200	3.663576E-11	25	451.3904	0.8609587	1228.877	8228.547	8.622447E-11	34	666.7139	0.895736	1118.531	10468.45	2.730344E-11	20	436.773	0.8892906	1361.505	11739.77	3.194523E-10	23	359.4914	0.8377358	1129.11	6345.639	6.526358E-06	30	674.455	0.9045864	1036.448	10774.31	1.040711E-14	21	481.0498	APBA2	APBA2_P305_R	22035549	NM_005503.2	APBA2	321	15	36.1	27000840	-305	N	AGCATGCAGCTCTGCTACCTGTGGCCCGAAATCATTAGTTGTCCATACTCACTGACCT	X11L, MINT2, LIN-10, HsT16821, MGC99508, D15S1518E, MGC:14091	neuronal munc18-1-interacting protein 2; phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; X11-like protein; neuron-specific X11L protein; adapter protein X11beta; amyloid beta A4; go_function: protein binding; go_process: protein transport; go_process: nervous system development	amyloid beta A4 precursor protein-binding, family A, member 2
APC_E117_R	4022	0.9125366	1297.566	14581.29	1.257154E-37	25	774.4472	0.3298188	6753.692	3372.934	3.946552E-10	22	694.4081	0.3733181	7176.056	4334.39	3.119619E-14	23	522.7675	0.8928608	1229.042	11075.77	1.877162E-12	28	891.9043	0.4769289	5821.149	5398.822	2.164655E-13	20	810.8583	0.4286415	6573.572	5006.612	2.030185E-16	33	586.7726	0.4304669	6364.723	4886.195	1.243597E-10	24	751.5327	0.4787261	6719.33	6262.718	4.892965E-10	33	697.9999	0.3199582	5360.433	2569.121	1.218452E-06	22	658.4979	0.4261418	7285.109	5484.113	2.74032E-17	31	676.1321	APC	APC_E117_R	53759121	NM_000038.3	APC	324	5	36.1	112101600	117	Y	TTTCCCTCGCACTGTCTTAAACCGATGGCCTTTCCTTGGCACAGGGTCC	GS, DP2, DP3, FAP, FPC, DP2.5	tumor suppressor; adenomatosis polyposis coli tumor suppressor; adenomatous polyposis coli protein; adenomatous polyposisi coli; go_component: nucleus; go_component: lateral plasma membrane; go_function: microtubule binding; go_function: beta-catenin binding; go_process: cell cycle; go_process: cell adhesion; go_process: signal transduction; go_process: protein complex assembly; go_process: Wnt receptor signaling pathway; go_process: negative regulation of progression through cell cycle	adenomatosis polyposis coli
APC_P14_F	2257	0.5109661	4859.479	5181.901	2.047307E-14	28	480.3564	0.4062421	6361.175	4420.659	1.7086E-11	20	391.6481	0.3717506	7745.143	4642.164	1.367852E-16	20	357.3208	0.62911	2871.706	5040.659	2.390782E-05	33	290.2167	0.3828244	7054.451	4437.794	4.555603E-14	25	557.845	0.3920431	7293.66	4767.826	7.060257E-18	27	623.9414	0.3732208	6971.185	4210.595	1.68794E-10	26	492.1524	0.4140124	7437.017	5325.059	1.061946E-09	31	496.6623	0.3737553	6229.281	3777.44	1.221563E-10	25	588.7957	0.4365716	7412.887	5821.348	1.27046E-18	27	665.9865	APC	APC_P14_F	53759121	NM_000038.3	APC	324	5	36.1	112101469	-14	Y	CCGACATGTGGCTGTATTGGTGCAGCCCGCCAGGGTGTCACTGGAGACAGAA	GS, DP2, DP3, FAP, FPC, DP2.5	tumor suppressor; adenomatosis polyposis coli tumor suppressor; adenomatous polyposis coli protein; adenomatous polyposisi coli; go_component: nucleus; go_component: lateral plasma membrane; go_function: microtubule binding; go_function: beta-catenin binding; go_process: cell cycle; go_process: cell adhesion; go_process: signal transduction; go_process: protein complex assembly; go_process: Wnt receptor signaling pathway; go_process: negative regulation of progression through cell cycle	adenomatosis polyposis coli
APC_P280_R	2259	0.04175531	6103.451	270.3141	9.126579E-06	27	302.5114	0.04840623	9782.762	502.7221	1.881964E-10	27	662.0569	0.04305937	12176.96	552.4255	1.452742E-17	32	595.5864	0.05313244	4395.997	252.2879	0.02709055	44	249.263	0.06755661	9229.951	675.9658	2.197173E-10	30	362.0451	0.06649381	9270.929	667.4929	5.95863E-12	23	822.8717	0.04897105	10229.23	531.8799	1.033112E-09	39	659.5988	0.05461399	12551.86	730.8853	1.655171E-10	34	365.4126	0.07558331	6877.275	570.4846	7.182573E-06	23	461.2792	0.05182069	12580.16	693.0069	9.768583E-19	23	642.8154	APC	APC_P280_R	53759121	NM_000038.3	APC	324	5	36.1	112101203	-280	Y	CCTCCCCCGACTCTTTACTATGCGTGTCAACTGCCATCAACTTCCTTGCTTGC	GS, DP2, DP3, FAP, FPC, DP2.5	tumor suppressor; adenomatosis polyposis coli tumor suppressor; adenomatous polyposis coli protein; adenomatous polyposisi coli; go_component: nucleus; go_component: lateral plasma membrane; go_function: microtubule binding; go_function: beta-catenin binding; go_process: cell cycle; go_process: cell adhesion; go_process: signal transduction; go_process: protein complex assembly; go_process: Wnt receptor signaling pathway; go_process: negative regulation of progression through cell cycle	adenomatosis polyposis coli
APOA1_P261_F	66	0.623593	541.6985	1063.101	0.4885446	27	53.64739	0.9699547	378.7486	15455.48	2.550501E-25	24	1293.006	0.9770339	389.9518	20843.78	3.678E-38	34	795.3818	0.7841634	315.2225	1508.559	0.4709443	26	81.50298	0.9693921	405.316	16003.98	1.70705E-29	28	829.0883	0.9679191	438.6382	16251.32	2.265343E-35	28	1441.374	0.9709162	425.1362	17530.82	4.774395E-28	21	857.845	0.9732778	501.4566	21906.29	1.029273E-30	25	708.6331	0.9529499	488.1559	11912.47	1.261267E-16	25	867.5296	0.9749669	389.1845	19052.35	3.678E-38	36	793.5789	APOA1	APOA1_P261_F	4557320	NM_000039.1	APOA1	335	11	36.1	116213809	-261	N	GCTTGCAGGTCTCCCGGGTGGGGTCGGGGTTCCCTGCACTCATCCCCT	MGC117399	preproapolipoprotein; apolipoprotein A1; amyloidosis; apolipoprotein A-I, preproprotein; go_component: extracellular space; go_function: lipid binding; go_function: protein binding; go_function: lipid transporter activity; go_function: high-density lipoprotein binding; go_process: circulation; go_process: circulation; go_process: lipid transport; go_process: lipid metabolism; go_process: steroid metabolism; go_process: lipoprotein metabolism; go_process: cholesterol transport; go_process: cholesterol metabolism	apolipoprotein A-I preproprotein
APOA1_P75_F	63	0.4587477	376.0123	403.4524	0.760515	36	23.00599	0.9117261	574.8331	6969.926	1.048723E-05	21	551.0854	0.9466921	621.2836	12809.24	1.178871E-19	29	723.9825	0.6029841	332.1353	656.3229	0.6825928	33	40.8544	0.9408489	581.4309	10838.75	6.910431E-14	30	508.1114	0.935253	685.5671	11347.3	8.658812E-18	24	740.8	0.9373772	603.6944	10533.33	2.054645E-10	33	717.6434	0.9480121	717.5747	14908.65	1.335837E-14	22	606.8395	0.9165211	570.4793	7361.238	1.208417E-06	38	570.8216	0.9511034	600.9581	13634.57	1.119098E-21	15	742.2737	APOA1	APOA1_P75_F	4557320	NM_000039.1	APOA1	335	11	36.1	116213623	-75	N	AGGCTGATAAGCCCAGCCCCGGCCCTGTTGCTGCTCACTGGTCCTGGCAAT	MGC117399	preproapolipoprotein; apolipoprotein A1; amyloidosis; apolipoprotein A-I, preproprotein; go_component: extracellular space; go_function: lipid binding; go_function: protein binding; go_function: lipid transporter activity; go_function: high-density lipoprotein binding; go_process: circulation; go_process: circulation; go_process: lipid transport; go_process: lipid metabolism; go_process: steroid metabolism; go_process: lipoprotein metabolism; go_process: cholesterol transport; go_process: cholesterol metabolism	apolipoprotein A-I preproprotein
APOC1_P406_R	69	0.2622393	8712.116	3132.294	2.437605E-20	24	814.8793	0.8708321	3789.156	26220.15	3.678E-38	22	1314.642	0.8793945	4008.467	29956.87	3.678E-38	24	905.8792	0.3861079	5109.236	3276.354	6.033484E-06	23	717.3498	0.8411235	4893.333	26435.68	3.678E-38	21	977.8264	0.8471238	5257.468	29687.02	3.678E-38	26	1002.162	0.8766262	4279.343	31117.2	3.678E-38	28	955.4936	0.8825102	4366.457	33549.23	3.678E-38	41	802.4975	0.8362036	2512.155	13335.42	7.360874E-28	22	1705.782	0.8571295	4821.744	29527.24	3.678E-38	33	672.322	APOC1	APOC1_P406_R	51944963	NM_001645.3	APOC1	341	19	36.1	50109355	-406	Y	CCCCTGCTTGTTCAATCGATCACGACCCTCTCACGTGCACCCACTTA	.	go_component: extracellular region; go_function: lipid transporter activity; go_process: lipid transport; go_process: lipid metabolism; go_process: lipoprotein metabolism	apolipoprotein C-I precursor
APOC2_P377_F	74	0.4632375	5372.785	4723.13	1.406859E-14	25	787.6221	0.8331879	785.1964	4421.35	0.005545852	24	324.1575	0.8497984	969.7946	6052.597	2.976476E-05	21	180.2606	0.4432462	2235.229	1859.137	0.05913337	24	365.1924	0.8299587	825.4568	4517.084	0.003007777	23	256.8391	0.7485989	951.35	3130.612	0.02589189	29	195.0312	0.8542137	814.3599	5357.561	0.002179689	30	231.1534	0.8575738	842.1133	5672.634	0.007295719	16	313.6499	0.7741514	953.5143	3611.179	0.01816933	32	198.3613	0.8751488	799.8096	6307.247	2.445476E-05	30	284.4797	APOC2	APOC2_P377_F	32130517	NM_000483.3	APOC2	344	19	36.1	50140706	-377	N	GGGAAGGAAGAGTAGGGAGGTCGGGAAGGGTATCAAGGAATAACACC	MGC75082	go_component: chylomicron; go_component: extracellular region; go_function: enzyme activator activity; go_function: lipid transporter activity; go_function: lipoprotein lipase activity; go_process: circulation; go_process: lipid transport; go_process: lipid catabolism	apolipoprotein C-II precursor
APP_E8_F	3007	0.03563364	6177.016	231.9377	7.920543E-06	21	190.1896	0.02502491	10335.38	267.8472	4.112164E-11	28	545.0823	0.03253067	13199.74	447.1972	2.514156E-20	34	891.6134	0.03385809	4423.451	158.5227	0.02992516	41	172.7708	0.03782186	11528.68	457.107	2.423135E-15	35	597.5876	0.03037185	11965.8	377.9393	9.159685E-19	31	812.2155	0.04104912	10602.08	458.1161	2.873275E-10	26	956.4663	0.03098866	15897.74	511.6024	3.887807E-16	25	586.6243	0.04963239	8477.692	447.9649	2.022392E-08	35	546.2706	0.02397846	13416.71	332.0724	3.674928E-20	19	675.7557	APP	APP_E8_F	41406054	NM_201413.1	APP	351	21	36.1	26464995	8	Y	GCGGCGGGGCTCAGAGCCAGGCGAGTCAGCTGATCCGGCCCACCC	AAA, AD1, PN2, ABPP, APPI, CVAP, ABETA, CTFgamma	precursor, isoform b is encoded by transcript variant 2; amyloid beta (A4) precursor protein (protease nexin-II, Alzheimer disease); cerebral vascular amyloid peptide; amyloid-beta protein; beta-amyloid peptide; A4 amyloid protein; go_component: membrane; go_component: coated pit; go_component: cell surface; go_component: extracellular region; go_component: integral to plasma membrane; go_function: heparin binding; go_function: iron ion binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: serine-type endopeptidase inhibitor activity; go_function: serine-type endopeptidase inhibitor activity; go_process: apoptosis; go_process: endocytosis; go_process: cell adhesion; go_process: Notch signaling pathway; go_process: copper ion homeostasis; go_process: neuromuscular physiological process	amyloid beta A4 protein precursor, isoform b
APP_P179_R	80	0.03779666	4641.288	186.2443	0.001834752	28	163.1866	0.08597064	8074.508	768.8678	9.630783E-08	28	635.7287	0.07872541	10203.12	880.4297	3.717584E-13	35	294.8427	0.03854562	3962.291	162.8611	0.05679268	34	170.326	0.09302312	8695.873	902.1394	9.64223E-10	32	446.3173	0.08717801	9676.198	933.6646	1.103691E-13	33	428.8123	0.102293	8467.853	976.3	1.78034E-07	34	607.5588	0.08671568	10437.38	1000.516	8.178565E-08	28	352.6902	0.1113836	6628.877	843.4311	6.583261E-06	39	344.1921	0.08393484	9592.636	888.0916	1.656611E-11	28	520.2045	APP	APP_P179_R	41406054	NM_201413.1	APP	351	21	36.1	26465182	-179	Y	GGCCGACGGCCCACCTGGGCTTCGTGAACAGTGGGAGGGAGAG	AAA, AD1, PN2, ABPP, APPI, CVAP, ABETA, CTFgamma	precursor, isoform b is encoded by transcript variant 2; amyloid beta (A4) precursor protein (protease nexin-II, Alzheimer disease); cerebral vascular amyloid peptide; amyloid-beta protein; beta-amyloid peptide; A4 amyloid protein; go_component: membrane; go_component: coated pit; go_component: cell surface; go_component: extracellular region; go_component: integral to plasma membrane; go_function: heparin binding; go_function: iron ion binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: serine-type endopeptidase inhibitor activity; go_function: serine-type endopeptidase inhibitor activity; go_process: apoptosis; go_process: endocytosis; go_process: cell adhesion; go_process: Notch signaling pathway; go_process: copper ion homeostasis; go_process: neuromuscular physiological process	amyloid beta A4 protein precursor, isoform b
AR_P189_R	2261	0.1909169	5750.959	1380.633	3.496903E-07	13	293.5701	0.1396523	8800.118	1444.674	2.277923E-10	18	652.0283	0.1523728	10460.23	1898.349	1.646003E-16	41	561.3194	0.03221093	7193.517	242.7502	8.7072E-05	25	241.3264	0.3441187	9730.032	5157.485	4.536827E-24	27	1159.693	0.3801034	8605.242	5337.814	3.13128E-24	29	1038.207	0.2978647	9361.358	4013.763	3.577795E-15	26	982.4007	0.313389	12932.49	5948.403	1.537432E-21	34	516.369	0.4225782	6476.918	4813.228	1.153386E-13	16	768.6859	0.4094065	10154.61	7108.621	1.935802E-32	31	950.8864	AR	AR_P189_R	58535454	NM_001011645.1	AR	367	X	36.1	66680410	-189	Y	CTAGAGCTAGCCTCTCCTGCCCTCGCCCACGCTGCGCCAGCACTTGTTTCT	KD, AIS, TFM, DHTR, SBMA, NR3C4, SMAX1, HUMARA	isoform 2 is encoded by transcript variant 2; dihydrotestosterone receptor; go_component: nucleus; go_component: nucleus; go_component: cytoplasm; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: receptor activity; go_function: androgen binding; go_function: androgen receptor activity; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: androgen receptor activity; go_function: androgen receptor activity; go_function: protein dimerization activity; go_function: transcription factor activity; go_process: transcription; go_process: transport; go_process: cell growth; go_process: cell proliferation; go_process: cell-cell signaling; go_process: sex differentiation; go_process: signal transduction; go_process: prostate gland development; go_process: regulation of transcription, DNA-dependent	androgen receptor isoform 2
AR_P54_R	2265	0.1167723	2839.816	388.6754	0.06970451	32	101.1408	0.0458536	7127.36	347.3267	1.317694E-05	35	176.2412	0.04774329	7852.395	398.7092	3.35193E-07	26	256.6866	0.113261	1262.224	173.9935	0.571931	24	38.45435	0.3660999	5913.524	3473.025	2.580356E-09	27	414.5936	0.2620113	6939.889	2499.402	9.507505E-11	34	291.4077	0.2618224	6207.566	2237.216	5.241821E-06	18	450.3502	0.1838477	7993.185	1823.083	7.933812E-06	30	314.3541	0.2310001	6357.717	1939.836	2.868584E-07	23	367.1197	0.3352344	5864.313	3007.741	3.222706E-08	34	351.4138	AR	AR_P54_R	58535454	NM_001011645.1	AR	367	X	36.1	66680545	-54	Y	AGGAGGCCGGCCCGGTGGGGGCGGGACCCGACTCGCAAACTGTTGCATTT	KD, AIS, TFM, DHTR, SBMA, NR3C4, SMAX1, HUMARA	isoform 2 is encoded by transcript variant 2; dihydrotestosterone receptor; go_component: nucleus; go_component: nucleus; go_component: cytoplasm; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: receptor activity; go_function: androgen binding; go_function: androgen receptor activity; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: androgen receptor activity; go_function: androgen receptor activity; go_function: protein dimerization activity; go_function: transcription factor activity; go_process: transcription; go_process: transport; go_process: cell growth; go_process: cell proliferation; go_process: cell-cell signaling; go_process: sex differentiation; go_process: signal transduction; go_process: prostate gland development; go_process: regulation of transcription, DNA-dependent	androgen receptor isoform 2
ARAF_E38_F	1240	0.2205519	1178.625	361.7984	0.5114652	32	47.72228	0.0372298	7496.603	293.7565	4.618104E-06	27	272.6551	0.04856715	7939.416	410.3826	2.250308E-07	32	358.881	0.07342702	4111.975	333.7813	0.03652211	29	251.0635	0.7992637	2904.833	11964.22	5.235815E-24	35	737.8842	0.7389754	3355.304	9782.163	2.201615E-21	28	567.3799	0.8237118	2697.993	13073.7	2.211989E-21	27	881.5525	0.767348	3642.934	12345.19	2.669365E-15	32	626.8419	0.8054839	2262.437	9782.76	1.21165E-15	28	654.7157	0.7931952	3387.966	13378.01	1.628588E-30	23	491.688	ARAF	ARAF_E38_F	4502192	NM_001654.1	ARAF	369	X	36.1	47305489	38	Y	CCAATAAGGGTGGAAGGCTGAGTCCCGCAGAGCCAATAACGAGAGTCCGAGAGG	PKS2, A-RAF, ARAF1, RAFA1	Oncogene ARAF1; v-raf murine sarcoma 3611 viral oncogene homolog 1; Ras-binding protein DA-Raf; go_component: cellular component unknown; go_function: ATP binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: diacylglycerol binding; go_function: receptor signaling protein activity; go_function: protein serine/threonine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	v-raf murine sarcoma 3611 viral oncogene homolog
ARAF_P63_R	5504	0.1719469	5205.969	1101.795	1.187556E-05	31	204.1788	0.05332367	9269.422	527.7537	1.757351E-09	23	309.2768	0.06453339	10380.58	723.0056	3.317405E-13	26	435.2231	0.1685303	5315.484	1097.662	0.001025062	20	209.4875	0.5211267	5454.198	6044.272	4.393929E-14	23	735.6718	0.4771146	6785.138	6282.447	3.808432E-21	27	1126.803	0.4428964	7119.901	5739.81	5.474043E-14	22	707.89	0.4370879	9683.683	7596.798	6.048506E-18	32	539.4033	0.5285502	4716.086	5399.395	7.031591E-11	32	368.384	0.5033485	7869.803	8077.27	1.765927E-27	20	977.6923	ARAF	ARAF_P63_R	4502192	NM_001654.1	ARAF	369	X	36.1	47305388	-63	Y	GAGCGCTTGCCCCAGATCTTGACGTTTCAGGCGGCCCCTCCTAATC	PKS2, A-RAF, ARAF1, RAFA1	Oncogene ARAF1; v-raf murine sarcoma 3611 viral oncogene homolog 1; Ras-binding protein DA-Raf; go_component: cellular component unknown; go_function: ATP binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: diacylglycerol binding; go_function: receptor signaling protein activity; go_function: protein serine/threonine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	v-raf murine sarcoma 3611 viral oncogene homolog
AREG_E25_F	101	0.04843367	5865.452	303.6349	2.042747E-05	22	271.1056	0.05222562	8243.647	459.7636	1.665239E-07	34	477.0021	0.05159254	9446.561	519.3246	1.464042E-10	34	750.3029	0.3031588	417.7503	225.2458	0.7585163	25	33.24889	0.05508528	8511.979	502.0488	1.373503E-08	31	543.3183	0.05050292	9891.826	531.4565	3.446436E-13	33	715.5733	0.06096404	9809.139	643.3206	3.707408E-09	29	589.8829	0.06392036	10068.18	694.3358	6.070997E-07	29	465.4969	0.06096589	7000.47	460.9912	6.841938E-06	29	543.3846	0.04873267	10437.66	539.8359	1.187347E-12	19	498.797	AREG	AREG_E25_F	22035683	NM_001657.2	AREG	374	4	36.1	75529742	25	Y	CCTACAGACGTTCGCACACCTGGGTGCCAGCGCCCCAGAGGTCCCGGGACAGCCC	AR, SDGF, CRDGF, MGC13647	schwannoma-derived growth factor; colorectum cell-derived growth factor; go_component: membrane; go_component: integral to membrane; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: cell proliferation; go_process: cell-cell signaling	amphiregulin preproprotein
AREG_P217_R	3002	0.1202272	6809.752	944.2668	1.724582E-08	25	361.6131	0.178547	11111.25	2436.822	2.461429E-18	30	699.6573	0.1636552	15346.44	3022.545	5.321623E-38	32	893.2836	0.02312293	8784.071	210.2882	8.960239E-07	30	292.3411	0.09863988	12724.27	1403.417	1.401942E-21	28	1296.902	0.1517209	14080.1	2536.213	4.816923E-35	29	1374.697	0.13056	14938.3	2258.237	1.275245E-25	32	999.2506	0.152054	15669.89	2827.863	1.201305E-20	44	671.5768	0.1901281	10182.06	2413.849	3.523769E-17	27	1064.894	0.06517616	15041.46	1055.667	5.051066E-28	26	829.7657	AREG	AREG_P217_R	22035683	NM_001657.2	AREG	374	4	36.1	75529500	-217	Y	TCCGGAACTCCAGTCCTGCTCGCCCTCAAAAACGGCTTGCAGCTAGAGG	AR, SDGF, CRDGF, MGC13647	schwannoma-derived growth factor; colorectum cell-derived growth factor; go_component: membrane; go_component: integral to membrane; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: cell proliferation; go_process: cell-cell signaling	amphiregulin preproprotein
ARHGAP9_P260_F	1842	0.4420109	3038.383	2486.069	0.0002099306	35	160.4374	0.8989518	1221.234	11754.06	8.957326E-17	25	689.685	0.8836392	1660.465	13368.9	6.710851E-25	27	468.597	0.3821779	1684.551	1103.903	0.2402215	29	150.1873	0.8910187	1185.332	10508.73	1.396022E-14	32	468.6532	0.8956916	1400.206	12882.2	1.735537E-25	32	517.4745	0.8784955	1533.909	11813.4	4.158064E-15	29	510.7415	0.8915731	1666.422	14524.95	1.061046E-15	22	730.6583	0.8897504	1288.849	11208.46	6.727644E-17	27	612.5696	0.8814126	1442.876	11467.58	1.09237E-17	31	622.8278	ARHGAP9	ARHGAP9_P260_F	14210509	NM_032496.1	ARHGAP9	64333	12	36.1	56169124	-260	N	TAAGGTCCCTGTCTTGCAGCTGGATAGCGGCAACTACCTCTTCTCCACTAGTGCAATC	10C, RGL1, MGC1295	go_function: GTPase activator activity	Rho GTPase activating protein 9
ARHGAP9_P518_R	1787	0.5128944	1899.12	2104.959	0.01499311	26	127.3739	0.8788229	1857.981	14200.04	4.549981E-26	31	818.9799	0.8925006	2060.216	17934.92	3.678E-38	26	1050.122	0.7157605	1039.078	2868.381	0.07500389	25	151.2279	0.889161	1642.675	13979.9	1.286796E-26	27	823.7459	0.8858616	1564.842	12921.33	2.943479E-26	26	721.7787	0.8792561	1858.639	14262.79	2.198534E-22	38	714.8392	0.8852578	2111.018	17058.44	3.169067E-22	31	784.3291	0.8746043	1610.68	11931.58	5.28262E-20	20	915.7632	0.8744473	1801.9	13246.32	2.427988E-24	27	1083.956	ARHGAP9	ARHGAP9_P518_R	14210509	NM_032496.1	ARHGAP9	64333	12	36.1	56169382	-518	N	TAACCAGTGGCTGGAATGGGAAGCGACAGAGCTGCAGGTAGGACTAAGGTAT	10C, RGL1, MGC1295	go_function: GTPase activator activity	Rho GTPase activating protein 9
ARHGDIB_P148_R	3126	0.1425433	4997.827	847.4606	6.847468E-05	38	144.1794	0.1160731	8476.222	1126.189	4.137161E-09	29	493.3549	0.1306102	9010.439	1368.68	1.751521E-11	30	490.0342	0.1882893	1855.664	453.6477	0.3477737	32	64.5676	0.2205001	8512.222	2436.172	9.81849E-13	33	442.5058	0.2398592	9145.551	2917.395	6.987032E-18	33	899.1137	0.2912968	8388.801	3489.133	7.046521E-12	22	694.3959	0.2845334	10796.39	4333.379	1.137133E-13	29	579.5912	0.2968124	6270.497	2688.959	1.741927E-08	34	512.9421	0.07836194	9738.475	836.5128	1.015591E-11	24	475.3045	ARHGDIB	ARHGDIB_P148_R	56676392	NM_001175.4	ARHGDIB	397	12	36.1	15005977	-148	N	GCACATGTGCGAGCATGACAGCCCGTGTGACGTGGAGATGCATGAATGTACACGCAAGA	D4, GDIA2, GDID4, LYGDI, Ly-GDI, RAP1GN1	Rho GDI 2; go_component: cytoplasm; go_component: cytoskeleton; go_component: cytoplasmic membrane-bound vesicle; go_function: GTPase activator activity; go_function: Rho GDP-dissociation inhibitor activity; go_process: development; go_process: cell motility; go_process: immune response; go_process: Rho protein signal transduction; go_process: negative regulation of cell adhesion; go_process: actin cytoskeleton organization and biogenesis	Rho GDP dissociation inhibitor (GDI) beta
ARHGDIB_P342_F	3136	0.04397166	4931.493	231.4189	0.0006762607	27	220.7359	0.2082611	5871.926	1570.872	1.460748E-05	28	232.578	0.2288725	5596.261	1690.664	1.219895E-05	32	214.6448	0.0498447	4155.077	223.2193	0.04020518	33	199.834	0.1926066	6298.319	1526.342	1.686757E-06	26	378.0248	0.1862548	7712.104	1788.08	6.841921E-11	30	399.7165	0.2051286	6587.02	1725.687	7.924854E-06	29	392.3018	0.2227063	5790.823	1687.81	0.001397213	25	217.2269	0.170324	6462.629	1347.241	1.917296E-06	25	200.3753	0.2315731	7613.993	2324.689	2.504001E-10	31	191.4278	ARHGDIB	ARHGDIB_P342_F	56676392	NM_001175.4	ARHGDIB	397	12	36.1	15006171	-342	N	TCTGTTCCCACTGGGTCCCCGCCAGCTTCATTATCAACCAGATACGTTGA	D4, GDIA2, GDID4, LYGDI, Ly-GDI, RAP1GN1	Rho GDI 2; go_component: cytoplasm; go_component: cytoskeleton; go_component: cytoplasmic membrane-bound vesicle; go_function: GTPase activator activity; go_function: Rho GDP-dissociation inhibitor activity; go_process: development; go_process: cell motility; go_process: immune response; go_process: Rho protein signal transduction; go_process: negative regulation of cell adhesion; go_process: actin cytoskeleton organization and biogenesis	Rho GDP dissociation inhibitor (GDI) beta
ARNT_P146_R	3144	0.06142167	4570.22	305.6247	0.001597225	29	129.1705	0.07361121	8474.787	681.356	2.730349E-08	25	570.401	0.0754884	10566.43	870.9372	4.80471E-14	26	514.6031	0.2122119	346.4531	120.2642	0.7930794	17	17.56852	0.04926531	9941.935	520.3544	1.322667E-11	23	797.9332	0.06419428	9072.702	629.2278	2.259975E-11	26	464.7676	0.05580902	10769.57	642.4761	6.050367E-11	19	383.076	0.0499044	11612.77	615.2213	6.542161E-09	19	644.9545	0.06493534	8553.506	600.9406	7.265557E-09	26	449.103	0.06334484	10546.51	720.0101	2.401658E-13	26	769.6282	ARNT	ARNT_P146_R	30795239	NM_178426.1	ARNT	405	1	36.1	149115956	-146	Y	AAATCGTCCAAGGGCAGGGCTACTCACTGCGCCAGCCAGTCCAGTGAAGGGAGG	HIF1B, TANGO, HIF1BETA, HIF-1beta	isoform 2 is encoded by transcript variant 2; dioxin receptor, nuclear translocator; hypoxia-inducible factor 1, beta subunit; go_component: nucleus; go_component: nucleus; go_function: receptor activity; go_function: protein binding; go_function: signal transducer activity; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_function: transcriptional activator activity; go_function: aryl hydrocarbon receptor nuclear translocator activity; go_process: signal transduction; go_process: protein import into nucleus, translocation; go_process: regulation of transcription, DNA-dependent	aryl hydrocarbon receptor nuclear translocator isoform 2
ARNT_P238_R	3022	0.05046996	3493.668	191.0127	0.02970257	23	260.0032	0.09721418	8115.653	884.6816	5.148747E-08	29	530.3912	0.09836072	9316.25	1027.228	2.111922E-11	27	469.5981	0.1599063	731.7379	158.3159	0.7052296	30	52.65373	0.08741363	8255.409	800.337	1.14345E-08	27	339.8987	0.1085521	8697.079	1071.225	1.560449E-11	24	359.3975	0.0973276	8680.874	946.768	9.108849E-08	36	387.9619	0.09586097	10021.69	1073.149	2.304586E-07	23	522.4516	0.1297274	7610.769	1149.408	4.159978E-08	29	406.7121	0.1279582	11031.19	1633.325	5.37918E-17	22	561.4213	ARNT	ARNT_P238_R	30795239	NM_178426.1	ARNT	405	1	36.1	149116048	-238	Y	CCTTGCGTAAGAGGTCAATGACCGAGTAACGTCATTGAAATGCAATTAAAATGGGT	HIF1B, TANGO, HIF1BETA, HIF-1beta	isoform 2 is encoded by transcript variant 2; dioxin receptor, nuclear translocator; hypoxia-inducible factor 1, beta subunit; go_component: nucleus; go_component: nucleus; go_function: receptor activity; go_function: protein binding; go_function: signal transducer activity; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_function: transcriptional activator activity; go_function: aryl hydrocarbon receptor nuclear translocator activity; go_process: signal transduction; go_process: protein import into nucleus, translocation; go_process: regulation of transcription, DNA-dependent	aryl hydrocarbon receptor nuclear translocator isoform 2
ASB4_E89_F	3011	0.9104145	923.3459	10399.77	1.636128E-18	36	717.1249	0.9476927	642.8732	13459.22	6.447006E-20	27	951.098	0.9619709	636.7017	18635.33	3.678E-38	25	638.4124	0.8903724	613.8135	5797.444	0.001029337	31	355.7961	0.9561635	614.3617	15581.68	1.06567E-28	34	703.7184	0.9442974	745.6068	14335.14	1.414577E-28	29	1084.399	0.9529153	641.6059	15008.85	4.859569E-21	32	979.715	0.9548926	777.9974	18586.6	1.072931E-22	28	735.8176	0.9241121	686.1213	9572.855	3.356772E-11	29	538.7616	0.9598451	585.5888	16388.02	2.603685E-31	31	618.3099	ASB4	ASB4_E89_F	7706378	NM_016116.1	ASB4	51666	7	36.1	94953309	89	N	TCCTTGAGGCGCTAAAGTCCAATGACTTCGGAAAATTGAAGGCTATTTTGAT	ASB-4	isoform a is encoded by transcript variant 1; go_process: intracellular signaling cascade	ankyrin repeat and SOCS box-containing protein 4 isoform a
ASB4_P391_F	96	0.5352132	2456.44	2943.802	0.0003172552	39	285.3874	0.9210037	1047.421	13377.57	7.157372E-21	33	1029.553	0.94366	857.5374	16038.17	7.306221E-32	32	955.1758	0.1530864	2633.202	494.0481	0.1767572	28	168.1394	0.9402167	817.8846	14435.66	2.543202E-25	29	932.1704	0.9138255	1156.33	13322.58	3.137228E-26	27	983.2306	0.93394	953.4815	14893.86	1.348997E-21	28	986.9208	0.9360678	1127.792	17976.79	4.530212E-22	32	836.8719	0.8895248	1068.451	9408.138	1.06856E-11	28	663.3577	0.9419884	936.1575	16825.06	1.981365E-34	27	781.9067	ASB4	ASB4_P391_F	7706378	NM_016116.1	ASB4	51666	7	36.1	94952829	-391	N	TTTTGGATATTGGCTTGTCAGAGCAAGACGCTGGATCTCCAGCCAGGCACCAGATGT	ASB-4	isoform a is encoded by transcript variant 1; go_process: intracellular signaling cascade	ankyrin repeat and SOCS box-containing protein 4 isoform a
ASB4_P52_R	87	0.6697716	651.6279	1524.457	0.2950687	30	78.71339	0.9619794	548.976	16420.09	3.095224E-29	25	1001.248	0.9451538	701.4731	13811.64	3.915744E-23	33	646.611	0.6339287	498.0092	1035.577	0.5467411	32	67.3905	0.9619145	510.6632	15423.33	9.755356E-28	29	1132.683	0.9577591	575.6357	15319.17	6.429118E-32	42	701.5504	0.9611799	545.2458	15976.17	1.462908E-23	25	1094.785	0.9684095	570.9152	20566.96	3.269947E-27	28	623.1118	0.9388481	521.2129	9537.302	9.398719E-11	26	703.1608	0.9653212	527.4933	17466.93	2.206818E-35	25	701.4761	ASB4	ASB4_P52_R	7706378	NM_016116.1	ASB4	51666	7	36.1	94953168	-52	N	ACTCTCCAGCATGCGCCTGTTTGCTCGGTGCTGTTCTCTCGATAAATCACAACAAAG	ASB-4	isoform a is encoded by transcript variant 1; go_process: intracellular signaling cascade	ankyrin repeat and SOCS box-containing protein 4 isoform a
ASCL1_E24_F	3014	0.06003232	4678.046	305.1565	0.001166497	22	210.1503	0.0968437	7515.713	816.6181	6.7697E-07	21	538.8792	0.07248595	10295.32	812.4025	3.240284E-13	31	437.1996	0.2733809	335.1469	163.7183	0.7870037	39	17.11895	0.0852119	8955.729	843.535	3.689922E-10	28	451.172	0.06907222	10664.82	798.7192	4.475912E-16	35	467.9316	0.06763417	9658.396	707.8777	5.255936E-09	25	558.5348	0.08698558	11184.54	1075.111	5.888535E-09	23	518.0144	0.1085493	6216.351	769.1232	3.471257E-05	42	357.655	0.07486919	9800.841	801.2574	8.814408E-12	32	330.744	ASCL1	ASCL1_E24_F	55743093	NM_004316.2	ASCL1	429	12	36.1	101875618	24	Y	TCTGGCCAGGGAACGTGGAAGGCGCACCGACAGGGATCCGGCCAGG	ASH1, HASH1, MASH1	go_component: nucleus; go_function: transcription factor activity; go_process: cell differentiation; go_process: nervous system development; go_process: regulation of transcription; go_process: regulation of transcription from RNA polymerase II promoter	achaete-scute complex homolog-like 1
ASCL1_P747_F	102	0.1749248	2636.835	580.2385	0.07107872	29	134.5358	0.4607742	5515.173	4798.226	1.650068E-10	33	598.3514	0.4517792	6526.352	5460.661	1.726487E-15	36	393.6003	0.10807	1725.542	221.1902	0.4389881	29	76.42371	0.4313649	6152.91	4743.438	1.305516E-12	31	538.213	0.5164678	5616.241	6105.6	7.677761E-17	38	748.4524	0.4593715	6056.147	5230.872	1.059313E-10	29	545.9207	0.4486169	6402.309	5290.415	3.699505E-08	22	686.9803	0.3460532	5453.773	2938.926	1.948308E-07	33	436.0671	0.4048833	7381.271	5089.829	1.839159E-16	25	483.8434	ASCL1	ASCL1_P747_F	55743093	NM_004316.2	ASCL1	429	12	36.1	101874847	-747	Y	ATTCTGTGGCTGCAGACGAGGAAGCGAAGGCTCAGAGAGGATGCCACTTC	ASH1, HASH1, MASH1	go_component: nucleus; go_function: transcription factor activity; go_process: cell differentiation; go_process: nervous system development; go_process: regulation of transcription; go_process: regulation of transcription from RNA polymerase II promoter	achaete-scute complex homolog-like 1
ASCL2_E76_R	3019	0.2199306	1055.575	325.7996	0.5677729	24	43.77126	0.2761468	3755.438	1470.832	0.005320699	22	298.5872	0.2748039	4229.725	1640.694	0.0009068621	35	142.7282	0.244394	406.4907	163.8199	0.7731345	20	27.75618	0.2673796	4133.197	1544.961	0.001333054	24	226.9154	0.2636825	4106.416	1506.359	0.0006653715	27	202.6484	0.2672835	3888.012	1454.765	0.01120876	34	280.0382	0.2825878	4030.797	1627.116	0.02523321	27	220.6372	0.2538129	3034.271	1066.111	0.0416792	38	275.8258	0.2487178	3931.472	1334.65	0.003935986	28	228.4087	ASCL2	ASCL2_E76_R	42716308	NM_005170.2	ASCL2	430	11	36.1	2248682	76	Y	GGTGCTTAGTGCGCCCCCAAAGCAAGGTACGCAGGTCCTGGGTTGAGCCTTC	ASH2, HASH2, MASH2	mammalian achaete/scute homologue 2; go_component: nucleus; go_function: transcription factor activity; go_process: cell differentiation; go_process: central nervous system development; go_process: peripheral nervous system development; go_process: regulation of transcription, DNA-dependent	achaete-scute complex homolog-like 2
ASCL2_P360_F	103	0.07342134	5789.536	466.6821	1.455303E-05	26	252.4386	0.2156171	10951.84	3038.014	1.36625E-19	32	707.0866	0.2527866	10461.07	3572.87	1.479345E-21	21	512.4227	0.3202299	1678.058	837.6174	0.2992063	30	125.8567	0.2938888	9067.385	3815.534	8.165087E-18	16	361.9947	0.2406321	12020.56	3840.822	8.896678E-32	21	817.4203	0.2313194	12551.63	3807.26	4.43949E-23	28	767.7855	0.2617068	11936.34	4266.587	1.006413E-15	32	496.1535	0.2591185	8268.049	2926.671	2.002301E-13	44	521.4529	0.2229566	11300.32	3271.087	9.290046E-23	34	451.419	ASCL2	ASCL2_P360_F	42716308	NM_005170.2	ASCL2	430	11	36.1	2249118	-360	Y	CCTAGCGCAGCTATGTCCCGAGCGCGCCCCCACCTGTGCGTTAATCTACTGG	ASH2, HASH2, MASH2	mammalian achaete/scute homologue 2; go_component: nucleus; go_function: transcription factor activity; go_process: cell differentiation; go_process: central nervous system development; go_process: peripheral nervous system development; go_process: regulation of transcription, DNA-dependent	achaete-scute complex homolog-like 2
ASCL2_P609_R	105	0.1535607	6769.727	1246.303	4.442215E-09	21	484.4587	0.3534652	9048.021	5001.289	9.185627E-20	32	1070.096	0.5596687	7208.14	9288.77	2.677554E-30	33	556.7459	0.3720585	933.3376	612.2577	0.5436192	33	64.95454	0.4069813	9100.989	6314.524	6.931718E-26	26	874.9305	0.6197998	5222.104	8676.059	4.564436E-24	24	1351.293	0.3038927	12442.65	5475.621	6.340017E-28	23	1158.425	0.3804713	12839.7	7946.663	2.782168E-26	30	603.9556	0.3989791	5537.874	3742.622	4.079384E-09	35	758.9927	0.345132	9455.148	5035.805	1.696245E-22	31	801.2115	ASCL2	ASCL2_P609_R	42716308	NM_005170.2	ASCL2	430	11	36.1	2249367	-609	Y	GGGCCTGGAGGTCTGCACCCGACCGCCTTGTGCCAGGACGGTCAGGT	ASH2, HASH2, MASH2	mammalian achaete/scute homologue 2; go_component: nucleus; go_function: transcription factor activity; go_process: cell differentiation; go_process: central nervous system development; go_process: peripheral nervous system development; go_process: regulation of transcription, DNA-dependent	achaete-scute complex homolog-like 2
ATP10A_P147_F	109	0.1118195	5057.564	649.3235	0.0001120849	36	190.3434	0.2748777	9332.248	3575.555	1.352473E-16	32	875.7345	0.1927103	13743.27	3304.566	1.803451E-32	30	670.8929	0.04512781	4410.956	213.1904	0.0280953	29	207.7783	0.2124829	12047.37	3277.528	1.437072E-25	25	586.6075	0.2931518	11062.85	4629.578	4.542789E-31	42	529.0575	0.2188042	10597.92	2996.366	1.080784E-15	29	860.9801	0.2202109	13620.55	3874.656	2.088798E-18	28	633.9662	0.2237299	7955.692	2321.742	3.049512E-11	25	627.6193	0.1958586	11554.01	2838.48	3.525936E-22	35	575.2965	ATP10A	ATP10A_P147_F	21361906	NM_024490.2	ATP10A	57194	15	36.1	23660110	-147	Y	CCACTTTCAGATTCCGTTGTTGGGCGAACTAGACCGTTTCCTTTCCACC	ATPVA, ATPVC, ATP10C, KIAA0566	ATPase, Class V, type 10C; ATPase type IV, phospholipid transporting (P-type); aminophospholipid translocase VA; phospholipid-transporting ATPase VA; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: ATPase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: magnesium ion binding; go_function: phospholipid-translocating ATPase activity; go_process: cation transport; go_process: regulation of cell shape	ATPase, Class V, type 10A
ATP10A_P524_R	110	0.2768252	1030.2	432.6311	0.5390339	17	85.02957	0.6792124	2086.96	4630.511	0.0001323031	16	277.5185	0.759922	1750.079	5856.082	3.939507E-06	28	229.2424	0.2065134	1643.867	453.8599	0.4003015	26	130.2702	0.7002185	1967.708	4829.675	5.658666E-05	31	213.7509	0.6661016	2170.981	4530.433	1.992702E-05	35	480.6215	0.7828977	1535.427	5897.55	0.0001018906	28	304.3597	0.7717471	1725.501	6172.213	0.0006246781	26	306.0446	0.5710971	2470.661	3422.912	0.0008800337	28	301.1722	0.7458588	1576.491	4920.2	0.0001618577	28	282.225	ATP10A	ATP10A_P524_R	21361906	NM_024490.2	ATP10A	57194	15	36.1	23660487	-524	Y	AGAAGGGGTGGGAGAATAAGCACGGCATGGAAAAAGGAGCTGG	ATPVA, ATPVC, ATP10C, KIAA0566	ATPase, Class V, type 10C; ATPase type IV, phospholipid transporting (P-type); aminophospholipid translocase VA; phospholipid-transporting ATPase VA; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: ATPase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: magnesium ion binding; go_function: phospholipid-translocating ATPase activity; go_process: cation transport; go_process: regulation of cell shape	ATPase, Class V, type 10A
AXIN1_P995_R	4229	0.06429547	2039.923	147.0415	0.2917264	19	94.10654	0.7813481	1027.764	4030.043	0.007534274	24	261.1069	0.7244279	1332.035	3764.553	0.005908655	30	195.508	0.4820647	892.6247	923.8787	0.4728438	30	75.966	0.7172846	980.6199	2741.669	0.06594245	29	143.2593	0.7003646	993.9734	2557.043	0.06598321	33	154.7141	0.688142	1028.25	2489.582	0.1506392	38	125.1096	0.6435103	1557.184	2991.433	0.09236951	23	218.9375	0.7035413	1150.6	2967.865	0.04043968	31	179.8726	0.5689805	1207.028	1725.382	0.1898417	29	77.37849	AXIN1	AXIN1_P995_R	31083149	NM_003502.2	AXIN1	8312	16	36.1	343460	-995	Y	GGGGACCGCCACGGCCTGCCCGCCGCCGTGAGGGAAGCAGGCTCCCA	AXIN, MGC52315	isoform a is encoded by transcript variant 1; axis inhibitor 1; fused, mouse, homolog of; axis inhibition protein 1; go_component: cytoplasm; go_component: nucleus; go_component: intracellular; go_component: lateral plasma membrane; go_function: protein binding; go_function: signal transducer activity; go_function: signal transducer activity; go_process: apoptosis; go_process: cell cycle; go_process: development; go_process: frizzled signaling pathway; go_process: oocyte axis determination; go_process: negative regulation of progression through cell cycle	axin 1 isoform a
AXL_E61_F	1482	0.03130899	7610.084	249.197	1.006461E-08	26	325.9787	0.3025294	6329.107	2788.64	3.196072E-08	32	490.449	0.2324349	8587.349	2630.712	1.722853E-13	25	668.4435	0.02341703	6998.818	170.2192	0.0001727224	31	284.2385	0.4313519	5323.389	4113.948	2.041809E-09	35	390.1259	0.4269319	3916.136	2991.995	9.385322E-06	26	413.1183	0.1866516	6363.805	1483.349	3.196325E-05	22	371.0145	0.1862248	7597.154	1761.422	2.490436E-05	24	368.0948	0.2535026	6040.576	2085.274	5.688933E-07	17	349.806	0.150799	7284.522	1311.325	1.020965E-07	30	293.84	AXL	AXL_E61_F	21536465	NM_021913.2	AXL	558	19	36.1	46416724	61	N	ACAGAGCCCAGAGGGACAGCGCCCAGAGCCCGGATAGAGAGACACGGCCTCACTGG	UFO	isoform 1 is encoded by transcript variant 1; oncogene AXL; AXL transforming sequence/gene; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	AXL receptor tyrosine kinase isoform 1
AXL_P223_R	5413	0.1479989	1131.71	213.9571	0.5802678	25	54.1992	0.561614	5055.246	6604.359	1.786548E-13	32	617.7966	0.530323	5783.383	6643.062	1.062069E-16	34	776.7776	0.8088866	322.5709	1788.529	0.3969159	29	74.23216	0.7765042	2483.728	8976.79	5.47482E-14	22	655.2272	0.6519649	4205.937	8066.198	1.545573E-18	26	704.9164	0.5535032	5048.888	6382.859	5.535681E-11	31	624.3026	0.666189	4467.491	9115.373	5.453863E-11	21	818.5298	0.7294611	2679.532	7494.523	5.207264E-11	37	546.4975	0.706365	4175.285	10284.58	2.138437E-22	15	433.1394	AXL	AXL_P223_R	21536465	NM_021913.2	AXL	558	19	36.1	46416440	-223	Y	GCCAGTAGCATGCCCCTGCCCGTCTGGGTCCCTCTGCGTGTCTCTGCTTGTC	UFO	isoform 1 is encoded by transcript variant 1; oncogene AXL; AXL transforming sequence/gene; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	AXL receptor tyrosine kinase isoform 1
B3GALT5_E246_R	2833	0.377369	1541.136	994.6721	0.1949719	24	141.0064	0.7897283	2267.281	8890.922	2.540963E-12	23	694.9902	0.7926224	2367.103	9429.567	5.57473E-15	33	510.7099	0.5275863	506.3391	677.1528	0.6357216	29	62.07935	0.7744628	2228.236	7994.83	4.525156E-11	24	497.2487	0.7793178	2283.837	8418.292	6.230959E-14	27	648.7942	0.8076161	2308.065	10108.91	5.17024E-13	35	553.7383	0.8176897	2469.27	11523.57	1.143277E-11	22	539.7355	0.7688226	2096.181	7303.801	2.339979E-09	33	423.6142	0.7889403	2201.904	8604.508	2.990029E-12	25	537.4747	B3GALT5	B3GALT5_E246_R	15451880	NM_033170.1	B3GALT5	10317	21	36.1	39951370	246	N	CACACTCCTGGCATCCCAGCGTCTCCAGCTTGCATGGCCTGTCACGGTATT	B3T5, GLCT5, B3GalTx, B3GalT-V, beta3Gal-T5	homolog of C. elegans Bt toxin resistance gene bre-5; GlcNAc-beta-1,3-galactosyltransferase 5; go_component: membrane; go_component: Golgi stack; go_component: integral to membrane; go_function: galactosyltransferase activity; go_function: transferase activity, transferring glycosyl groups; go_function: UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity; go_process: protein amino acid glycosylation	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 5
B3GALT5_P330_F	1844	0.4847345	2527.154	2471.488	0.001114168	23	210.9361	0.9197068	1044.438	13108.81	4.568156E-20	29	852.796	0.9387152	1058.407	17743.62	3.678E-38	31	697.1776	0.4594675	826.1718	787.2715	0.5259356	30	71.26865	0.9289085	933.8803	13509.07	1.352896E-22	21	1022.82	0.9070128	1492.217	15530.76	7.139987E-37	23	1072.715	0.9373993	942.4014	15609.21	1.188733E-23	27	1314.607	0.9456964	1022.468	19547.74	1.017822E-25	23	1056.161	0.9117891	1029.704	11677.14	1.690438E-17	29	811.9828	0.947964	948.0921	19093.58	3.678E-38	27	1136.277	B3GALT5	B3GALT5_P330_F	15451880	NM_033170.1	B3GALT5	10317	21	36.1	39950794	-330	N	GGGGGCAGTGACCTAGGCAGAGGGCGGGAGCCAGCAGATGGGATACACTCAG	B3T5, GLCT5, B3GalTx, B3GalT-V, beta3Gal-T5	homolog of C. elegans Bt toxin resistance gene bre-5; GlcNAc-beta-1,3-galactosyltransferase 5; go_component: membrane; go_component: Golgi stack; go_component: integral to membrane; go_function: galactosyltransferase activity; go_function: transferase activity, transferring glycosyl groups; go_function: UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity; go_process: protein amino acid glycosylation	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 5
BAX_E281_R	3031	0.1833645	3399.99	785.8757	0.009836386	26	149.2943	0.5724381	5087.928	6945.82	2.259984E-14	30	908.7025	0.5644451	6984.273	9180.663	4.990222E-29	30	791.4237	0.3046247	3469.913	1563.88	0.01469456	30	244.704	0.4703985	6062.52	5473.624	3.529264E-14	29	660.5539	0.6626026	5224.547	10456.69	5.057487E-31	26	1232.719	0.6401964	5940.736	10748.24	4.598436E-24	21	513.1802	0.625276	7542.83	12753.06	5.166365E-25	25	848.4702	0.6475793	4081.623	7683.805	6.819206E-15	32	801.5187	0.5096428	7957.341	8374.232	6.962841E-29	21	544.7759	BAX	BAX_E281_R	34335125	NM_138765.2	BAX	581	19	36.1	54150210	281	Y	AGGTTCCTGGCTCTCTGATCCCCGTGTCCCGATCCCTGCCTCTCTGGC	Bax zeta	isoform sigma is encoded by transcript variant sigma; apoptosis regulator BAX; go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_process: apoptosis; go_process: cell cycle; go_process: regulation of apoptosis; go_process: germ cell development; go_process: induction of apoptosis; go_process: apoptotic mitochondrial changes; go_process: induction of apoptosis by extracellular signals; go_process: negative regulation of progression through cell cycle; go_process: negative regulation of survival gene product activity	BCL2-associated X protein isoform sigma
BCAM_E100_R	3038	0.01085071	28163.9	310.0476	3.678E-38	24	1001.141	0.03329473	12140.75	421.589	1.073373E-15	18	691.0551	0.02911865	13554.36	409.5211	2.487035E-21	25	786.5003	0.01390111	18845.3	267.0734	1.874733E-30	46	1410.164	0.03909516	10669.71	438.1739	4.061086E-13	22	873.2354	0.03167666	12852.42	423.7111	7.349325E-22	30	694.9407	0.0438688	12219.14	565.2215	8.073175E-14	28	796.9609	0.035601	15701.64	583.3209	6.907433E-16	21	703.8231	0.05199872	8464.12	469.7496	1.950465E-08	18	1055.152	0.03565814	11857.42	442.1455	5.374386E-16	22	676.4874	BCAM	BCAM_E100_R	61742796	NM_001013257.1	BCAM	4059	19	36.1	50004278	100	Y	GGGGCCCCGCGGCTGCTGTTGCTCGCAGTCCTGCTGGCGGCGCACCCAGG	AU, LU, CD239, MSK19	isoform 2 precursor is encoded by transcript variant 2; B-CAM cell surface glycoprotein; Auberger b antigen; F8/G253 antigen; antigen identified by monoclonal antibody F8; glycoprotein 95kDa; B-cell adhesion molecule; Lutheran blood group (Auberger b antigen included); basal cell adhesion molecule (Lu and Au blood groups); go_component: cell surface; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: transmembrane receptor activity; go_process: cell adhesion; go_process: signal transduction	basal cell adhesion molecule isoform 2 precursor
BCAM_P205_F	140	0.7849635	2544.155	9652.151	1.262506E-21	33	521.075	0.1282625	10943.22	1624.837	1.037673E-15	27	624.0367	0.1102422	14134.37	1763.657	4.996928E-28	41	751.8847	0.72741	2020.736	5659.211	4.545696E-05	35	407.0676	0.1240942	11202.8	1601.328	1.371447E-17	28	582.4778	0.1691486	9730.707	2001.381	7.152514E-17	35	603.1645	0.1738935	10869.03	2308.956	1.03044E-14	23	528.8547	0.1978029	10117.5	2519.396	1.6393E-09	37	441.3651	0.1146807	9082.334	1189.443	3.140642E-11	31	528.8633	0.1576994	9434.607	1785.113	3.12099E-13	28	457.6746	BCAM	BCAM_P205_F	61742796	NM_001013257.1	BCAM	4059	19	36.1	50003973	-205	Y	GGCTACGCTGGTCGATCAGGCCCCCCGCTGCAGGCGCTGGTCAGTAAGCCC	AU, LU, CD239, MSK19	isoform 2 precursor is encoded by transcript variant 2; B-CAM cell surface glycoprotein; Auberger b antigen; F8/G253 antigen; antigen identified by monoclonal antibody F8; glycoprotein 95kDa; B-cell adhesion molecule; Lutheran blood group (Auberger b antigen included); basal cell adhesion molecule (Lu and Au blood groups); go_component: cell surface; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: transmembrane receptor activity; go_process: cell adhesion; go_process: signal transduction	basal cell adhesion molecule isoform 2 precursor
BCAP31_P1072_F	153	0.6016834	725.5495	1247.047	0.3605434	28	82.16084	0.9423376	546.7123	10568.77	3.166444E-12	27	636.7493	0.9602702	558.1863	15908.4	3.507399E-30	28	787.1042	0.4038753	320.7302	285.0453	0.7660651	28	18.16121	0.9624899	507.9464	15599.6	2.261061E-28	34	764.3423	0.9589447	505.064	14132.71	7.720131E-27	21	825.3604	0.9564654	555.1246	14393.25	4.054345E-19	31	1132.496	0.9656563	658.5259	21327.81	1.583034E-29	27	727.7584	0.9397176	537.6585	9940.2	1.061355E-11	37	737.2068	0.9631062	516.9771	16106.09	5.669941E-30	28	664.9772	BCAP31	BCAP31_P1072_F	49472837	NM_005745.6	BCAP31	10134	X	36.1	152644153	.	Y	CCTGCAGCGGCTCCTGTGGCTCCTGCGGCTGCTGTTCCCCCGGGTCCTGTGCC	CDM, BAP31, 6C6-AG, DXS1357E	accessory protein BAP31; go_component: endoplasmic reticulum; go_component: integral to plasma membrane; go_function: receptor binding; go_process: apoptosis; go_process: immune response; go_process: ER to Golgi transport; go_process: intracellular protein transport	B-cell receptor-associated protein 31
BCAP31_P1131_F	152	0.3208091	2832.507	1385.141	0.009115337	29	190.007	0.9639947	525.5513	16748.32	2.443889E-30	25	917.0254	0.968892	466.8832	17656.22	6.162478E-37	25	1010.802	0.669403	800.9769	1824.326	0.2747248	27	115.5232	0.9707012	385.5616	16087.18	9.849504E-30	36	1510.793	0.9714829	499.6866	20429.31	3.678E-38	27	624.2604	0.9720981	479.6387	20194.55	1.091445E-37	29	1301.029	0.977874	492.179	26171.77	3.678E-38	33	839.6262	0.9514664	485.9864	11487.86	1.890946E-15	23	1044.781	0.9751372	453.3779	21703.85	3.678E-38	22	851.7964	BCAP31	BCAP31_P1131_F	49472837	NM_005745.6	BCAP31	10134	X	36.1	152644212	.	Y	GGGGCTGCTGGCCCTGCACTCGGCCGCCTTGGTGAGCCGCACCTTCCTGTCGG	CDM, BAP31, 6C6-AG, DXS1357E	accessory protein BAP31; go_component: endoplasmic reticulum; go_component: integral to plasma membrane; go_function: receptor binding; go_process: apoptosis; go_process: immune response; go_process: ER to Golgi transport; go_process: intracellular protein transport	B-cell receptor-associated protein 31
BCL2A1_E425_F	111	0.1479446	2148.682	390.4443	0.1941564	29	94.97688	0.185926	6679.211	1548.301	9.931102E-07	27	568.524	0.2719279	7305.545	2765.9	8.593398E-11	23	477.6689	0.1374839	2911.448	480.0206	0.1354299	26	184.1831	0.2349267	6920.102	2155.623	1.046979E-08	34	295.3964	0.2109397	6819.946	1849.911	4.910922E-09	23	388.9819	0.2949183	4561.315	1949.713	0.001024327	23	737.0778	0.2838335	6591.497	2651.997	3.286893E-05	33	421.3128	0.261408	4846.736	1750.786	0.000118386	29	478.7549	0.2268031	8405.143	2494.827	1.80813E-12	27	462.7085	BCL2A1	BCL2A1_E425_F	14574570	NM_004049.2	BCL2A1	597	15	36.1	78050273	425	N	AATTCTTCCCCAGTTAATGATGCCGTCTTCAAACTCCTTTTCCATCACT	GRS, BFL1, HBPA1, BCL2L5	hematopoietic BCL2-related protein A1; go_component: intracellular; go_process: anti-apoptosis; go_process: regulation of apoptosis	BCL2-related protein A1
BCL2A1_P1127_R	3039	0.3798251	4819.83	3013.143	1.152397E-08	32	206.942	0.9699237	464.384	18200.7	1.207773E-35	34	1362.334	0.9721044	610.7023	24766.53	3.678E-38	27	1636.95	0.07480189	4575.946	378.0484	0.0167562	42	185.9249	0.9674776	569.6421	19920.54	3.678E-38	28	915.6259	0.9619446	700.3113	20229.89	3.678E-38	29	1378.487	0.9674301	562.8115	19687.63	4.35753E-36	27	1900.374	0.9729705	641.1956	26680.55	3.678E-38	22	1263.721	0.9444957	675.0023	13187.93	5.164381E-21	30	750.6406	0.9797607	482.8394	28214.55	3.678E-38	33	924.1986	BCL2A1	BCL2A1_P1127_R	14574570	NM_004049.2	BCL2A1	597	15	36.1	78051825	-1127	Y	TGGGTGGCAGAGAACAGGGCCTCTCGAGGTGACTCTGGCAGTACCGCCC	GRS, BFL1, HBPA1, BCL2L5	hematopoietic BCL2-related protein A1; go_component: intracellular; go_process: anti-apoptosis; go_process: regulation of apoptosis	BCL2-related protein A1
BCL2L2_E172_F	5384	0.08191453	2808.677	259.5215	0.09095118	26	112.4626	0.1431495	3512.1	603.4546	0.0409493	23	129.1356	0.07699277	4242.795	362.2549	0.01636388	23	191.5877	0.180612	590.6104	152.2265	0.73763	35	28.33755	0.08957936	4084.073	411.6851	0.01791871	31	204.6024	0.2354959	4030.898	1272.472	0.0015698	16	159.002	0.1186697	4544.727	625.4051	0.01519345	37	143.1423	0.1458264	4567.271	796.8066	0.03679168	31	185.1729	0.1960523	3875.433	969.4572	0.0104074	28	236.9058	0.1329588	3268.786	516.5956	0.06316736	31	102.759	BCL2L2	BCL2L2_E172_F	14574571	NM_004050.2	BCL2L2	599	14	36.1	22846038	172	N	TTGGGCTGCACTAGGGGGAACCGGGAATAGAGATGGTGTCGG	BCLW, BCL-W, KIAA0271	apoptosis regulator BCL-W; go_component: membrane; go_component: mitochondrion; go_function: protein binding; go_process: anti-apoptosis; go_process: spermatogenesis; go_process: regulation of apoptosis	BCL2-like 2 protein
BCL2L2_P280_F	4235	0.1040148	2169.553	263.4721	0.2212502	21	61.6754	0.387202	4229.304	2735.51	6.432024E-05	25	283.5634	0.3090447	4851.081	2214.478	2.580397E-05	32	277.7372	0.1194006	1247.199	182.6668	0.5735652	28	69.24849	0.3749794	4268.94	2621.134	4.222591E-05	31	236.8028	0.4738124	3539.663	3277.381	1.312277E-05	27	346.3577	0.2655501	4774.323	1762.376	0.0009654403	26	282.4634	0.2964905	5067.345	2177.751	0.002138793	28	166.4431	0.3198363	3820.905	1843.744	0.001590319	31	353.1654	0.290712	5032.585	2103.664	2.222629E-05	26	199.5551	BCL2L2	BCL2L2_P280_F	14574571	NM_004050.2	BCL2L2	599	14	36.1	22845586	-280	N	CTGGAAAAGTTCAACAAGTGCATGGAACATCGGAAACCTCCTGAAAATGCTAAATT	BCLW, BCL-W, KIAA0271	apoptosis regulator BCL-W; go_component: membrane; go_component: mitochondrion; go_function: protein binding; go_process: anti-apoptosis; go_process: spermatogenesis; go_process: regulation of apoptosis	BCL2-like 2 protein
BCL3_E71_F	1549	0.6528606	2736.148	5333.908	3.336251E-09	30	310.5635	0.1120769	8956.824	1143.185	4.462118E-10	29	537.4407	0.08260714	11930.13	1083.26	2.141301E-18	27	508.785	0.1277666	7762.227	1151.676	1.163061E-06	15	760.4803	0.130523	10633.23	1611.236	4.92259E-16	30	365.4065	0.1573289	9846.014	1856.947	8.746982E-17	29	608.0519	0.1429822	10898.11	1834.891	1.050525E-13	41	412.3758	0.1492644	13123.33	2320.077	2.966172E-14	38	589.1309	0.151555	8802.619	1590.246	1.665349E-11	31	478.9098	0.0908216	9572.122	966.1884	1.22932E-11	26	472.7331	BCL3	BCL3_E71_F	20336471	NM_005178.2	BCL3	602	19	36.1	49943942	71	Y	GGGGCCCGTGGACCTGCGCACCCGGCCCAAGGCCGCCGGACTCC	BCL4, D19S37	B-cell lymphoma 3-encoded protein; B-cell leukemia/lymphoma 3; chronic lymphatic leukemia protein; go_component: nucleus; go_process: transcription; go_process: cytoplasmic sequestering of NF-kappaB; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle	B-cell CLL/lymphoma 3
BCL3_P1038_R	5500	0.03651086	7803.131	299.4846	2.804444E-09	33	291.1435	0.03833017	12833.47	515.5016	8.756747E-18	27	988.2052	0.03896081	15211.67	620.7396	8.746788E-28	31	900.8123	0.03889617	5611.119	231.1308	0.003379832	32	331.9371	0.0400231	12708.89	534.0248	7.295664E-19	30	1262.563	0.04186525	12543.88	552.4682	3.040678E-21	22	964.0302	0.05136754	13411.56	731.6379	4.890725E-17	36	595.6726	0.04222408	18453.48	817.9404	1.802269E-22	18	922.4335	0.06255372	9948.953	670.5444	4.96232E-12	35	592.1383	0.04686513	16153.45	799.1736	3.13711E-31	30	621.2974	BCL3	BCL3_P1038_R	20336471	NM_005178.2	BCL3	602	19	36.1	49942833	-1038	Y	CGCTCCTGCAGCACCGGCCTCGGTCGCGCTGACTCTGGCCTGGTGTCCGTGT	BCL4, D19S37	B-cell lymphoma 3-encoded protein; B-cell leukemia/lymphoma 3; chronic lymphatic leukemia protein; go_component: nucleus; go_process: transcription; go_process: cytoplasmic sequestering of NF-kappaB; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle	B-cell CLL/lymphoma 3
BCL6_P248_R	2296	0.03663604	4492.635	174.6546	0.002870366	21	205.444	0.1892688	7163.509	1695.698	9.046592E-08	28	265.8222	0.2441805	7508.985	2458.213	1.454434E-10	29	409.9602	0.3740456	3253.725	2004.053	0.0100325	28	159.5723	0.1898805	6540.054	1556.335	6.031186E-07	29	270.6174	0.1880546	7101.194	1667.868	3.019183E-09	26	434.4858	0.1857001	7063.385	1633.601	2.329349E-06	18	427.6514	0.2382129	7039.157	2232.434	3.072736E-05	32	238.0084	0.1865086	7018.814	1632.125	6.637819E-08	30	235.7416	0.2156957	7295.646	2033.916	4.341054E-09	40	295.9911	BCL6	BCL6_P248_R	21040335	NM_138931.1	BCL6	604	3	36.1	188946417	-248	Y	AGCAGATCGAGCTAAATGCACAAAAGGGAGCGAGAGGTTTGAACCACTGGGA	BCL5, LAZ3, BCL6A, ZNF51, ZBTB27	B-cell CLL/lymphoma-6; lymphoma-associated zinc finger gene on chromosome 3; zinc finger protein 51; cys-his2 zinc finger transcription factor; go_component: nucleus; go_component: mediator complex; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transcription factor activity; go_process: transcription; go_process: inflammatory response; go_process: positive regulation of cell proliferation; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	B-cell lymphoma 6 protein
BCR_P346_F	2298	0.4133625	1492.372	1122.033	0.1762182	25	152.2556	0.9193029	1191.593	14713.85	1.477931E-25	23	1110.432	0.9246721	1476.207	19348.4	3.678E-38	35	825.0862	0.7563394	407.2886	1574.659	0.4298988	32	90.90997	0.9250669	998.2228	13557.82	5.766115E-23	38	918.1857	0.9279947	969.5493	13784.2	2.744388E-27	33	854.1599	0.8872724	1775.878	14764.92	1.280481E-23	35	737.4317	0.9204423	1748.885	21390.64	7.811461E-33	25	893.6159	0.9082851	976.7483	10663.41	1.455882E-14	29	1028.633	0.886349	1378.889	11533.66	1.077503E-17	20	854.9273	BCR	BCR_P346_F	11038640	NM_021574.1	BCR	613	22	36.1	21852206	-346	Y	CTCTGACACGACGACTGGGCAGTGCCGGTGACGCTTATGGCACTGCGG	ALL, CML, PHL, BCR1, D22S11, D22S662	isoform 2 is encoded by transcript variant 2; breakpoint cluster region protein; go_component: cellular component unknown; go_function: kinase activity; go_function: transferase activity; go_function: GTPase activator activity; go_function: GTPase activator activity; go_function: protein serine/threonine kinase activity; go_function: guanyl-nucleotide exchange factor activity; go_function: protein serine/threonine kinase activity; go_process: intracellular signaling cascade; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	breakpoint cluster region isoform 2
BCR_P422_F	2304	0.2766165	1123.453	467.8394	0.493353	33	49.99504	0.90921	880.5344	9819.488	2.560099E-11	15	327.0626	0.9191818	993.83	12440.61	1.146615E-19	32	473.898	0.4416606	413.7141	406.3609	0.7208599	32	26.29659	0.9024169	989.7538	10077.7	5.086787E-13	18	693.5237	0.8885653	849.722	7572.955	1.604089E-08	23	581.5844	0.8443257	1373.262	7990.484	2.376557E-07	26	456.9269	0.9022585	1189.767	11905.93	3.259268E-10	31	358.025	0.8994176	809.8801	8136.237	1.847785E-08	22	612.2371	0.8540244	840.638	5503.165	0.0002516402	29	198.4434	BCR	BCR_P422_F	11038640	NM_021574.1	BCR	613	22	36.1	21852130	-422	Y	TGCGTCTCCATGGAAGGTGCCCTCCGCATCGTTGGGCCAGATCTGCCTG	ALL, CML, PHL, BCR1, D22S11, D22S662	isoform 2 is encoded by transcript variant 2; breakpoint cluster region protein; go_component: cellular component unknown; go_function: kinase activity; go_function: transferase activity; go_function: GTPase activator activity; go_function: GTPase activator activity; go_function: protein serine/threonine kinase activity; go_function: guanyl-nucleotide exchange factor activity; go_function: protein serine/threonine kinase activity; go_process: intracellular signaling cascade; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	breakpoint cluster region isoform 2
BDNF_E19_R	2840	0.1806975	3149.671	716.7161	0.02031085	24	186.5611	0.182015	9671.286	2174.27	6.453051E-14	27	646.9778	0.1841775	9608.33	2191.722	5.460875E-15	26	563.1942	0.04111154	4094.045	179.8161	0.04649673	32	178.9623	0.1821065	8330.354	1877.044	4.899148E-11	37	677.7138	0.2084658	9914.819	2637.595	1.955066E-19	26	745.6166	0.2110048	9118.183	2465.263	2.775009E-11	35	518.7177	0.1968432	10712.68	2650.046	1.234714E-10	25	669.0027	0.2182564	7060.978	1999.286	1.111508E-08	20	452.5278	0.1729588	11095.23	2341.254	3.21385E-19	26	704.6115	BDNF	BDNF_E19_R	34106708	NM_170733.2	BDNF	627	11	36.1	27699853	19	Y	TGAGTTCTTACGTGATTCTAATGAATGAGCGAGGTTACCAATGATTGCCCAACTGCC	MGC34632	isoform a preproprotein is encoded by transcript variant 5; neurotrophin; brain-derived neurotrophic factor preproprotein isoform 2; go_function: growth factor activity; go_function: growth factor activity; go_process: nervous system development	brain-derived neurotrophic factor isoform a preproprotein
BDNF_P259_R	1862	0.6372942	800.8191	1582.789	0.2345732	29	81.10983	0.5528411	3650.063	4636.359	8.012486E-07	27	377.7277	0.4966335	4033.726	4078.433	5.817526E-07	40	302.2534	0.4209546	417.5091	376.2189	0.7266386	28	28.86722	0.5260802	3363.008	3844.152	1.495962E-05	32	293.3361	0.6084865	3982.247	6344.587	6.152229E-13	34	393.9616	0.4845253	3909.212	3768.497	5.183722E-05	27	335.9812	0.494202	4827.401	4814.436	1.236288E-05	23	388.007	0.5437505	2910.87	3588.305	0.0001593673	29	402.1124	0.4606677	4308.159	3765.204	8.041955E-07	35	333.8218	BDNF	BDNF_P259_R	34106708	NM_170733.2	BDNF	627	11	36.1	27700131	-259	Y	TGTCAGGCTAGGGCGGGAAGACCGCTGGGGAACTTGTTGCTT	MGC34632	isoform a preproprotein is encoded by transcript variant 5; neurotrophin; brain-derived neurotrophic factor preproprotein isoform 2; go_function: growth factor activity; go_function: growth factor activity; go_process: nervous system development	brain-derived neurotrophic factor isoform a preproprotein
BGN_E282_R	2432	0.212772	1226.467	358.5175	0.4955992	21	42.34497	0.3132428	3385.479	1589.792	0.008889124	27	168.7542	0.3805835	4500.876	2826.882	1.059166E-05	32	335.7983	0.3526009	385.8835	264.6327	0.7569752	39	23.18408	0.7680596	1922.121	6696.158	7.441749E-08	29	753.2987	0.7964901	2327.904	9502.246	3.617368E-17	33	774.3704	0.776083	2362.516	8534.936	5.794169E-10	39	545.804	0.7962523	2828.219	11443.57	3.830894E-12	22	684.4688	0.7787437	1945.846	7200.653	7.532493E-09	23	875.5255	0.7840684	2350.095	8896.529	2.684991E-13	26	551.9181	BGN	BGN_E282_R	34304351	NM_001711.3	BGN	633	X	36.1	152413887	282	Y	GGGTGTCCACAGATTTCCCCGGTGCTCTCTGTAGGCTGCTGATCCACGCCC	PGI, DSPG1, PG-S1, SLRR1A	small leucine-rich protein 1A; bone/cartilage proteoglycan-I; dermatan sulphate proteoglycan I; go_component: extracellular matrix (sensu Metazoa); go_function: extracellular matrix structural constituent; go_process: biological process unknown	biglycan preproprotein
BGN_P333_R	1868	0.2199459	1336.693	405.0934	0.4399917	24	82.49666	0.7839203	1283.727	5020.054	0.0004123604	31	416.5382	0.8438684	1306.272	7600.694	2.132354E-08	26	416.3452	0.6081514	361.0509	715.5536	0.6617154	23	42.00919	0.7975742	1728.126	7202.963	1.97165E-08	32	710.8863	0.7458301	2617.131	7973.084	1.24566E-13	17	1010.667	0.7793426	2277.269	8396.303	1.490904E-09	31	475.3	0.8047047	2913.04	12415.08	4.87865E-14	21	606.046	0.790712	1551.903	6241.063	2.0427E-06	37	450.0901	0.8653714	1354.181	9347.247	5.226607E-12	23	787.3632	BGN	BGN_P333_R	34304351	NM_001711.3	BGN	633	X	36.1	152413272	-333	N	CCATCTCTCTTTCCTCTGCCTGGCGAGATGCCAGCCAGCACCTCAGTGTC	PGI, DSPG1, PG-S1, SLRR1A	small leucine-rich protein 1A; bone/cartilage proteoglycan-I; dermatan sulphate proteoglycan I; go_component: extracellular matrix (sensu Metazoa); go_function: extracellular matrix structural constituent; go_process: biological process unknown	biglycan preproprotein
BIRC4_P122_R	4238	0.08586978	3081.241	298.8332	0.05334017	35	126.0708	0.1011259	9452.302	1074.661	5.952643E-11	27	487.2103	0.09289335	10612.19	1096.995	9.485556E-15	27	525.461	0.1909391	4970.695	1196.689	0.001740664	30	182.0554	0.8129911	2786.89	12550.29	1.302248E-25	28	1778.095	0.8155689	3543.367	16111.26	3.678E-38	25	962.0641	0.7989839	3788.143	15454.3	2.005575E-32	28	1132.275	0.7901908	5046.924	19384.53	9.303793E-37	22	903.2339	0.8103085	2696.743	11946.9	1.388436E-23	28	1278.141	0.8220807	4420.536	20887.25	3.678E-38	28	1183.109	BIRC4	BIRC4_P122_R	32528298	NM_001167.2	BIRC4	331	X	36.1	122821607	-122	Y	GAGGCCCTGACGTGGACACACTTCGGGTTTCACGACTCCGGGTTTCTCC	API3, ILP1, MIHA, XIAP	X-linked inhibitor of apoptosis; apoptosis inhibitor 3; go_component: cytosol; go_component: intracellular; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: caspase inhibitor activity; go_function: cysteine protease inhibitor activity; go_process: apoptosis; go_process: anti-apoptosis; go_process: anti-apoptosis	baculoviral IAP repeat-containing protein 4
BIRC4_P500_F	4239	0.0380986	8363.657	335.2251	1.008304E-10	24	357.1221	0.08668244	7654.463	735.9716	5.460694E-07	40	444.4919	0.0695936	9711.773	733.9122	1.232453E-11	34	419.9618	0.03480123	6783.275	248.1835	0.0002429856	29	404.8314	0.7381971	3540.768	10265.75	1.430531E-20	27	957.5715	0.7513372	3253.494	10132.62	3.050069E-22	31	740.5721	0.7294067	3747.587	10371.49	5.619692E-17	32	1218.985	0.7499226	4284.281	13147.41	2.865085E-18	27	763.5179	0.7895677	2251.823	8824.326	3.943716E-13	45	444.9029	0.7860567	4156.383	15638.53	3.678E-38	28	849.5297	BIRC4	BIRC4_P500_F	32528298	NM_001167.2	BIRC4	331	X	36.1	122821229	-500	Y	AGAAGAAACACTGGAGCTGGGGGCGGAGACTACGAGGTGCTCACTGCG	API3, ILP1, MIHA, XIAP	X-linked inhibitor of apoptosis; apoptosis inhibitor 3; go_component: cytosol; go_component: intracellular; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: caspase inhibitor activity; go_function: cysteine protease inhibitor activity; go_process: apoptosis; go_process: anti-apoptosis; go_process: anti-apoptosis	baculoviral IAP repeat-containing protein 4
BIRC5_E89_F	54	0.04822314	3571.997	186.047	0.02554841	32	143.6598	0.03172024	11058.4	365.5423	6.325499E-13	38	877.1026	0.03762608	9941.527	392.5952	2.217964E-11	32	451.6637	0.03591187	4686.779	178.3055	0.0193399	15	162.8903	0.03802412	11818.37	471.0986	3.715793E-16	29	950.5786	0.05108942	8589.296	467.8324	7.084557E-10	23	380.8927	0.04837188	8693.268	446.9676	5.223658E-07	32	433.6333	0.03957193	11193.35	465.3131	4.118158E-08	20	541.8256	0.1467463	1875.018	339.6722	0.3962763	32	109.2773	0.03953602	10848.18	450.6651	2.002531E-13	27	461.5822	BIRC5	BIRC5_E89_F	59859877	NM_001168.2	BIRC5	332	17	36.1	73721961	89	Y	GGCGCGCCATTAACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTG	API4, EPR-1	isoform 1 is encoded by transcript variant 1; apoptosis inhibitor 4; survivin; go_component: midbody; go_component: intracellular; go_component: spindle microtubule; go_component: chromosome, pericentric region; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: microtubule binding; go_function: caspase inhibitor activity; go_function: cysteine protease inhibitor activity; go_process: apoptosis; go_process: anti-apoptosis; go_process: anti-apoptosis; go_process: G2/M transition of mitotic cell cycle	baculoviral IAP repeat-containing protein 5 isoform 1
BLK_P14_F	154	0.1911045	2742.273	671.4973	0.050153	35	203.0269	0.8279175	1830.559	9288.236	3.112978E-12	20	282.1592	0.841099	1826.503	10197.41	1.372095E-15	28	395.5484	0.6690202	460.6384	1133.237	0.5310426	28	90.42342	0.8019101	1953.152	8311.594	3.660901E-11	34	388.0801	0.7907214	2032.631	8057.76	2.480508E-12	29	565.0182	0.7819265	2066.681	7768.87	4.184724E-08	33	443.8871	0.771968	2679.169	9408.459	1.039447E-08	35	321.9784	0.7843038	1921.525	7350.568	4.240653E-09	36	433.2055	0.8476298	1495.816	8877.466	2.875877E-11	35	367.8397	BLK	BLK_P14_F	33469981	NM_001715.2	BLK	640	8	36.1	11388916	-14	N	GACAAAGCAAAACCAGTGAGGCTGAAAGAACGGCTGCCCTGGTGCACACAGATGG	MGC10442	BLK nonreceptor tyrosine kinase; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: protein kinase cascade; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	B lymphoid tyrosine kinase
BLK_P668_R	162	0.526741	1340.641	1603.444	0.1104498	31	112.1917	0.8922267	1553.096	13685.55	2.200675E-23	39	1062.155	0.8840395	2284.655	18179.72	3.678E-38	37	755.9288	0.08276886	1910.258	181.4011	0.40184	25	127.7474	0.8608071	2212.978	14304.09	6.697992E-30	20	1158.687	0.8987164	1741.847	16343.21	3.678E-38	20	1593.299	0.8545902	2609.6	15924.64	5.661833E-30	35	699.8031	0.849174	2405.275	14105.08	2.428859E-16	24	1251.077	0.8982251	1317.41	12509.49	6.727134E-21	33	1165.731	0.9182559	1760.106	20895.14	3.678E-38	26	684.495	BLK	BLK_P668_R	33469981	NM_001715.2	BLK	640	8	36.1	11388262	-668	N	AAACCCCAGAACTCTGCGTTGCTGCGTCTATTGACATGAACACCTGTCAAACCTGC	MGC10442	BLK nonreceptor tyrosine kinase; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: protein kinase cascade; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	B lymphoid tyrosine kinase
BMP2_E48_R	2857	0.1571093	1686.197	332.9356	0.3451144	27	135.5426	0.07403024	5585.563	454.5544	0.0008134753	36	312.4928	0.0720335	6816.862	536.9222	9.674679E-06	28	702.3921	0.2290125	378.0398	141.9959	0.7829465	31	20.43548	0.08895259	5653.149	561.7244	0.0003193486	29	261.8005	0.09431791	6233.856	659.6091	9.909402E-06	35	355.6746	0.06430214	6490.849	452.9301	0.0003632655	31	267.035	0.08902414	6732.481	667.697	0.001614987	32	240.9862	0.07836664	4750.826	412.4665	0.005244355	32	258.2037	0.08311249	6370.902	586.5636	3.960823E-05	21	344.075	BMP2	BMP2_E48_R	4557368	NM_001200.1	BMP2	650	20	36.1	6697255	48	Y	AATAACTTGCGCACCCCACTTTGCGCCGGTGCCTTTGCCCCAGCGGAGC	BMP2A	go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: growth; go_process: ossification; go_process: cell differentiation; go_process: cartilage development; go_process: cell-cell signaling	bone morphogenetic protein 2 precursor
BMP2_P1201_F	1884	0.06906169	1621.425	127.704	0.4374079	17	80.29326	0.1201783	7477.886	1035.093	3.450901E-07	29	293.1122	0.08438264	8171.082	762.2569	1.898723E-08	33	273.7056	0.2601002	1914.351	708.1138	0.2753458	39	102.919	0.09504315	7563.725	804.8832	2.064287E-07	33	251.3016	0.1248145	6865.527	993.3878	2.050985E-07	26	460.6285	0.09433437	7860.6	829.1782	2.384931E-06	29	330.9072	0.100931	7619.135	866.5627	0.0001846506	35	342.131	0.1278957	5634.947	841.0405	0.0001707996	28	584.1753	0.09710602	7301.908	796.0733	7.321871E-07	31	353.9635	BMP2	BMP2_P1201_F	4557368	NM_001200.1	BMP2	650	20	36.1	6696006	-1201	Y	AAACTGAAAGTTGAATAACGGGCCCAGCGGGGAAATAAGAGGCCAGACCCT	BMP2A	go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: growth; go_process: ossification; go_process: cell differentiation; go_process: cartilage development; go_process: cell-cell signaling	bone morphogenetic protein 2 precursor
BMP3_E147_F	2863	0.1050181	9546.056	1131.878	2.219729E-16	31	389.1642	0.1218604	12347.47	1727.349	7.742544E-20	24	818.1636	0.1266865	13429.48	1962.643	3.502342E-26	22	722.8871	0.1170458	6397.43	861.3094	0.0001376901	37	304.7537	0.136295	11776.05	1874.074	4.338457E-20	36	634.0172	0.1489793	13995.28	2467.514	2.293998E-34	21	853.4491	0.1348177	11855.37	1862.955	5.435374E-16	23	755.013	0.114798	16174.23	2110.534	3.691533E-20	40	776.0723	0.1401179	10159.29	1671.753	4.566261E-15	18	567.8867	0.1303646	13312.13	2010.574	2.807775E-25	39	546.222	BMP3	BMP3_E147_F	4557370	NM_001201.1	BMP3	651	4	36.1	82171290	147	Y	ACCTGTCAGGCTGCGCTGGGTCAGCGCAGCAAGTGGGGCTGGCCGCTA	.	Bone morphogenetic protein-3; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: ossification; go_process: cell differentiation; go_process: cartilage development; go_process: cell-cell signaling	bone morphogenetic protein 3 (osteogenic) precursor
BMP3_P56_R	1700	0.02858653	6696.103	199.9942	1.010141E-06	30	247.7304	0.05118413	8387.872	457.8806	9.540813E-08	25	532.816	0.03804355	9622.6	384.5104	1.189948E-10	31	415.6895	0.2005463	457.9202	139.9566	0.7676501	29	21.4577	0.0346701	9193.384	333.7745	1.344788E-09	18	520.2305	0.05377015	9781.679	561.5331	5.578139E-13	32	511.0934	0.04095677	8938.67	386.0042	2.731789E-07	35	333.0963	0.0367379	10644.58	409.7879	2.597946E-07	40	408.0808	0.05239034	7736.663	433.2643	4.779815E-07	26	339.4781	0.0370879	10893.53	423.431	1.80825E-13	31	397.9611	BMP3	BMP3_P56_R	4557370	NM_001201.1	BMP3	651	4	36.1	82171087	-56	Y	CAGAGCTAGTCCTAGTCCCTCGCGCGGCCAGTTTGGCCGGGTGTTCCCA	.	Bone morphogenetic protein-3; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: ossification; go_process: cell differentiation; go_process: cartilage development; go_process: cell-cell signaling	bone morphogenetic protein 3 (osteogenic) precursor
BMP4_P123_R	3156	0.0709295	4420.594	345.1228	0.002185377	34	183.818	0.09176424	10114.76	1032.056	2.69472E-12	33	673.4194	0.0973213	12360.16	1343.378	1.670612E-20	26	740.8154	0.04140608	4894.414	215.7317	0.01293014	29	199.3437	0.1118922	11410.65	1450.22	9.443998E-18	26	573.7697	0.12481	12157.57	1748.04	4.288331E-24	28	811.8644	0.1295753	11502.79	1727.243	7.8072E-15	33	719.4572	0.1521815	12482.32	2258.498	5.765111E-13	22	746.6328	0.1256974	8552.682	1243.986	3.479825E-10	29	547.6093	0.0756717	11445.47	945.1894	3.047409E-16	29	526.6433	BMP4	BMP4_P123_R	19528651	NM_130851.1	BMP4	652	14	36.1	53493485	-123	Y	CCCGGAAGCCCAGGCAGCGCCCGAGTCCGCAGCTGCCGTCGGAGCTGGG	ZYME, BMP2B, BMP2B1	bone morphogenetic protein 2B; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_function: signal transducer activity; go_process: growth; go_process: ossification; go_process: cell differentiation; go_process: cartilage development; go_process: ureteric bud development; go_process: positive regulation of bone mineralization; go_process: negative regulation of myoblast differentiation; go_process: positive regulation of osteoblast differentiation; go_process: negative regulation of striated muscle development; go_process: positive regulation of protein amino acid phosphorylation	bone morphogenetic protein 4 preproprotein
BMP4_P199_R	3050	0.4884792	1230.098	1270.184	0.2038325	32	89.79645	0.4834307	5180.986	4942.203	4.009718E-10	33	668.8613	0.4910139	5831.206	5721.776	2.422683E-14	26	492.3385	0.4333087	1294.04	1065.924	0.3355792	33	98.79954	0.4487908	4824.296	4009.329	3.00021E-08	21	499.2211	0.6726227	4448.816	9345.906	1.082032E-23	25	554.9514	0.4045317	5193.841	3596.373	1.713466E-06	19	634.738	0.4590375	6373.018	5492.725	2.133998E-08	34	378.1648	0.5535462	3768.264	4796.16	9.562794E-08	28	498.5316	0.3486236	7026.02	3813.922	2.498247E-12	30	365.1125	BMP4	BMP4_P199_R	19528651	NM_130851.1	BMP4	652	14	36.1	53493561	-199	Y	GGGGCTCACCTGGGGACCACGTGCGGAGGTACTAGAAAGCATGCACCGACT	ZYME, BMP2B, BMP2B1	bone morphogenetic protein 2B; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_function: signal transducer activity; go_process: growth; go_process: ossification; go_process: cell differentiation; go_process: cartilage development; go_process: ureteric bud development; go_process: positive regulation of bone mineralization; go_process: negative regulation of myoblast differentiation; go_process: positive regulation of osteoblast differentiation; go_process: negative regulation of striated muscle development; go_process: positive regulation of protein amino acid phosphorylation	bone morphogenetic protein 4 preproprotein
BMP6_P163_F	1885	0.06180923	6448.307	431.411	1.085766E-06	26	290.9883	0.07766068	8841.34	752.858	4.287393E-09	33	437.2534	0.05456506	13332.94	775.2719	8.501568E-22	35	581.435	0.03890905	6665.258	273.8864	0.0003042108	25	405.2796	0.06294113	10262.48	696.0353	9.28772E-13	27	367.9776	0.144245	9693.772	1650.826	9.92855E-16	24	633.0419	0.06004306	11399.6	734.5774	2.069766E-12	26	601.9266	0.08246657	12259.9	1110.89	1.198616E-10	33	720.183	0.1156663	7268.579	963.7724	3.727953E-07	27	717.3198	0.07253708	10168.9	803.1326	1.22322E-12	26	453.044	BMP6	BMP6_P163_F	4809281	NM_001718.2	BMP6	654	6	36.1	7671846	-163	Y	GCCAGCGAGGCCCAGAGTGACCGCGCCGCGACTCGCAGGAGCCAGGGCGCAGG	VGR, VGR1	Vg-related sequence; transforming growth factor-beta; vegetal related growth factor (TGFB-related); vegetal-related (TGFB related) cytokine; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: growth; go_process: ossification; go_process: cell differentiation; go_process: cartilage development	bone morphogenetic protein 6 precursor
BMP6_P398_F	1888	0.06191316	2846.524	194.4688	0.09499011	31	130.1313	0.04298206	8737.67	396.9218	2.982983E-08	35	544.1034	0.03322425	12668.23	438.7935	1.127052E-18	19	662.6653	0.0638961	2111.046	150.9205	0.3593166	31	72.45128	0.03227322	8081.961	272.8644	2.181634E-07	35	610.9002	0.03672268	10051.52	387.0028	3.14308E-13	34	687.5898	0.03019738	10134	318.6629	3.704277E-09	27	669.0392	0.0397536	11703.98	488.6774	7.355207E-09	17	647.41	0.03866021	7356.833	299.876	3.383345E-06	28	579.6033	0.05031899	11489.06	614.0479	1.797814E-15	34	511.5551	BMP6	BMP6_P398_F	4809281	NM_001718.2	BMP6	654	6	36.1	7671611	-398	Y	TTCGTGAGCGAGAAGGAAGTTAAACCTCGCGGAATAGACTGGCATTTCGG	VGR, VGR1	Vg-related sequence; transforming growth factor-beta; vegetal related growth factor (TGFB-related); vegetal-related (TGFB related) cytokine; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_process: growth; go_process: ossification; go_process: cell differentiation; go_process: cartilage development	bone morphogenetic protein 6 precursor
BMPR1A_E88_F	2440	0.2981734	5318.608	2302.114	3.369152E-08	21	320.3487	0.6823463	4807.281	10541.25	9.80752E-24	31	1221.724	0.7499792	5751.723	17553.22	3.678E-38	29	925.0439	0.471225	2258.92	2102.184	0.04119058	29	280.976	0.5802261	5938.01	8345.949	4.430978E-22	26	1076.193	0.6900283	5637.424	12772.08	3.678E-38	24	1491.099	0.7166886	4549.105	11760.77	6.189931E-23	27	1415.58	0.5829677	8971.916	12681.59	1.316859E-28	28	973.5474	0.6783336	3676.519	7963.965	1.453068E-14	33	846.7488	0.5790805	7474.455	10420.57	5.645801E-35	23	668.6774	BMPR1A	BMPR1A_E88_F	41349436	NM_004329.2	BMPR1A	657	10	36.1	88506464	88	Y	AGGAGGGAGGAGGGCCAAGGGCGGGCAGGAAGGCTTAGGCTCG	ALK3, CD292, ACVRLK3	activin A receptor, type II-like kinase 3; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transforming growth factor beta receptor signaling pathway	bone morphogenetic protein receptor, type IA precursor
BMPR1A_P956_F	1899	0.07294915	2562.925	209.5442	0.1420941	29	77.59848	0.1102079	10772.1	1346.596	1.398835E-14	35	632.0268	0.1382267	12797.15	2068.677	2.475816E-24	25	660.921	0.04157081	3983.494	177.1171	0.05418778	27	232.1143	0.1069859	9716.385	1176.034	1.333826E-12	28	883.7541	0.265997	8230.769	3019.005	1.861144E-15	25	737.7919	0.1101355	10255.44	1281.657	3.430748E-11	22	772.9157	0.08504882	15519.3	1451.884	2.726337E-17	27	646.539	0.1270982	7127.456	1052.349	4.596189E-07	20	513.688	0.1225912	12366.25	1741.778	2.830111E-21	33	637.0944	BMPR1A	BMPR1A_P956_F	41349436	NM_004329.2	BMPR1A	657	10	36.1	88505420	-956	Y	TTTCCAAATGGACGGAATGAGCCTCCGGAGGGTACACGAGGTCACCAGCGT	ALK3, CD292, ACVRLK3	activin A receptor, type II-like kinase 3; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: transforming growth factor beta receptor activity; go_process: protein amino acid phosphorylation; go_process: transforming growth factor beta receptor signaling pathway	bone morphogenetic protein receptor, type IA precursor
BMPR2_E435_F	2867	0.05999481	3262.983	214.6388	0.04453112	26	240.3091	0.05394115	7180.968	415.1368	8.857449E-06	30	554.8148	0.05038702	9144.704	490.5294	7.444907E-10	28	328.1955	0.1242448	3169.813	463.8934	0.103842	24	196.076	0.06025717	7639.798	496.2829	5.171821E-07	32	386.8911	0.06321321	7935.142	542.2014	1.238948E-08	30	295.5497	0.06264879	5970.479	405.7264	0.00139133	39	505.7567	0.0605363	8827.067	575.2341	2.238841E-05	37	324.1313	0.08003387	5200.779	461.1494	0.001601257	26	498.6754	0.05560209	10977.62	652.2029	3.010745E-14	25	413.4428	BMPR2	BMPR2_E435_F	72376969	NM_001204.5	BMPR2	659	2	36.1	202950351	435	Y	TGTATTGTGATACGGGCAGGATCAGTCCACGGGAGAGAAGACGAGCCTCCCG	BMR2, PPH1, BMPR3, BRK-3, T-ALK, BMPR-II	serine/threonine kinase; type II activin receptor-like kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: transforming growth factor beta receptor activity; go_process: skeletal development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	bone morphogenetic protein receptor type II precursor
BMPR2_P1271_F	1938	0.0979998	2053.525	233.9745	0.2617095	38	66.48463	0.2172413	7540.111	2120.383	3.211543E-09	21	373.1482	0.1721173	8783.074	1846.796	4.596994E-12	27	366.4444	0.03377862	4967.4	177.1538	0.01219686	24	169.6034	0.231042	6408.664	1955.6	2.100602E-07	30	349.09	0.2229742	6949.374	2022.878	1.092206E-09	33	329.9223	0.2376775	7606.438	2402.719	2.153097E-08	28	335.8436	0.2266984	8672.158	2571.616	1.476477E-07	12	301.8029	0.1816361	7484.026	1683.277	6.853109E-09	23	309.0131	0.2038625	8554.186	2216.029	3.627515E-12	29	406.7654	BMPR2	BMPR2_P1271_F	72376969	NM_001204.5	BMPR2	659	2	36.1	202948645	-1271	Y	GTTGAGGAAAGCAGGACGTCGATTACAGCGAACACATCAAAGGGGTGGTCTTT	BMR2, PPH1, BMPR3, BRK-3, T-ALK, BMPR-II	serine/threonine kinase; type II activin receptor-like kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: transforming growth factor beta receptor activity; go_process: skeletal development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	bone morphogenetic protein receptor type II precursor
BRCA1_P835_R	2318	0.4969922	1901.466	1977.53	0.01976508	41	108.3064	0.6169448	4800.14	7892.118	4.961837E-16	27	761.7713	0.6675893	5665.802	11579.62	2.870933E-33	30	619.1276	0.4404804	560.6605	520.1033	0.6607173	30	57.12901	0.800303	2499.258	10416.76	6.559821E-18	33	1114.716	0.7754357	3220.867	11467.18	4.936328E-27	20	548.4751	0.765424	3310.979	11130.06	8.601968E-18	29	762.2357	0.6368535	6507.039	11586.83	9.974139E-20	28	728.447	0.7158197	2996.76	7800.407	1.880163E-12	29	373.8375	0.7473034	3586.337	10901.66	1.734122E-22	20	757.6558	BRCA1	BRCA1_P835_R	63252875	NM_007298.2	BRCA1	672	17	36.1	38531829	-835	Y	GCAATCGCCACCAGTCAATGGGGTGGTCGTTTTGAGGGACAAGTGGTAAGA	IRIS, PSCP, BRCAI, BRCC1, RNF53	isoform BRCA1-delta9-11 is encoded by transcript variant BRCA1-delta9-11; breast and ovarian cancer susceptibility protein 1; breast and ovarian cancer suseptibility protein variant; go_component: nucleus; go_component: nucleus; go_component: intracellular; go_component: BRCA1-BARD1 complex; go_component: ubiquitin ligase complex; go_component: gamma-tubulin ring complex; go_function: DNA binding; go_function: DNA binding; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: tubulin binding; go_function: zinc ion binding; go_function: androgen receptor binding; go_function: ubiquitin-protein ligase activity; go_function: transcription coactivator activity; go_process: DNA repair; go_process: cell cycle; go_process: cell cycle checkpoint; go_process: protein ubiquitination; go_process: regulation of apoptosis; go_process: regulation of cell proliferation; go_process: positive regulation of DNA repair; go_process: androgen receptor signaling pathway; go_process: negative regulation of centriole replication; go_process: negative regulation of progression through cell cycle; go_process: positive regulation of transcription, DNA-dependent; go_process: regulation of transcription from RNA polymerase II promoter; go_process: regulation of transcription from RNA polymerase III promoter; go_process: DNA damage response, signal transduction resulting in induction of apoptosis; go_process: DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator	breast cancer 1, early onset isoform BRCA1-delta9-11
BSG_P211_R	4248	0.08180656	2162.365	201.5657	0.2399992	39	86.29632	0.06914935	8859.844	665.5927	5.771436E-09	38	422.2267	0.07914953	9784.357	849.5866	4.496783E-12	17	602.6314	0.04148837	3230.862	144.1735	0.137789	20	94.29484	0.08157606	7761.79	698.2983	1.426267E-07	23	594.8125	0.0852867	8257.87	779.2772	7.847936E-10	32	461.0974	0.07092965	8946.521	690.6545	8.793464E-08	25	428.9726	0.07948124	10017.71	873.6028	4.187939E-07	30	604.7416	0.0862169	6912.31	661.6227	4.572799E-06	26	484.3731	0.07927484	10386.79	902.9172	2.108249E-13	31	764.4905	BSG	BSG_P211_R	38372918	NM_001728.2	BSG	682	19	36.1	522114	-211	Y	CTCTTCAAAGGTTTGGCTCGTTCAGCGCCCTCGTTCTTCGTTTCCTACTTCC	M6, OK, 5F7, TCSF, CD147, EMMPRIN	isoform 1 is encoded by transcript variant 1; OK blood group; collagenase stimulatory factor; M6 antigen; extracellular matrix metalloproteinase inducer; go_component: membrane; go_component: integral to membrane; go_function: sugar binding; go_function: mannose binding; go_function: signal transducer activity; go_process: cell surface receptor linked signal transduction	basigin isoform 1
BTK_E64_R	119	0.4464768	2129.89	1798.649	0.01773962	31	133.4673	0.6747639	3057.987	6551.844	4.005844E-09	22	384.9408	0.5892866	3765.81	5546.619	3.422924E-09	29	325.0048	0.1118686	4719.716	607.0892	0.008884365	31	147.21	0.8511006	1954.817	11745.22	3.049607E-20	28	458.0881	0.8649691	1809.141	12229.41	1.398395E-24	31	662.1302	0.7378476	2999.643	8724.179	1.450971E-11	24	635.7096	0.8367891	2766.921	14698.82	2.418982E-18	28	716.3609	0.8474175	1453.549	8628.146	8.353949E-11	31	727.9825	0.855819	2591.8	15977.79	8.599315E-38	28	971.3615	BTK	BTK_E64_R	4557376	NM_000061.1	BTK	695	X	36.1	100527774	64	N	CAGGACTTGGAAGGTGGGACTCGATCGCAGCAGACACTGGCCCTGGAG	AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262	src-related protein-tyrosine kinase; Bruton's tyrosine kinase; frameshift mutation results in truncated protein; dominant-negative kinase-deficient Brutons tyrosine kinase isoform 5; dominant-negative kinase-deficient Brutons tyrosine kinase isoform 9; dominant-negative kinase-deficient Brutons tyrosine kinase isoform 11; go_component: cytoplasm; go_component: lipid raft; go_function: ATP binding; go_function: ATP binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: mesoderm development; go_process: calcium-mediated signaling; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	Bruton agammaglobulinemia tyrosine kinase
BTK_P105_F	3055	0.08574376	1946.505	191.932	0.3067678	33	67.08278	0.3046452	4513.544	2021.262	0.0002209082	27	316.2646	0.318047	6085	2884.54	1.618048E-08	29	291.1234	0.1806491	1155.667	276.8471	0.5728841	41	66.54021	0.2971746	6753.087	2897.681	7.512712E-10	32	480.5455	0.3054734	7524.061	3353.288	2.071142E-14	28	538.9327	0.1992755	9411.342	2367.078	1.124786E-11	26	476.9648	0.2475216	8788.864	2923.919	3.47255E-08	32	584.2217	0.2737839	4706.04	1811.88	0.0001506534	26	378.0234	0.26767	8606.627	3182.313	1.184137E-14	28	525.4377	BTK	BTK_P105_F	4557376	NM_000061.1	BTK	695	X	36.1	100527943	-105	N	GCAGCATGCTATCTGGTTCCCTGCTGCCGTCCCTATTCCACCCCCTCAAC	AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262	src-related protein-tyrosine kinase; Bruton's tyrosine kinase; frameshift mutation results in truncated protein; dominant-negative kinase-deficient Brutons tyrosine kinase isoform 5; dominant-negative kinase-deficient Brutons tyrosine kinase isoform 9; dominant-negative kinase-deficient Brutons tyrosine kinase isoform 11; go_component: cytoplasm; go_component: lipid raft; go_function: ATP binding; go_function: ATP binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: mesoderm development; go_process: calcium-mediated signaling; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	Bruton agammaglobulinemia tyrosine kinase
C20orf47_P225_R	1740	0.142607	3184.266	546.2598	0.02704576	31	143.819	0.09204637	7294.99	749.688	1.911523E-06	26	327.2169	0.08449642	8435.358	787.7711	5.16386E-09	28	247.5127	0.1206747	1716.907	249.3442	0.4339457	28	117.0986	0.08965671	5728.185	573.9987	0.0002493525	23	437.5056	0.1210829	6543.784	915.2727	1.100804E-06	26	441.7137	0.1046648	6307.955	749.0908	0.000273201	27	373.1482	0.07615338	8006.241	668.2036	0.0001221169	28	245.873	0.1235092	5244.661	753.1337	0.0006656417	26	316.1928	0.08353657	9527.626	877.5679	2.44298E-11	36	228.9402	C20orf47	C20orf47_P225_R	38327613	NM_015966.2	ERGIC3	51614	20	36.1	33592967	-225	Y	AGTTCCGAGCACAAGGCACACGAACGGTGCTATTAGCGTTTCTAACCCCGC	Erv46, CGI-54, PRO0989, C20orf47, NY-BR-84, SDBCAG84, dJ477O4.2	isoform b is encoded by transcript variant 2; serologically defined breast cancer antigen 84; go_component: membrane; go_component: integral to membrane; go_component: ER-Golgi intermediate compartment; go_function: protein binding; go_process: ER to Golgi vesicle-mediated transport	serologically defined breast cancer antigen 84 isoform b
C4B_E171_F	3042	0.3543735	3671.741	2070.245	9.905286E-05	36	173.2686	0.8397725	2063.761	11340.54	6.167269E-18	41	562.2007	0.8622494	2235.59	14619.61	1.057855E-31	29	741.2734	0.8332392	787.3561	4433.776	0.01069312	26	238.1075	0.8547384	2161.004	13304.04	4.643769E-26	19	858.0863	0.8115565	2624.404	11733	9.062665E-26	24	954.5453	0.8495225	2268.811	13373.15	5.134033E-21	22	1076.501	0.847429	2710.281	15609.21	3.077058E-20	31	906.6561	0.800265	2575.859	10721.19	2.999111E-19	33	646.7716	0.8708201	1980.987	14028.23	1.05328E-27	19	709.2035	C4B	C4B_E171_F	67782350	NM_000592.4	C4B	721	6	36.1	32057984	171	N	GGCAGGGCTGGCATCGGGACCCGATTCAGGAGTGAGGGAGAGCAG	CH, C4F, CO4, C4B1, C4B3, CPAMD3	Chido form of C4; basic C4; complement component 4B, centromeric; go_component: extracellular region; go_function: endopeptidase inhibitor activity; go_process: inflammatory response; go_process: innate immune response; go_process: complement activation, classical pathway	complement component 4B preproprotein
C4B_P191_F	171	0.7166496	517.2585	1561.17	0.3258252	30	67.7577	0.9598831	721.6865	19660.6	3.678E-38	23	1598.461	0.9646391	680.7072	21297.57	3.678E-38	30	1566.4	0.8421761	425.9752	2806.696	0.1593978	32	100.0434	0.9623112	647.476	19085.38	3.678E-38	26	1494.833	0.9618861	782.476	22271.17	3.678E-38	36	1284.3	0.9658858	672.2869	21865.98	3.678E-38	29	1403.951	0.9694149	749.8771	26937.4	3.678E-38	33	937.1619	0.941564	631.9556	11793.81	1.071676E-16	33	988.3823	0.9687518	637.1937	22854.42	3.678E-38	29	746.2631	C4B	C4B_P191_F	67782350	NM_000592.4	C4B	721	6	36.1	32057622	-191	N	CTCAGGCACTGGAATGAGAGGAGTTAACGGGGAAGGACAGGGTTATTT	CH, C4F, CO4, C4B1, C4B3, CPAMD3	Chido form of C4; basic C4; complement component 4B, centromeric; go_component: extracellular region; go_function: endopeptidase inhibitor activity; go_process: inflammatory response; go_process: innate immune response; go_process: complement activation, classical pathway	complement component 4B preproprotein
CALCA_E174_R	3043	0.4012113	802.1426	604.47	0.5588995	28	46.65907	0.4279676	4968.167	3791.762	1.336531E-07	28	285.4181	0.4143623	5581.849	4020.137	8.736337E-10	38	262.1774	0.729615	484.1036	1576.162	0.4098239	20	92.09505	0.3830083	4955.892	3138.533	6.077109E-07	27	311.9692	0.4559308	4875.202	4169.227	7.560912E-10	34	250.8039	0.3886247	5356.605	3468.526	1.525775E-06	23	171.3837	0.5491734	3337.977	4187.963	0.001279218	29	337.5923	0.3761252	4886.599	3006.349	1.400917E-06	26	276.363	0.3034551	6139.88	2718.451	3.4162E-08	24	388.1643	CALCA	CALCA_E174_R	76880483	NM_001033952.1	CALCA	796	11	36.1	14950234	174	Y	TCCAACCTAGGGCACGAGCCTGGTATAAATCGCGGACTAACAGAGACTATCTGATGAA	CT, KC, CGRP, CALC1, CGRP1, CGRP-I, MGC126648	isoform CALCA preproprotein is encoded by transcript variant 2; katacalcin; go_component: soluble fraction; go_component: extracellular space; go_component: endoplasmic reticulum; go_function: hormone activity; go_process: cell-cell signaling; go_process: skeletal development; go_process: phospholipase C activation; go_process: adenylate cyclase activation; go_process: regulation of blood pressure; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to cAMP nucleotide second messenger	calcitonin isoform CALCA preproprotein
CALCA_P171_F	174	0.3233101	6018.968	2923.531	2.392963E-11	27	453.1782	0.6467646	4704.392	8796.715	3.326724E-18	24	766.8107	0.6801341	5108.938	11075.82	4.198469E-29	24	621.6913	0.1297311	5570.546	845.3087	0.001018961	38	252.722	0.5726373	5912.028	8055.712	4.491186E-21	30	834.9598	0.5717437	6691.746	9067.323	2.393478E-31	25	737.6123	0.6217622	6126.635	10235.59	4.340094E-23	23	876.5709	0.5354461	6684.643	7819.998	1.509162E-12	35	550.4763	0.5962253	4512.773	6811.353	9.464628E-14	40	752.9356	0.6092947	5324.946	8460.063	2.847191E-20	33	434.643	CALCA	CALCA_P171_F	76880483	NM_001033952.1	CALCA	796	11	36.1	14950579	-171	Y	AGGGGTCCTTTGCCCCTGGGTTGCGTCACCCTCATGCTTCCAGAACCTG	CT, KC, CGRP, CALC1, CGRP1, CGRP-I, MGC126648	isoform CALCA preproprotein is encoded by transcript variant 2; katacalcin; go_component: soluble fraction; go_component: extracellular space; go_component: endoplasmic reticulum; go_function: hormone activity; go_process: cell-cell signaling; go_process: skeletal development; go_process: phospholipase C activation; go_process: adenylate cyclase activation; go_process: regulation of blood pressure; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to cAMP nucleotide second messenger	calcitonin isoform CALCA preproprotein
CALCA_P75_F	178	0.0463982	6668.193	329.3115	6.430861E-07	29	247.546	0.1797265	11455.54	2531.884	1.388544E-19	30	1009.052	0.1886449	15860.47	3710.905	3.678E-38	31	870.4194	0.04181417	4896.257	218.0311	0.01283987	25	244.9571	0.161682	11491.69	2235.629	2.513484E-20	24	1313.087	0.2929742	11469.28	4794.024	1.70246E-33	36	1221.508	0.1757249	13392.82	2876.496	8.142651E-23	30	978.3338	0.1953539	10369.08	2541.708	6.299601E-10	26	1004.786	0.2443818	8283.833	2711.496	6.229776E-13	28	697.3776	0.1446548	14639.59	2492.74	6.303781E-32	35	646.0922	CALCA	CALCA_P75_F	76880483	NM_001033952.1	CALCA	796	11	36.1	14950483	-75	Y	GGCAGTGTCTCTGATGCCTCCCAGCGCCAGCGACTGCTCTTATTCCCGCCG	CT, KC, CGRP, CALC1, CGRP1, CGRP-I, MGC126648	isoform CALCA preproprotein is encoded by transcript variant 2; katacalcin; go_component: soluble fraction; go_component: extracellular space; go_component: endoplasmic reticulum; go_function: hormone activity; go_process: cell-cell signaling; go_process: skeletal development; go_process: phospholipase C activation; go_process: adenylate cyclase activation; go_process: regulation of blood pressure; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to cAMP nucleotide second messenger	calcitonin isoform CALCA preproprotein
CAPG_E228_F	3045	0.1661452	1024.297	224.0157	0.6138909	35	33.76395	0.1249862	7707.191	1115.172	1.046278E-07	32	382.2638	0.06351547	9223.278	632.3355	2.536405E-10	33	408.7782	0.3171233	3348.253	1601.346	0.01687661	30	158.6255	0.09095253	7470.288	757.4268	3.614453E-07	30	205.64	0.1090196	7951.508	985.1753	1.307565E-09	27	420.5764	0.09394678	8466.022	888.1931	2.458857E-07	20	255.7008	0.06475252	9556.17	668.5517	2.706647E-06	23	440.4993	0.08157304	7322.481	659.2515	9.97327E-07	31	338.1475	0.09743629	9339.18	1019.007	3.105965E-11	25	281.9249	CAPG	CAPG_E228_F	63252912	NM_001747.2	CAPG	822	2	36.1	85490959	228	N	CTTTCTTCCTCCTACCTCTGCTTCGTAGGTTCGTCTTCCTTCCAGCCTGC	MCP, AFCP	macrophage capping protein; actin-regulatory protein CAP-G; go_component: nucleus; go_component: F-actin capping protein complex; go_function: actin binding; go_process: protein complex assembly; go_process: barbed-end actin filament capping; go_process: response to pest, pathogen or parasite	gelsolin-like capping protein
CARD15_P302_R	4256	0.2012569	4049.68	1045.583	0.0008326569	32	153.788	0.5365677	5493.019	6475.668	3.255023E-14	27	613.4064	0.4581395	6404.481	5499.497	2.8866E-15	37	541.0259	0.2299889	4164.097	1273.611	0.007280064	30	227.2933	0.3464545	6707.153	3608.577	2.821015E-11	37	540.9324	0.353502	8127.991	4499.026	1.117596E-19	23	986.909	0.5240437	5672.612	6355.838	3.443795E-12	31	543.4551	0.4792116	7308.083	6816.663	6.83809E-12	30	701.4591	0.4409273	5258.626	4226.221	1.568714E-09	29	317.008	0.5912996	4980.62	7350.54	4.416802E-16	35	390.1094	CARD15	CARD15_P302_R	11545911	NM_022162.1	CARD15	64127	16	36.1	49288249	-302	N	AGAGCTCCGAGTCACGTGGCTTGGGCGGGCCTCCCCTTCCTGGTGTCCA	CD, ACUG, BLAU, IBD1, NOD2, NOD2B, PSORAS1	inflammatory bowel disease protein 1; caspase recruitment domain protein 15; nucleotide-binding oligomerization domain 2; LRR-containing protein; go_component: cytoplasm; go_function: ATP binding; go_function: protein binding; go_function: nucleotide binding; go_function: peptidoglycan binding; go_process: defense response; go_process: regulation of apoptosis; go_process: protein oligomerization; go_process: detection of biotic stimulus	NOD2 protein
CARD15_P665_F	4255	0.3256685	5814.895	2856.599	1.181852E-10	35	393.7112	0.6254736	3882.704	6651.271	5.754344E-11	30	382.3854	0.6094199	4897.706	7797.892	1.818606E-17	28	629.5443	0.2699978	4285.457	1622	0.002968652	32	329.5304	0.5646277	4236.277	5623.651	2.74977E-10	22	583.7117	0.6661157	3489.022	7160.277	8.650179E-14	20	627.7271	0.6713095	3602.089	7561.058	1.832102E-10	36	550.2697	0.5677958	5193.32	6953.946	8.544694E-09	24	414.1042	0.6153314	3194.042	5269.282	1.456989E-07	30	490.9598	0.5364177	5319.674	6271.182	3.775532E-14	30	379.5797	CARD15	CARD15_P665_F	11545911	NM_022162.1	CARD15	64127	16	36.1	49287886	-665	N	ATTTCGCCTGAAGAGGGGAAGCCCGACCAGGTAATAAAGGAGTAAGAGGAA	CD, ACUG, BLAU, IBD1, NOD2, NOD2B, PSORAS1	inflammatory bowel disease protein 1; caspase recruitment domain protein 15; nucleotide-binding oligomerization domain 2; LRR-containing protein; go_component: cytoplasm; go_function: ATP binding; go_function: protein binding; go_function: nucleotide binding; go_function: peptidoglycan binding; go_process: defense response; go_process: regulation of apoptosis; go_process: protein oligomerization; go_process: detection of biotic stimulus	NOD2 protein
CASP10_E139_F	121	0.08609341	4141.52	399.567	0.004029468	21	170.2886	0.173788	7534.479	1605.86	2.913474E-08	27	431.9026	0.1426509	8684.58	1461.632	5.868722E-11	26	327.0442	0.1463875	1604.981	292.3902	0.4517816	31	66.97025	0.199404	6443.836	1629.87	6.582324E-07	26	595.3251	0.255491	7202.538	2505.99	2.178572E-11	36	580.2896	0.1437804	8066.672	1371.385	1.819942E-07	31	482.3546	0.1563898	9092.152	1704.056	5.511732E-07	31	480.0945	0.1802976	6194.359	1384.476	4.49243E-06	26	514.0782	0.1569124	8346.729	1572.074	2.757455E-10	32	412.4602	CASP10	CASP10_E139_F	47078266	NM_001230.3	CASP10	843	2	36.1	201756239	139	N	TTTGTTTTCAGGCAATTTCCCTGAGAACCGTTTACTTCCAGAAGATTGGTGGAG	MCH4, ALPS2, FLICE2	isoform a preproprotein is encoded by transcript variant A; caspase 10, apoptosis-related cysteine protease; FADD-like ICE2; apoptotic protease MCH-4; ICE-like apoptotic protease 4; Fas-associated death domain protein; interleukin-1B-converting enzyme 2; go_function: protein binding; go_function: caspase activity; go_function: caspase activity; go_function: caspase activity; go_function: identical protein binding; go_function: cysteine-type peptidase activity; go_process: proteolysis; go_process: regulation of apoptosis; go_process: induction of apoptosis	caspase 10 isoform a preproprotein
CASP10_P186_F	3056	0.1560936	4233.156	801.4844	0.001000409	27	210.8263	0.05053619	10000.18	537.5924	5.649709E-11	28	609.2294	0.04121457	11152.21	483.6902	1.475379E-14	28	618.85	0.04286021	4627.469	211.6935	0.02015411	29	306.6369	0.05676112	9189.007	558.9829	4.723392E-10	38	306.6206	0.07527182	10139.94	833.5197	1.122072E-14	25	446.5622	0.04903467	9275.525	483.4306	5.586063E-08	33	404.0032	0.03724188	11233.08	438.3918	3.955603E-08	34	564.5967	0.04842065	8978.386	461.9492	1.935818E-09	34	337.9415	0.05370286	11327.24	648.5021	3.886654E-15	33	430.0352	CASP10	CASP10_P186_F	47078266	NM_001230.3	CASP10	843	2	36.1	201755914	-186	N	GAAAGCCTGAAGCACTTTGTGGCTTCCACGGGTTCGTTTCTAGGAAGCTTTT	MCH4, ALPS2, FLICE2	isoform a preproprotein is encoded by transcript variant A; caspase 10, apoptosis-related cysteine protease; FADD-like ICE2; apoptotic protease MCH-4; ICE-like apoptotic protease 4; Fas-associated death domain protein; interleukin-1B-converting enzyme 2; go_function: protein binding; go_function: caspase activity; go_function: caspase activity; go_function: caspase activity; go_function: identical protein binding; go_function: cysteine-type peptidase activity; go_process: proteolysis; go_process: regulation of apoptosis; go_process: induction of apoptosis	caspase 10 isoform a preproprotein
CASP10_P334_F	3158	0.2094182	1556.783	438.8674	0.3528695	21	73.81268	0.4861541	5146.709	4963.958	4.248241E-10	24	315.0045	0.4045689	5692.173	3935.524	7.720252E-10	31	381.1226	0.1647831	3493.554	708.9861	0.05123053	23	170.1312	0.4890135	4133.363	4051.324	4.279207E-07	23	503.891	0.5537459	4320.838	5485.709	1.258897E-11	31	406.7511	0.3025003	5418.842	2393.48	3.534037E-05	28	375.357	0.4039896	5307.182	3665.112	6.220138E-05	27	369.28	0.4424054	4175.355	3392.142	4.680374E-06	23	442.1554	0.4583747	5099.574	4400.372	1.996302E-09	29	368.0703	CASP10	CASP10_P334_F	47078266	NM_001230.3	CASP10	843	2	36.1	201755766	-334	N	TGTGGACATAAGAAAGGGTTAACATGGCCGACAACTATTTCATGAGCTTTTTGGCTT	MCH4, ALPS2, FLICE2	isoform a preproprotein is encoded by transcript variant A; caspase 10, apoptosis-related cysteine protease; FADD-like ICE2; apoptotic protease MCH-4; ICE-like apoptotic protease 4; Fas-associated death domain protein; interleukin-1B-converting enzyme 2; go_function: protein binding; go_function: caspase activity; go_function: caspase activity; go_function: caspase activity; go_function: identical protein binding; go_function: cysteine-type peptidase activity; go_process: proteolysis; go_process: regulation of apoptosis; go_process: induction of apoptosis	caspase 10 isoform a preproprotein
CASP2_P192_F	5508	0.02253851	11008.46	256.1412	2.588697E-18	21	436.6574	0.08218279	9282.236	840.1001	4.025526E-10	21	374.3137	0.06985914	10453.74	792.6492	1.463196E-13	31	383.0436	0.03788803	8727.526	347.6285	6.876804E-07	27	359.6103	0.06154311	9826.493	650.97	1.222042E-11	28	425.1644	0.06010444	10174.31	657.0212	2.771496E-14	34	453.8177	0.07010332	9608.875	731.9354	5.823089E-09	32	435.7036	0.07805201	11524.27	984.1097	2.546972E-09	28	456.0882	0.06315841	8657.747	590.415	4.734618E-09	23	620.9163	0.05592065	10928.28	653.2382	3.985438E-14	32	458.1757	CASP2	CASP2_P192_F	39995058	NM_032982.2	CASP2	835	7	36.1	142695332	-192	Y	GAGAGGCACCGGGGTGATTTCCGCGGGAATCGATAACCAATCGGATTC	ICH1, NEDD2, CASP-2, ICH-1L, ICH-1L/1S	isoform 1 preproprotein is encoded by transcript variant 1; ICH-1 protease; NEDD2 apoptosis regulatory gene; caspase 2, apoptosis-related cysteine protease; caspase 2, apoptosis-related cysteine protease (neural precursor cell expressed, developmentally down-regulated 2); go_component: intracellular; go_function: protein binding; go_function: enzyme binding; go_function: caspase activity; go_function: caspase activity; go_function: cysteine-type peptidase activity; go_process: proteolysis; go_process: proteolysis; go_process: anti-apoptosis; go_process: apoptotic program; go_process: regulation of apoptosis	caspase 2 isoform 1 preproprotein
CASP3_P420_R	3063	0.2453893	7316.135	2411.628	1.692496E-13	35	351.0402	0.0836091	11400.46	1049.271	2.079937E-15	29	592.5656	0.05600554	12785.96	764.5012	5.024204E-20	33	564.9366	0.1066719	7088.249	858.3455	2.170842E-05	25	340.8654	0.06471436	10776.25	752.5504	3.683492E-14	25	963.5378	0.05784908	12110.77	749.7545	1.89472E-20	37	748.9679	0.08219896	12091.74	1091.901	9.999029E-15	28	662.0287	0.07320067	13981.02	1112.15	1.327514E-13	35	591.8554	0.07528035	9328.274	767.5449	7.773947E-11	32	597.3314	0.06464994	13271.29	924.2031	1.499049E-21	30	752.3752	CASP3	CASP3_P420_R	22749372	NM_152683.1	FLJ33167	201973	4	36.1	185808043	147	Y	CTCTGGGAAGAAGAGGAGCAGGCCGGGACGCCCACCGGTAATTTCTG	.	.	hypothetical protein LOC201973
CASP6_P201_F	4260	0.04454546	6551.809	310.1224	1.174044E-06	32	231.4529	0.06212702	13203.68	881.2687	7.233718E-20	33	541.4764	0.038268	15752.5	630.7823	7.341494E-30	30	940.7783	0.02475638	7332.957	188.6842	6.953127E-05	29	266.4776	0.1590535	12220.9	2330.329	5.979938E-23	21	830.5473	0.1195034	13939.27	1905.448	1.045757E-31	16	1077.712	0.1647532	13854.85	2752.606	8.088476E-24	38	1050.868	0.139721	15925.56	2602.768	1.021299E-20	42	619.4297	0.1612547	10513.56	2040.531	4.639043E-17	30	742.1589	0.1647963	15138.96	3006.84	5.220469E-36	13	1261.874	CASP6	CASP6_P201_F	73622128	NM_001226.3	CASP6	839	4	36.1	110844279	-201	Y	TCCAGGCCCGCTGGGACTAACCGTGCCCTGGGGACATGCCAGTTGCCAC	MCH2	isoform alpha preproprotein is encoded by transcript variant alpha; caspase 6, apoptosis-related cysteine protease; apoptotic protease MCH-2; go_function: caspase activity; go_function: protein binding; go_function: cysteine-type peptidase activity; go_process: apoptosis; go_process: proteolysis; go_process: induction of apoptosis	caspase 6 isoform alpha preproprotein
CASP6_P230_R	4259	0.05255241	2672.676	153.793	0.1315364	30	82.27042	0.0572164	7700.62	473.4102	1.204931E-06	29	309.1094	0.06047797	8569.112	558.0394	7.991634E-09	25	375.2378	0.0241309	5918.736	148.8289	0.002143525	32	140.0517	0.05839253	7702.058	483.8342	4.259082E-07	27	262.6288	0.08663238	7721.76	741.8893	1.32201E-08	35	276.4087	0.05280037	7803.784	440.5858	9.78441E-06	22	378.1002	0.04566909	8075.459	391.2331	0.0001923852	36	338.9136	0.06590616	7118.803	509.3316	3.75584E-06	38	282.2413	0.04668888	7717.807	382.881	7.246581E-07	36	239.829	CASP6	CASP6_P230_R	73622128	NM_001226.3	CASP6	839	4	36.1	110844308	-230	Y	TGCCCTGGGGACATGCCAGTTGCCACCCGGGGGGACACACAGACCGCCTAGC	MCH2	isoform alpha preproprotein is encoded by transcript variant alpha; caspase 6, apoptosis-related cysteine protease; apoptotic protease MCH-2; go_function: caspase activity; go_function: protein binding; go_function: cysteine-type peptidase activity; go_process: apoptosis; go_process: proteolysis; go_process: induction of apoptosis	caspase 6 isoform alpha preproprotein
CASP8_E474_F	4042	0.1505641	6137.146	1105.545	2.088862E-07	32	234.7952	0.1164743	12156.86	1615.81	5.733887E-19	27	1066.638	0.07809487	13679.72	1167.284	2.874202E-24	29	841.6917	0.02827647	7370.724	217.3928	5.823901E-05	38	364.3108	0.1050054	12454.33	1472.938	6.015752E-21	26	917.9816	0.1231312	13169.05	1863.259	2.204879E-28	29	981.5685	0.1494771	13440.52	2379.711	1.611005E-21	24	672.8959	0.1091799	15696.89	1936.084	1.047795E-18	26	876.308	0.1456555	10237.36	1762.395	1.609303E-15	24	827.1542	0.1077466	15290.64	1858.54	5.418072E-32	28	798.3046	CASP8	CASP8_E474_F	73623018	NM_001228.3	CASP8	841	2	36.1	201806900	474	N	CCTTGCCCAGAGGCTGCGGGCTGCGGGTCAAGACATCAGTAGAAGGAGG	CAP4, MACH, MCH5, FLICE, MGC78473	isoform A is encoded by transcript variant A; caspase 8, apoptosis-related cysteine protease; Mch5 isoform alpha; FADD-homologous ICE/CED-3-like protease; MACH-alpha-1/2/3 protein; MACH-beta-1/2/3/4 protein; procaspase-8L; go_component: cytoskeleton; go_component: mitochondrion; go_function: caspase activity; go_function: identical protein binding; go_function: signal transducer activity; go_function: cysteine-type peptidase activity; go_process: proteolysis; go_process: apoptotic program; go_process: regulation of apoptosis; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	caspase 8 isoform A
CAV1_P130_R	2326	0.1331806	9339.235	1450.271	9.72036E-17	35	531.3565	0.09207278	9652.808	989.0309	3.405847E-11	32	646.5781	0.07969193	11038.3	964.4951	1.565072E-15	32	506.0774	0.09739497	6636.99	726.9502	0.0001051083	34	248.7995	0.09159399	8752.941	892.6364	7.699984E-10	22	1071.417	0.1076224	9392.432	1144.805	1.724028E-13	22	813.1287	0.07615372	12127.75	1007.947	1.289919E-14	26	523.8879	0.08287127	13047.44	1187.995	4.423738E-12	30	599.7424	0.1017557	7846.643	900.2184	4.405462E-08	36	443.9381	0.09106255	12123.61	1224.631	5.871125E-19	22	619.3757	CAV1	CAV1_P130_R	15451855	NM_001753.3	CAV1	857	7	36.1	115951945	-130	Y	CATACTGGGCATCTCTGCAGGCGCGTCGGCTCCCTCCACCCCTGCTGAGAT	CAV, VIP21, MSTP085	caveolae protein, 22-kD; caveolin 1 caveolae protein, 22kD; caveolin 1, alpha isoform; caveolin 1, beta isoform; cell growth-inhibiting protein 32; go_component: membrane; go_component: lipid raft; go_component: caveolar membrane; go_component: Golgi membrane; go_component: integral to membrane; go_component: caveolar membrane; go_component: endoplasmic reticulum; go_component: integral to plasma membrane; go_function: protein binding; go_function: cholesterol binding; go_function: structural molecule activity; go_process: cholesterol transport; go_process: cholesterol homeostasis	caveolin 1
CAV1_P169_F	2327	0.05052285	5584.462	302.4772	5.886938E-05	23	197.7854	0.3206882	7678.656	3672.132	9.310224E-13	27	437.9318	0.3328436	8900.84	4490.51	1.554671E-19	25	547.3464	0.04311475	5403.783	247.9861	0.004889725	26	189.6461	0.371197	6750.805	4044.188	2.263686E-12	26	370.5889	0.398818	7187.422	4834.402	9.366602E-18	34	559.8564	0.3707867	7780.107	4643.638	4.999145E-13	26	443.0651	0.371309	9141.096	5457.852	1.029841E-12	34	413.2336	0.3046629	6700.685	2979.729	6.141844E-10	40	430.9861	0.3065722	8280.481	3705.104	3.663083E-15	32	421.8624	CAV1	CAV1_P169_F	15451855	NM_001753.3	CAV1	857	7	36.1	115951906	-169	Y	GGCAGGATTGTGGATTGTTTCTGCCGCCTTGGTTGCCCATACTGGGCATC	CAV, VIP21, MSTP085	caveolae protein, 22-kD; caveolin 1 caveolae protein, 22kD; caveolin 1, alpha isoform; caveolin 1, beta isoform; cell growth-inhibiting protein 32; go_component: membrane; go_component: lipid raft; go_component: caveolar membrane; go_component: Golgi membrane; go_component: integral to membrane; go_component: caveolar membrane; go_component: endoplasmic reticulum; go_component: integral to plasma membrane; go_function: protein binding; go_function: cholesterol binding; go_function: structural molecule activity; go_process: cholesterol transport; go_process: cholesterol homeostasis	caveolin 1
CAV2_E33_R	5468	0.106448	2226.256	277.1247	0.2030503	24	97.06332	0.04276979	8859.684	400.3256	1.7763E-08	20	415.5965	0.04117129	9405.954	408.1776	3.113102E-10	27	369.6439	0.03433689	4655.725	169.1033	0.02061674	36	200.5721	0.03369964	8201.701	289.5211	1.256269E-07	33	243.1161	0.09110215	8487.546	860.761	1.547252E-10	24	404.2416	0.04040717	7952.836	339.0941	8.451212E-06	31	282.5928	0.05583202	9481.264	566.5743	4.339513E-06	28	289.4182	0.05444384	7666.361	447.1765	5.971264E-07	23	488.7073	0.05312124	9042.122	512.886	1.547656E-09	39	280.3499	CAV2	CAV2_E33_R	38176291	NM_198212.1	CAV2	858	7	36.1	115926713	33	Y	AAGGCCGTTGTCTTCCCTGGGACGACTTGCCAGCTCTGAGGCATGACAGTACGG	CAV, MGC12294	isoform c is encoded by transcript variant 2; caveolae protein, 20-kD; go_component: lipid raft; go_component: caveolar membrane; go_component: perinuclear region; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein homodimerization activity	caveolin 2 isoform c
CCKAR_E79_F	2459	0.4106664	1423.718	1061.775	0.2075908	34	87.27939	0.9297712	697.5756	10559.25	1.523268E-12	26	475.6635	0.9353271	741.9564	12176.74	4.076075E-18	29	633.7472	0.2205276	696.1333	225.2413	0.6981055	34	29.96852	0.92444	703.8083	9834.213	8.899601E-12	29	344.181	0.9300976	701.0602	10658.63	8.978702E-16	37	362.8825	0.92262	883.2081	11723.02	2.001933E-13	28	547.1569	0.9321815	806.7264	12463.17	1.734675E-10	32	420.028	0.9005656	903.9371	9092.534	1.286365E-10	39	345.2764	0.9340213	734.1622	11808.74	1.168169E-16	27	551.9973	CCKAR	CCKAR_E79_F	63054823	NM_000730.2	CCKAR	886	4	36.1	26101061	79	N	CCGGCTCATTCCTCTAATGACCGAAGCGTCTCGCAGATGCAACCTGCCG	CCK-A, CCKRA, CCK1-R	cholecystokinin-1 receptor; cholecystokinin type-A receptor; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: cholecystokinin receptor activity; go_process: digestion; go_process: signal transduction; go_process: feeding behavior; go_process: response to nutrient; go_process: smooth muscle contraction; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	cholecystokinin A receptor
CCKAR_P270_F	1749	0.5513346	1193.938	1590.033	0.1397985	45	79.4823	0.8968244	860.0807	8345.226	2.22921E-08	20	363.7763	0.9129082	793.2955	9363.646	5.554679E-11	19	447.0354	0.2689198	300.655	147.3765	0.7965631	19	25.80564	0.9157273	688.4636	8567.631	4.676078E-09	25	317.2722	0.894421	955.3538	8940.519	7.594671E-12	25	530.7585	0.9128256	788.174	9300.294	1.582104E-08	31	677.1086	0.9103091	1048.771	11659.35	1.281285E-09	31	322.3967	0.8801988	892.6553	7293.197	4.487123E-07	30	369.2968	0.9248409	654.6398	9285.927	2.481186E-10	27	240.4285	CCKAR	CCKAR_P270_F	63054823	NM_000730.2	CCKAR	886	4	36.1	26101410	-270	N	CCAGTACTCCTCTATATAGGAACCCGTCACCATCCCAGACATATGCAGAA	CCK-A, CCKRA, CCK1-R	cholecystokinin-1 receptor; cholecystokinin type-A receptor; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: cholecystokinin receptor activity; go_process: digestion; go_process: signal transduction; go_process: feeding behavior; go_process: response to nutrient; go_process: smooth muscle contraction; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	cholecystokinin A receptor
CCKBR_P361_R	1756	0.02340246	31717.14	762.4424	3.678E-38	27	611.1125	0.05093459	16757.96	904.7354	8.918858E-32	27	1522.492	0.03670384	23190.44	887.4203	3.678E-38	32	1168.037	0.03388847	18110.62	638.7773	2.811399E-29	28	1747.413	0.03425982	19286.61	687.7438	3.678E-38	25	1294.826	0.05962911	19390.53	1235.898	3.678E-38	29	1544.578	0.05724686	16489.7	1007.377	1.442683E-26	34	1327.203	0.05210862	22428.54	1238.466	2.082672E-34	36	1271.192	0.07218886	8891.275	699.5712	9.463075E-10	29	793.8917	0.04354865	22288.88	1019.399	3.678E-38	31	1262.932	CCKBR	CCKBR_P361_R	33356159	NM_176875.2	CCKBR	887	11	36.1	6237181	-361	Y	GCACGCAGACCTGGTCTCCAACGCCACCTCCACGTTCCCTGATACA	GASR, CCK-B	gastrin receptor; CCK2 receptor; cholecystokinin-B receptor/gastrin receptor; gastrincholecystokinin brain receptor; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: gastrin receptor activity; go_function: gastrin receptor activity; go_function: rhodopsin-like receptor activity; go_function: phosphoinositide phospholipase C activity; go_function: phosphoinositide phospholipase C activity; go_function: phosphatidylinositol 3-kinase regulator activity; go_function: phosphatidylinositol 3-kinase regulator activity; go_process: digestion; go_process: digestion; go_process: feeding behavior; go_process: cell proliferation; go_process: sensory perception; go_process: feeding behavior; go_process: cell proliferation; go_process: sensory perception; go_process: phospholipase C activation; go_process: phospholipase C activation; go_process: positive regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: elevation of cytosolic calcium ion concentration; go_process: elevation of cytosolic calcium ion concentration	cholecystokinin B receptor
CCKBR_P480_F	1753	0.1705074	804.4598	185.9174	0.6983649	28	31.42999	0.0511769	7523.889	411.2115	2.806834E-06	37	388.2788	0.07588605	7862.781	653.8848	1.132474E-07	31	376.243	0.08933719	2317.047	237.1154	0.2904992	24	136.1526	0.06389737	7049.045	487.9862	4.787898E-06	30	393.8401	0.09600214	6747.49	727.185	1.032913E-06	18	387.9185	0.063833	6273.644	434.59	0.0006452071	31	501.8237	0.07311922	8722.224	695.9624	2.153565E-05	23	348.9232	0.07409707	5067.213	413.5156	0.00250421	26	366.4993	0.04863574	10347.55	534.1006	1.996065E-12	29	367.368	CCKBR	CCKBR_P480_F	33356159	NM_176875.2	CCKBR	887	11	36.1	6237062	-480	Y	CGCAGCGAGGAGCTGCAGGGAACTACGGTAGCAATAGTGTCACGGTCACTGCGG	GASR, CCK-B	gastrin receptor; CCK2 receptor; cholecystokinin-B receptor/gastrin receptor; gastrincholecystokinin brain receptor; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: gastrin receptor activity; go_function: gastrin receptor activity; go_function: rhodopsin-like receptor activity; go_function: phosphoinositide phospholipase C activity; go_function: phosphoinositide phospholipase C activity; go_function: phosphatidylinositol 3-kinase regulator activity; go_function: phosphatidylinositol 3-kinase regulator activity; go_process: digestion; go_process: digestion; go_process: feeding behavior; go_process: cell proliferation; go_process: sensory perception; go_process: feeding behavior; go_process: cell proliferation; go_process: sensory perception; go_process: phospholipase C activation; go_process: phospholipase C activation; go_process: positive regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: elevation of cytosolic calcium ion concentration; go_process: elevation of cytosolic calcium ion concentration	cholecystokinin B receptor
CCL3_E53_R	2868	0.07085206	9497.396	731.8483	5.567355E-15	23	694.5031	0.4854872	11776.31	11206.33	3.678E-38	26	1879.867	0.4697099	11456.41	10236.21	3.678E-38	46	1242.975	0.1204081	6244.499	868.5041	0.0001986668	23	184.1544	0.4559447	13700.22	11565.25	3.678E-38	27	1193.477	0.3973107	12244.31	8137.734	3.678E-38	29	1306.056	0.4673312	10393.82	9206.639	1.058717E-33	34	1313.265	0.4854338	14340.15	13622.61	3.678E-38	26	878.0959	0.4682009	6643.318	5936.879	3.907786E-17	25	756.2624	0.5811086	11187.69	15658.88	3.678E-38	33	1048.823	CCL3	CCL3_E53_R	4506842	NM_002983.1	CCL3	6348	17	36.1	31441547	53	N	AGCAGGTGACGGAATGTGGGCTCGAGTGTCAGCAGAGCCAAGAAAGGACTG	MIP1A, SCYA3, G0S19-1, LD78ALPHA, MIP-1-alpha	Small inducible cytokine A3; small inducible cytokine A3 (homologous to mouse Mip-1a); LD78 alpha beta; go_component: extracellular space; go_component: soluble fraction; go_function: chemokine activity; go_function: signal transducer activity; go_process: chemotaxis; go_process: exocytosis; go_process: cell motility; go_process: sensory perception; go_process: cell-cell signaling; go_process: signal transduction; go_process: inflammatory response; go_process: calcium ion homeostasis; go_process: regulation of viral genome replication; go_process: cytoskeleton organization and biogenesis; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: G-protein coupled receptor protein signaling pathway	chemokine (C-C motif) ligand 3
CCL3_P543_R	1959	0.3806969	3628.606	2292.042	5.204149E-05	29	197.0117	0.9487318	1219.559	24418.77	3.678E-38	16	2095.863	0.9096757	1711.232	18241.32	3.678E-38	35	1265.061	0.4986144	2852.984	2936.662	0.00374809	36	198.9904	0.9258316	1679.889	22218.05	3.678E-38	36	1009.963	0.8793683	2062.408	15763.3	3.678E-38	30	849.4741	0.9155278	1613.659	18573	7.535543E-36	32	1037.074	0.935374	1607.767	24717.6	3.678E-38	29	1019.967	0.8758751	1496.992	11269.02	1.139071E-17	29	911.2028	0.9551558	1181.603	27297.43	3.678E-38	29	899.0844	CCL3	CCL3_P543_R	4506842	NM_002983.1	CCL3	6348	17	36.1	31442143	-543	N	ATGTAGTGACTAGGGCGCTGTGTTAAACGCTAGTTGTGGATCATAAAAATACTTT	MIP1A, SCYA3, G0S19-1, LD78ALPHA, MIP-1-alpha	Small inducible cytokine A3; small inducible cytokine A3 (homologous to mouse Mip-1a); LD78 alpha beta; go_component: extracellular space; go_component: soluble fraction; go_function: chemokine activity; go_function: signal transducer activity; go_process: chemotaxis; go_process: exocytosis; go_process: cell motility; go_process: sensory perception; go_process: cell-cell signaling; go_process: signal transduction; go_process: inflammatory response; go_process: calcium ion homeostasis; go_process: regulation of viral genome replication; go_process: cytoskeleton organization and biogenesis; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: G-protein coupled receptor protein signaling pathway	chemokine (C-C motif) ligand 3
CCNA1_E7_F	3049	0.0375891	4470.077	178.4945	0.003020694	28	193.0988	0.06437678	8836.293	614.8733	7.934322E-09	19	495.3741	0.05497981	9478.244	557.2474	1.031088E-10	34	395.9858	0.04137795	3560.142	157.9863	0.09419973	29	168.7265	0.08445017	8684.347	810.2667	1.565301E-09	26	296.9722	0.1296469	8665.983	1305.771	4.923094E-12	28	337.3284	0.06574448	9004.58	640.6982	8.533758E-08	28	390.3222	0.05130461	9785.568	534.6028	2.089572E-06	26	430.4326	0.1398431	8425.017	1385.985	3.242591E-10	26	465.5352	0.06590109	9185.739	655.1129	4.015858E-10	30	351.7826	CCNA1	CCNA1_E7_F	16306528	NM_003914.2	CCNA1	8900	13	36.1	35904640	7	Y	GCGATCCTCCAGTGCACTTGCCAGTTGTTCCGGACACATAGAAAGATAACGACGGGA	.	go_component: nucleus; go_component: cytosol; go_function: protein binding; go_process: meiosis; go_process: mitosis; go_process: cell division; go_process: male meiosis I; go_process: spermatogenesis; go_process: regulation of cyclin dependent protein kinase activity	cyclin A1
CCNA1_P216_F	186	0.03279441	10158.83	347.8395	7.736087E-16	22	497.5928	0.04283829	10406.96	470.2446	1.06166E-11	26	447.1207	0.04370563	12024.63	554.1332	3.933151E-17	38	405.9896	0.03040803	7502.771	238.4357	3.845742E-05	26	429.3556	0.04610946	10430.82	509.0422	1.028889E-12	30	455.1893	0.07614503	10657.31	886.6278	2.598118E-16	28	636.1735	0.04544405	10524.67	505.8143	3.268685E-10	35	505.3936	0.04589777	12931.99	626.9131	5.965591E-11	25	631.8661	0.06489313	9559.435	670.3308	3.905932E-11	22	450.9075	0.03873842	12832.88	521.1895	5.642682E-19	21	775.1769	CCNA1	CCNA1_P216_F	16306528	NM_003914.2	CCNA1	8900	13	36.1	35904417	-216	Y	CGCCGCTGATTGGCCGATTCAACAGACGCGGGTGGGCAGCTCAGCCGCATCG	.	go_component: nucleus; go_component: cytosol; go_function: protein binding; go_process: meiosis; go_process: mitosis; go_process: cell division; go_process: male meiosis I; go_process: spermatogenesis; go_process: regulation of cyclin dependent protein kinase activity	cyclin A1
CCNC_P132_R	5518	0.07325643	6557.962	526.2928	4.342863E-07	23	581.6629	0.0337909	17686.85	622.0533	3.042489E-34	28	1839.017	0.03162431	20734.71	680.4006	3.678E-38	24	969.5891	0.02782493	6359.864	184.8898	0.0007643364	24	267.6667	0.03032864	19077.96	599.8334	3.678E-38	33	1022.538	0.04920599	18048.79	939.246	3.678E-38	30	1656.322	0.03617864	15579.93	588.5724	1.604375E-22	22	1750.634	0.03924968	21323.83	875.2312	4.012382E-30	24	997.994	0.04764152	11079.52	559.2531	1.468073E-14	23	961.3808	0.02803341	22629.92	655.5754	3.678E-38	32	1118.841	CCNC	CCNC_P132_R	61676092	NM_001013399.1	CCNC	892	6	36.1	100123543	-132	Y	GAGTTGCTGAGTGGGTCTAACCTAGGCGAAGTGGCTCAGATACGGGGTT	.	isoform b is encoded by transcript variant 2; go_component: nucleus; go_process: cell division; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle	cyclin C isoform b
CCND1_E280_R	70	0.1953918	5073.876	1256.429	1.085836E-05	31	190.3327	0.05643485	11279.8	680.6282	3.408849E-14	26	460.8989	0.04528004	13979.06	667.7355	1.387218E-23	31	520.0603	0.7018414	652.3668	1771.01	0.3205543	25	117.3407	0.05181422	11605.97	639.6805	4.886189E-16	30	754.0001	0.07103723	12745.81	982.3118	1.878968E-23	30	722.0056	0.06095615	12189.68	797.7601	2.816253E-14	29	627.3893	0.06648578	15270.65	1094.712	4.76663E-16	26	921.1881	0.08060315	9929.495	879.2818	1.763475E-12	36	404.1727	0.06354503	11931.07	816.3922	3.154355E-17	34	499.4496	CCND1	CCND1_E280_R	16950654	NM_053056.1	CCND1	595	11	36.1	69165334	280	Y	CCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCG	BCL1, PRAD1, U21B31, D11S287E, cyclin D1	B-cell CLL/lymphoma 1; G1/S-specific cyclin D1; parathyroid adenomatosis 1; go_component: nucleus; go_function: protein binding; go_function: protein binding; go_process: cell division; go_process: G1/S transition of mitotic cell cycle; go_process: regulation of progression through cell cycle	cyclin D1
CCND1_P343_R	3085	0.1370431	3221.252	527.4363	0.02604947	33	150.4283	0.08751038	7349.477	714.4263	1.785786E-06	28	389.7008	0.0957448	8147.901	873.3083	1.28605E-08	30	399.4163	0.06185525	3204.446	217.874	0.131076	24	134.9898	0.09404472	7234.221	761.3453	8.876488E-07	35	401.5805	0.1055444	7726.619	923.5291	5.405022E-09	25	303.2502	0.1009904	7618.899	867.1035	4.600023E-06	28	298.0041	0.1409148	8333.518	1383.34	1.022746E-05	19	464.8903	0.09419827	6680.444	705.128	8.942375E-06	29	285.7924	0.09012923	7342.407	737.2239	7.852412E-07	40	310.0117	CCND1	CCND1_P343_R	16950654	NM_053056.1	CCND1	595	11	36.1	69164711	-343	Y	TTCTCGTGGTCTCCCCAGGCTGCGTGTGGCCTGCCGGCCTTCCTAGTTGTCC	BCL1, PRAD1, U21B31, D11S287E, cyclin D1	B-cell CLL/lymphoma 1; G1/S-specific cyclin D1; parathyroid adenomatosis 1; go_component: nucleus; go_function: protein binding; go_function: protein binding; go_process: cell division; go_process: G1/S transition of mitotic cell cycle; go_process: regulation of progression through cell cycle	cyclin D1
CCND2_P887_F	2329	0.0955173	1878.943	208.9849	0.3227763	32	56.7172	0.03485168	7270.987	266.1677	1.075161E-05	26	445.8894	0.0294108	9248.938	283.2916	1.21945E-09	14	535.5189	0.0335217	3808.461	135.5625	0.0716673	29	235.2936	0.02669214	7244.071	201.4049	6.608884E-06	33	245.7803	0.02767525	8566.601	246.6772	2.425558E-09	27	345.6579	0.02742081	7453.87	212.9731	5.344644E-05	32	349.0236	0.02706782	9029.095	253.9794	2.989077E-05	25	304.3005	0.06807624	5793.64	430.5254	0.0003553373	36	300.2263	0.03273346	8623.653	295.2189	2.639278E-08	35	415.4933	CCND2	CCND2_P887_F	16950656	NM_001759.2	CCND2	894	12	36.1	4252312	-887	Y	CGGTGTGGCCACGCTCAGCGCAGACACCTCGGGCGGCTTGTCAGCAGATGCAG	KIAK0002, MGC102758	G1/S-specific cyclin D2; go_component: nucleus; go_function: protein binding; go_process: cell cycle; go_process: cell division; go_process: regulation of progression through cell cycle	cyclin D2
CCND2_P898_R	2328	0.09991276	3381.982	386.5119	0.02499829	26	109.5464	0.0268506	10683.46	297.5313	6.290984E-12	30	473.2203	0.02968113	10653.9	328.9516	6.565485E-13	21	1084.005	0.05645377	3868.217	237.4243	0.05826748	28	153.3599	0.02881513	9079.956	272.37	3.01872E-09	21	596.2228	0.02913421	12243.65	370.4141	1.231931E-19	19	818.1674	0.0311421	11501.09	372.895	7.179163E-12	26	780.5261	0.03384662	14930.09	526.5392	2.8009E-14	27	787.995	0.0452865	9821.85	470.6395	2.819421E-11	25	551.6115	0.03061475	12075.44	384.5201	1.972774E-16	22	925.1084	CCND2	CCND2_P898_R	16950656	NM_001759.2	CCND2	894	12	36.1	4252301	-898	Y	GCTGCATCGGTGTGGCCACGCTCAGCGCAGACACCTCGGGCGGCTTGTCAGCA	KIAK0002, MGC102758	G1/S-specific cyclin D2; go_component: nucleus; go_function: protein binding; go_process: cell cycle; go_process: cell division; go_process: regulation of progression through cell cycle	cyclin D2
CCND3_P435_F	3091	0.05970988	5776.206	373.1482	2.204027E-05	22	276.5556	0.09324039	12886.23	1335.349	2.876911E-20	33	908.6128	0.07983358	15572.23	1359.722	5.241554E-32	33	1035.076	0.2187201	4401.829	1260.291	0.004794337	28	260.774	0.09517846	12070.57	1280.226	3.48657E-19	28	1263.736	0.08957018	11300.48	1121.605	5.147138E-19	29	989.3949	0.1090895	15974.17	1968.237	5.287518E-28	30	1080.76	0.1011544	17061.11	1931.279	8.378474E-22	35	758.7142	0.0954206	7230.213	773.236	9.17143E-07	27	679.02	0.1162321	16395.38	2169.452	9.010107E-38	35	1014.657	CCND3	CCND3_P435_F	16950657	NM_001760.2	CCND3	896	6	36.1	42017965	-435	Y	ACTCACTACATCTTCACGAAAACTCGGAAACCGAGGCAACTGTCATTCAGTTGG	.	D3-type cyclin; G1/S-specific cyclin D3; go_component: nucleus; go_function: protein binding; go_function: protein binding; go_process: cell cycle; go_process: cell division; go_process: regulation of progression through cell cycle; go_process: regulation of progression through cell cycle	cyclin D3
CCNE1_P683_F	3096	0.02464858	8410.939	215.0841	1.536411E-10	33	268.1877	0.0936139	24611.56	2552.274	3.678E-38	29	1673.665	0.09125333	30028.07	3025.361	3.678E-38	31	684.4312	0.02631414	8016.727	219.3569	9.414764E-06	24	315.0414	0.09331659	22988.29	2376.266	3.678E-38	38	1737.551	0.1018485	26736.08	3043.155	3.678E-38	33	1549.985	0.102911	27620.46	3179.998	3.678E-38	25	1398.389	0.1098415	30799.97	3812.915	3.678E-38	27	1014.054	0.09628911	17050.05	1827.313	3.678E-38	31	2006.817	0.1040412	27642.29	3221.509	3.678E-38	27	1272.588	CCNE1	CCNE1_P683_F	17318560	NM_057182.1	CCNE1	898	19	36.1	34994058	-683	Y	AATGCACTGACGGATGAATGGACAGGCGGCCAGGAATAGCAGCCGGCCCCCAG	CCNE	isoform 2 is encoded by transcript variant 2; cyclin Es; cyclin Et; go_component: nucleus; go_function: protein binding; go_function: androgen receptor binding; go_function: transcription coactivator activity; go_process: cell cycle; go_process: cell division; go_process: androgen receptor signaling pathway; go_process: G1/S transition of mitotic cell cycle; go_process: regulation of progression through cell cycle; go_process: positive regulation of transcription, DNA-dependent	cyclin E1 isoform 2
CCR5_P630_R	1761	0.05782818	2927.126	185.7975	0.08459023	36	95.47942	0.1774508	6635.645	1453.099	1.63503E-06	30	254.1074	0.2071331	6475.474	1717.815	4.222035E-07	24	304.8083	0.4644264	3370.778	3009.709	0.001101321	31	273.6675	0.2636306	5364.65	1956.422	1.016387E-05	26	368.6006	0.2462019	6490.218	2152.465	5.604511E-09	35	230.7364	0.3311874	5346.316	2696.946	1.797468E-05	31	300.5602	0.3521611	5825.161	3220.88	5.24132E-05	27	278.2833	0.3518289	5166.889	2858.881	8.411993E-07	23	338.1966	0.1704923	6622.235	1381.65	1.046029E-06	34	171.6316	CCR5	CCR5_P630_R	4502638	NM_000579.1	CCR5	1234	3	36.1	58097	-630	N	ACTTCTAAACACCATTACATTGGGATTCGAATTTCAACATGAATTTTTGGGGAACACAA	CKR5, CD195, CKR-5, CCCKR5, CMKBR5, CC-CKR-5	chemr13; chemokine (C-C) receptor 5; C-C chemokine receptor 5; chemokine receptor CCR5; CCR5 chemokine receptor; CC chemokine receptor 5; C-C chemokine receptor type 5; go_component: endosome; go_component: cell surface; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: coreceptor activity; go_function: rhodopsin-like receptor activity; go_function: C-C chemokine receptor activity; go_function: phosphoinositide phospholipase C activity; go_process: chemotaxis; go_process: cell-cell signaling; go_process: inflammatory response; go_process: cellular defense response; go_process: elevation of cytosolic calcium ion concentration; go_process: G-protein coupled receptor protein signaling pathway	chemokine (C-C motif) receptor 5
CD1A_P414_R	208	0.6398858	1309.066	2503.766	0.02277345	31	139.7703	0.966769	495.7343	17331.37	2.146896E-32	22	1662.934	0.9650319	590.933	19067.98	3.678E-38	31	675.0053	0.8959867	508.7408	5243.788	0.004029184	25	162.0684	0.9575496	543.0986	14506.32	1.280538E-24	17	736.1738	0.9629324	627.8063	18906.75	3.678E-38	29	1022.339	0.9565108	607.5456	15561.93	1.594004E-22	18	1201.302	0.9623066	643.4765	18980.8	2.491573E-23	27	924.3457	0.9375645	654.2676	11326.48	1.811454E-15	31	961.4655	0.9691852	506.7581	19083.74	3.678E-38	25	1498.709	CD1A	CD1A_P414_R	27764864	NM_001763.1	CD1A	909	1	36.1	156490137	-414	N	AACATTGAAGTCAAAATTCTGGGCTGGCGTACATTAGTTAGGAGCCCCCATTTTAG	CD1	CD1A antigen, a polypeptide; thymocyte antigen CD1A; T-cell surface glycoprotein CD1a precursor; T-cell surface antigen T6/Leu-6; hTa1 thymocyte antigen; go_component: MHC class I protein complex; go_component: integral to plasma membrane; go_function: MHC class I receptor activity; go_process: antigen presentation	CD1A antigen precursor
CD1A_P6_F	206	0.3900079	4928.291	3214.915	2.255993E-09	29	244.0583	0.9209751	1401.137	17494.61	1.441612E-36	29	1392.076	0.9290277	1628.395	22624.71	3.678E-38	29	1183.63	0.4653208	4011.527	3578.181	5.799117E-05	28	406.1841	0.9209305	1546.716	19179.47	3.678E-38	30	1092.645	0.8968183	1807.752	16581.51	3.678E-38	31	1305.377	0.8925933	2172.222	18883.1	3.678E-38	35	1052.594	0.9285307	1776.289	24376.79	3.678E-38	19	785.9724	0.8908339	1479.367	12888.2	1.174E-22	20	1095.769	0.9315158	1561.938	22605.53	3.678E-38	31	1164.49	CD1A	CD1A_P6_F	27764864	NM_001763.1	CD1A	909	1	36.1	156490545	-6	N	TGGAGAAAAGGTGTTAGTTTGTACTGTCGCACAGGGCAGTCGTAGGAGACTCTG	CD1	CD1A antigen, a polypeptide; thymocyte antigen CD1A; T-cell surface glycoprotein CD1a precursor; T-cell surface antigen T6/Leu-6; hTa1 thymocyte antigen; go_component: MHC class I protein complex; go_component: integral to plasma membrane; go_function: MHC class I receptor activity; go_process: antigen presentation	CD1A antigen precursor
CD2_P68_F	209	0.04499876	6949.249	332.154	1.741674E-07	31	246.8889	0.2415045	8034.574	2590.043	3.704848E-11	25	379.466	0.2482133	8533.89	2850.605	6.553934E-14	23	467.7167	0.045713	4584.583	224.4046	0.02113838	26	190.8651	0.2281275	7903.21	2365.354	3.590313E-11	32	284.0068	0.2406446	7806.583	2505.647	6.712825E-13	31	365.9261	0.2379963	8476.185	2678.596	1.900685E-10	32	328.2192	0.2174933	9331.422	2621.41	1.612054E-08	43	279.911	0.2125548	6302.512	1728.227	8.251334E-07	33	476.9431	0.2644179	7907.887	2878.575	3.326398E-12	18	492.6299	CD2	CD2_P68_F	31542293	NM_001767.2	CD2	914	1	36.1	117098557	-68	N	TGTAAAGAGAGGCACGTGGTTAAGCTCTCGGGGTGTGGACTCCACCAGTC	T11, SRBC	lymphocyte-function antigen-2; go_component: integral to plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: receptor activity; go_function: receptor activity; go_process: T cell activation; go_process: T cell activation; go_process: cell-cell adhesion; go_process: cell-cell adhesion; go_process: induction of apoptosis; go_process: induction of apoptosis; go_process: induction of apoptosis; go_process: lipid raft polarization; go_process: lipid raft polarization; go_process: natural killer cell activation; go_process: regulation of T cell differentiation; go_process: regulation of T cell differentiation; go_process: cell surface receptor linked signal transduction; go_process: cell surface receptor linked signal transduction; go_process: positive regulation of dendritic cell activation	CD2 antigen (p50), sheep red blood cell receptor
CD34_E20_R	122	0.0959924	12255.15	1311.937	4.880391E-27	33	619.6071	0.1363633	11834.15	1884.334	8.16883E-19	33	606.4435	0.1235608	13937.63	1979.032	4.260361E-28	31	573.9561	0.08711837	10140.79	977.3021	3.456572E-10	36	365.8232	0.1559616	12216.13	2275.777	9.361303E-23	28	646.3608	0.1760325	11902.83	2564.286	3.478883E-26	37	791.764	0.1963161	11593.64	2856.409	8.156363E-18	30	664.6251	0.1843946	14729.2	3352.632	1.061468E-19	24	650.7293	0.1729313	8872.627	1876.081	2.454507E-12	34	571.9411	0.08513568	14028.05	1314.732	2.393718E-25	37	519.1508	CD34	CD34_E20_R	68342037	NM_001025109.1	CD34	947	1	36.1	206151286	20	N	TTAGGAGGGAGGCTGGGTTGCCGCCGTCGAGGCCAAAAAAGGTG	.	isoform a is encoded by transcript variant 1; hematopoietic progenitor cell antigen CD34; go_component: membrane; go_component: plasma membrane; go_component: integral to membrane; go_function: protein binding; go_process: cell adhesion	CD34 antigen isoform a
CD34_P339_R	3103	0.1367239	9119.556	1460.175	4.554458E-16	38	638.4981	0.4839492	6611.838	6294.319	1.366084E-16	17	522.6772	0.4993149	7546.912	7625.985	2.105905E-25	26	753.9204	0.1130006	5089.813	661.1638	0.004041331	25	381.4661	0.4475609	6161.132	5072.484	2.004051E-13	30	771.5882	0.5651143	6780.259	8940.587	3.45786E-31	35	719.9424	0.4435369	7911.68	6385.825	1.997829E-17	32	632.7547	0.5035806	7827.705	8042.065	4.540501E-15	28	761.4194	0.477955	6444.034	5991.35	1.006862E-16	27	907.8652	0.5003631	7765.795	7877.226	2.143711E-26	40	619.0621	CD34	CD34_P339_R	68342037	NM_001025109.1	CD34	947	1	36.1	206151645	-339	N	ATCCTGTGCTGTGTGTGAGTGAAGCGTCAGGAGTGAGCAGGTATACGTGACT	.	isoform a is encoded by transcript variant 1; hematopoietic progenitor cell antigen CD34; go_component: membrane; go_component: plasma membrane; go_component: integral to membrane; go_function: protein binding; go_process: cell adhesion	CD34 antigen isoform a
CD34_P780_R	3105	0.2762514	2465.104	979.0881	0.04740766	28	168.4664	0.4391418	5967.73	4750.922	2.335606E-11	23	724.7876	0.4908184	6351.338	6218.678	4.165497E-17	32	533.4377	0.1309015	2317.614	364.1352	0.2625165	23	124.0095	0.3751919	6337.419	3865.615	5.008621E-11	32	406.3058	0.5096165	5123.573	5428.443	1.574894E-13	21	919.7177	0.397924	6948.47	4658.474	2.49114E-11	38	510.1537	0.3526797	8163.119	4501.998	1.487107E-09	25	358.4818	0.4711822	4368.042	3981.073	2.327576E-07	32	426.5128	0.4175034	6935.529	5042.703	3.828902E-15	35	536.6766	CD34	CD34_P780_R	68342037	NM_001025109.1	CD34	947	1	36.1	206152086	-780	N	GGCAGCCTAGTCTTGGGGACGTAGAGACGGGAGAAAGGAGAAGCCAGCCT	.	isoform a is encoded by transcript variant 1; hematopoietic progenitor cell antigen CD34; go_component: membrane; go_component: plasma membrane; go_component: integral to membrane; go_function: protein binding; go_process: cell adhesion	CD34 antigen isoform a
CD40_E58_R	1558	0.100172	1774.959	208.7271	0.3568447	24	99.20119	0.1019314	5137.339	594.4417	0.001722615	20	367.1332	0.04793991	6483.683	331.5139	5.81955E-05	25	308.2119	0.07792176	1606.633	144.2218	0.490001	26	96.24714	0.06920583	4972.464	377.1447	0.002958532	28	335.6398	0.08081736	5998.734	536.2194	3.580723E-05	23	347.2538	0.08978467	5398.974	542.425	0.003539735	23	435.4817	0.05928607	6304.791	403.6454	0.005350594	28	294.8566	0.1175013	4187.548	570.8704	0.01241666	31	328.0729	0.06793603	6385.263	472.6961	5.421431E-05	25	167.6069	CD40	CD40_E58_R	23312370	NM_152854.1	CD40	958	20	36.1	44180371	58	Y	CGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGC	p50, Bp50, CDW40, MGC9013, TNFRSF5	isoform 2 precursor is encoded by transcript variant 2; tumor necrosis factor receptor superfamily, member 5; CD40L receptor; CD40 type II isoform; nerve growth factor receptor-related B-lymphocyte activation molecule; B cell-associated molecule; B cell surface antigen CD40; tumor necrosis factor receptor superfamily member 5; go_component: membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: development; go_process: immune response; go_process: signal transduction; go_process: platelet activation; go_process: B cell proliferation; go_process: inflammatory response; go_process: protein complex assembly; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	CD40 antigen isoform 2 precursor
CD40_P372_R	5537	0.1282194	2509.885	383.8556	0.1191588	26	165.4038	0.3001134	8578.154	3721.217	4.978786E-15	35	831.9976	0.1934738	11394.01	2757.243	6.157822E-22	26	661.3676	0.0476898	3924.753	201.5516	0.05670651	31	264.428	0.2279425	8353.259	2495.743	1.689521E-12	32	680.5927	0.319874	9884.474	4695.856	1.284292E-26	26	681.5117	0.1915109	10665.1	2549.984	8.455811E-15	26	664.8489	0.2318894	11703.38	3563.391	6.346693E-14	34	571.8875	0.2583302	9379.495	3301.793	2.003404E-17	28	638.9638	0.2093131	11970.37	3195.305	9.697375E-25	23	701.4364	CD40	CD40_P372_R	23312370	NM_152854.1	CD40	958	20	36.1	44179941	-372	Y	GGAACTTCCTCAGGCCTCTCCGCAGTGGAGCCTCTTTCGGTTCTGCCAGG	p50, Bp50, CDW40, MGC9013, TNFRSF5	isoform 2 precursor is encoded by transcript variant 2; tumor necrosis factor receptor superfamily, member 5; CD40L receptor; CD40 type II isoform; nerve growth factor receptor-related B-lymphocyte activation molecule; B cell-associated molecule; B cell surface antigen CD40; tumor necrosis factor receptor superfamily member 5; go_component: membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: development; go_process: immune response; go_process: signal transduction; go_process: platelet activation; go_process: B cell proliferation; go_process: inflammatory response; go_process: protein complex assembly; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	CD40 antigen isoform 2 precursor
CD44_E26_F	4049	0.1294067	4799.714	728.303	0.0002074218	24	322.6199	0.06376342	11942	820.1335	3.264478E-16	34	814.1854	0.04889954	19288.18	996.8169	3.678E-38	25	1441.388	0.06113352	6211.876	410.9926	0.0006400279	29	334.5743	0.06146649	15774.94	1039.683	4.885058E-31	37	799.8102	0.05719221	15376.6	938.835	1.010944E-33	26	1395.968	0.05575319	16114.91	957.4117	3.100723E-25	30	1256.722	0.05529819	18407.7	1083.35	5.283914E-23	32	905.5567	0.08852299	10744.63	1053.234	5.594716E-15	31	676.0075	0.04676708	20000	986.1373	3.678E-38	20	1066.275	CD44	CD44_E26_F	48255936	NM_001001389.1	CD44	960	11	36.1	35117019	26	Y	GAGAAGAAAGCCAGTGCGTCTCTGGGCGCAGGGGCCAGTGGGGCTC	IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1, CDW44, MUTCH-I, ECMR-III, MGC10468	isoform 2 precursor is encoded by transcript variant 2; cell surface glycoprotein CD44; antigen gp90 homing receptor; CDW44 antigen; phagocytic glycoprotein I; extracellular matrix receptor-III; GP90 lymphocyte homing/adhesion receptor; heparan sulfate proteoglycan; hyaluronate receptor; Hermes antigen; cell adhesion molecule (CD44); CD44 epithelial domain (CD44E); CD44 antigen (homing function and Indian blood group system); go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: collagen binding; go_function: hyaluronic acid binding; go_function: hyaluronic acid binding; go_process: cell adhesion; go_process: cell-cell adhesion; go_process: cell-matrix adhesion	CD44 antigen isoform 2 precursor
CD44_P87_F	2330	0.09785836	1070.124	126.9273	0.6312741	24	45.02438	0.1216126	6838.771	960.6715	4.477451E-06	22	400.5015	0.1201247	7214.826	998.6544	3.895968E-07	21	509.557	0.2907873	275.0935	153.7937	0.8000959	34	11.45514	0.1446551	5944.843	1022.298	3.298308E-05	33	283.2482	0.1393758	7246.852	1189.803	1.501851E-08	42	395.9805	0.1379735	6116.38	994.9758	0.0002378362	31	332.7305	0.1537586	7117.721	1311.43	0.000208561	27	446.6868	0.1226973	4933.196	703.9296	0.001704188	20	428.7731	0.1192024	7345.655	1007.655	2.712548E-07	33	340.9018	CD44	CD44_P87_F	48255936	NM_001001389.1	CD44	960	11	36.1	35116906	-87	Y	CTTGCTCCAGCCGGATTCAGAGAAATTTAGCGGGAAAGGAGAGGCCAAAGG	IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1, CDW44, MUTCH-I, ECMR-III, MGC10468	isoform 2 precursor is encoded by transcript variant 2; cell surface glycoprotein CD44; antigen gp90 homing receptor; CDW44 antigen; phagocytic glycoprotein I; extracellular matrix receptor-III; GP90 lymphocyte homing/adhesion receptor; heparan sulfate proteoglycan; hyaluronate receptor; Hermes antigen; cell adhesion molecule (CD44); CD44 epithelial domain (CD44E); CD44 antigen (homing function and Indian blood group system); go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: collagen binding; go_function: hyaluronic acid binding; go_function: hyaluronic acid binding; go_process: cell adhesion; go_process: cell-cell adhesion; go_process: cell-matrix adhesion	CD44 antigen isoform 2 precursor
CD81_P211_F	223	0.4767475	2791.292	2634.323	0.0002918663	24	334.3594	0.2217672	6635.383	1919.332	2.946305E-07	26	543.0155	0.2172454	7708.464	2167.157	2.296921E-10	21	357.6546	0.3205008	2210.13	1089.624	0.1489534	17	287.6729	0.2676851	6016.287	2235.703	3.284545E-07	29	435.0964	0.223948	6904.791	2021.397	1.378663E-09	34	305.5927	0.2423221	7338.227	2378.909	6.53289E-08	24	339.902	0.2020487	8922.461	2284.572	1.648957E-07	33	354.5893	0.2549669	4718.1	1648.861	0.0002355938	28	399.9374	0.2654627	5261.473	1937.643	1.806371E-05	41	182.0361	CD81	CD81_P211_F	62240999	NM_004356.3	CD81	975	11	36.1	2354912	-211	Y	CGACAGCAGCTTGGGGACGCCTCCCGCGCCCAGCACGGTGCACCTGGGCCC	S5.7, TAPA1, TSPAN28	target of antiproliferative antibody 1; 26 kDa cell surface protein TAPA-1; go_component: membrane; go_component: integral to plasma membrane; go_function: protein binding; go_process: protein localization; go_process: activation of MAPK activity; go_process: phosphoinositide metabolism; go_process: entry of virus into host cell; go_process: phosphatidylinositol biosynthesis; go_process: positive regulation of B cell proliferation; go_process: positive regulation of cell proliferation; go_process: positive regulation of peptidyl-tyrosine phosphorylation; go_process: virion attachment, binding of host cell surface receptor; go_process: positive regulation of 1-phosphatidylinositol 4-kinase activity	CD81 antigen
CD81_P272_R	220	0.05536471	8408.025	498.6521	2.965141E-11	30	262.4781	0.7587916	3593.623	11619.37	2.655154E-23	31	704.3293	0.7459587	4105.991	12350.33	3.842199E-30	27	732.6146	0.05418548	5297.438	309.2179	0.005325516	26	252.7529	0.7754574	2915.471	10413.92	4.038787E-19	31	547.4576	0.7611364	3433.086	11258.14	4.798323E-27	38	630.175	0.7474136	3506.095	10670.59	4.030922E-17	26	527.5661	0.7468355	4664.192	14054.37	3.694553E-21	28	831.6415	0.7944127	2474.979	9950.009	1.07713E-16	35	558.5297	0.6828668	4277.972	9426.863	5.003078E-20	32	370.4313	CD81	CD81_P272_R	62240999	NM_004356.3	CD81	975	11	36.1	2354851	-272	Y	ACGCTGCATGCCTGTCCTCAGGCGCGGCCCTGCTGCCACCCCCTTGGG	S5.7, TAPA1, TSPAN28	target of antiproliferative antibody 1; 26 kDa cell surface protein TAPA-1; go_component: membrane; go_component: integral to plasma membrane; go_function: protein binding; go_process: protein localization; go_process: activation of MAPK activity; go_process: phosphoinositide metabolism; go_process: entry of virus into host cell; go_process: phosphatidylinositol biosynthesis; go_process: positive regulation of B cell proliferation; go_process: positive regulation of cell proliferation; go_process: positive regulation of peptidyl-tyrosine phosphorylation; go_process: virion attachment, binding of host cell surface receptor; go_process: positive regulation of 1-phosphatidylinositol 4-kinase activity	CD81 antigen
CD82_P557_R	1967	0.06798032	2255.376	171.7981	0.2228048	37	79.01313	0.6620594	3257.675	6578.021	1.480114E-09	28	386.3522	0.5948786	4221.48	6345.643	6.447089E-12	26	370.3278	0.1213049	3700.411	524.6511	0.04969594	19	112.0193	0.5595935	4268.205	5550.37	3.360922E-10	25	323.9345	0.6270239	3697.08	6383.412	2.627475E-12	24	369.2847	0.6155624	3988.289	6546.179	2.651364E-09	28	306.5328	0.5232832	4930.41	5521.789	1.454115E-06	22	229.336	0.5798036	3775.045	5346.941	8.417095E-09	20	375.5147	0.744306	2573.152	7781.347	3.164857E-11	27	313.5388	CD82	CD82_P557_R	67782352	NM_002231.3	CD82	3732	11	36.1	44543160	-557	Y	AAAGTTCCTGGGCCCAGGCCGCCTCCTGATAGAGGCCCCGACTTAGG	R2, 4F9, C33, IA4, ST6, GR15, KAI1, SAR2, TSPAN27	isoform 1 is encoded by transcript variant 1; suppressor of tumorigenicity 6; R2 leukocyte antigen; kangai 1; C33 antigen; inducible membrane protein R2; kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monoclonal and antibody IA4)); go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding	CD82 antigen isoform 1
CD86_E65_F	2534	0.04897428	2654.689	141.8562	0.137318	28	100.8442	0.3769235	4383.813	2712.436	4.32901E-05	24	396.0107	0.365231	4445.489	2615.366	2.620996E-05	27	281.2777	0.285014	268.6065	146.9372	0.8025362	31	12.00524	0.4561071	3635.39	3132.488	6.205066E-05	25	426.5316	0.4254491	3805.435	2891.935	2.021711E-05	21	401.209	0.2957141	4269.404	1834.616	0.002520323	36	359.9582	0.3586422	4620.292	2639.55	0.002083061	32	288.2818	0.3835347	4350.867	2769.113	2.223079E-05	23	307.1739	0.3504839	4802.938	2645.663	7.762618E-06	25	300.6284	CD86	CD86_E65_F	29029570	NM_006889.2	CD86	942	3	36.1	123256976	65	N	GCTGCTGTAACAGGGACTAGCACAGACACACGGATGAGTGGGGTCATTTCC	B70, B7-2, LAB72, CD28LG2, MGC34413	isoform 2 precursor is encoded by transcript variant 2; CD28 antigen ligand 2; B7-2 antigen; B-lymphocyte activation antigen B7-2; CTLA-4 counter-receptor B7.2; go_component: plasma membrane; go_component: integral to membrane; go_function: protein binding; go_function: coreceptor activity; go_function: transcriptional activator activity; go_process: immune response; go_process: T cell activation; go_process: cell-cell signaling; go_process: positive regulation of transcription; go_process: positive regulation of cell proliferation; go_process: positive regulation of interleukin-2 biosynthesis; go_process: positive regulation of interleukin-4 biosynthesis; go_process: positive regulation of T-helper 2 cell differentiation; go_process: positive regulation of tumor necrosis factor-beta biosynthesis	CD86 antigen isoform 2 precursor
CD86_P3_F	1766	0.09028709	5169.917	523.0282	0.000117695	21	275.2607	0.4737544	6232.084	5700.481	3.98204E-14	32	582.0679	0.423605	7929.24	5900.86	6.651785E-21	26	607.4432	0.1074502	4513.059	555.3464	0.01387056	26	181.039	0.4307826	6658.946	5115.156	8.676596E-15	17	744.7394	0.5282164	5771.445	6573.763	9.061514E-19	21	1088.655	0.3410134	7503.662	3934.754	5.371332E-11	29	507.4207	0.416046	8304.618	5987.984	3.527241E-12	26	572.309	0.4881454	4809.355	4681.953	1.521418E-09	18	928.5994	0.3454341	9233.565	4925.602	1.952865E-21	24	677.5458	CD86	CD86_P3_F	29029570	NM_006889.2	CD86	942	3	36.1	123256908	-3	N	AAGTTAGCTGGGTAGGTATACAGTCATTGCCGAGGAAGGCTTGCACAGGGTG	B70, B7-2, LAB72, CD28LG2, MGC34413	isoform 2 precursor is encoded by transcript variant 2; CD28 antigen ligand 2; B7-2 antigen; B-lymphocyte activation antigen B7-2; CTLA-4 counter-receptor B7.2; go_component: plasma membrane; go_component: integral to membrane; go_function: protein binding; go_function: coreceptor activity; go_function: transcriptional activator activity; go_process: immune response; go_process: T cell activation; go_process: cell-cell signaling; go_process: positive regulation of transcription; go_process: positive regulation of cell proliferation; go_process: positive regulation of interleukin-2 biosynthesis; go_process: positive regulation of interleukin-4 biosynthesis; go_process: positive regulation of T-helper 2 cell differentiation; go_process: positive regulation of tumor necrosis factor-beta biosynthesis	CD86 antigen isoform 2 precursor
CD9_E14_R	5854	0.113528	3913.422	513.9876	0.005415165	26	181.8377	0.06506763	9446.353	664.3887	4.246787E-10	33	392.1317	0.05707427	10015.61	612.2866	4.646436E-12	33	659.1183	0.0846905	1525.972	150.4457	0.5094757	26	67.57707	0.06961531	8299.442	628.4818	1.99888E-08	31	518.7625	0.1013492	7323.636	837.232	5.377046E-08	26	408.7592	0.05943782	9254.105	591.1226	4.034005E-08	29	443.0744	0.04568821	11124.14	537.362	4.081591E-08	22	681.7801	0.08486003	7140.445	671.3994	1.903138E-06	35	318.8666	0.07017063	9819.729	748.6035	1.051465E-11	29	593.4374	CD9	CD9_E14_R	21237762	NM_001769.2	CD9	928	12	36.1	6179830	14	Y	CCGGAGACCAGCCTACAGCCGCCTGCATCTGTATCCAGCGCCAGGTCC	5H9, BA2, P24, GIG2, MIC3, MRP-1, BTCC-1, DRAP-27, TSPAN29	motility related protein; leukocyte antigen MIC3; antigen defined by monoclonal antibody 602-29; p24 antigen; growth-inhibiting gene 2 protein; 5H9 antigen; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein binding; go_process: cell adhesion; go_process: cell motility; go_process: platelet activation; go_process: paranodal junction assembly; go_process: fusion of sperm to egg plasma membrane	CD9 antigen
CD9_P504_F	5546	0.2178435	1946.271	569.9202	0.1998353	30	67.2489	0.5210266	3935.588	4389.907	6.94223E-07	27	728.8728	0.522436	4696.677	5247.374	1.633267E-10	29	495.1173	0.4251847	336.3055	322.7305	0.7552228	30	20.33421	0.4857126	4043.475	3913.255	1.028554E-06	27	375.626	0.5518011	3632.795	4595.639	3.952401E-08	24	516.9755	0.3502887	5906.139	3238.181	5.15006E-07	43	321.9818	0.4263765	6333.967	4782.392	2.161934E-07	32	325.7838	0.5603628	2868.723	3783.941	9.99679E-05	32	479.8054	0.471438	5367.718	4876.797	5.522039E-11	27	430.1748	CD9	CD9_P504_F	21237762	NM_001769.2	CD9	928	12	36.1	6179312	-504	Y	GCGAGCGAAGGTTTGCAAGGAGACAGACGAGGGCGAAATTAAGCCAGGCG	5H9, BA2, P24, GIG2, MIC3, MRP-1, BTCC-1, DRAP-27, TSPAN29	motility related protein; leukocyte antigen MIC3; antigen defined by monoclonal antibody 602-29; p24 antigen; growth-inhibiting gene 2 protein; 5H9 antigen; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein binding; go_process: cell adhesion; go_process: cell motility; go_process: platelet activation; go_process: paranodal junction assembly; go_process: fusion of sperm to egg plasma membrane	CD9 antigen
CD9_P585_R	5853	0.5675746	2105.166	2894.363	0.00111123	39	150.8022	0.7308108	2832.186	7960.47	1.619178E-11	24	846.9175	0.7043883	4075.74	9950.02	1.572048E-21	33	736.0316	0.4594476	1990.741	1777.045	0.08884567	32	149.3947	0.6729969	3295.627	6988.453	3.316982E-11	28	546.2369	0.7504726	3205.669	9942.051	2.030962E-21	35	634.2433	0.6293485	3817.793	6652.224	3.451511E-09	39	783.1168	0.6472391	4997.568	9352.921	2.801515E-12	24	699.3231	0.7262748	2140.003	5943.397	6.720369E-07	23	497.2538	0.6777692	4405.516	9476.751	1.429796E-20	26	704.4303	CD9	CD9_P585_R	21237762	NM_001769.2	CD9	928	12	36.1	6179231	-585	Y	CTGTCATCCCACCCAGACTGCGCGCTTCTAATTCCTCCTACCCCAC	5H9, BA2, P24, GIG2, MIC3, MRP-1, BTCC-1, DRAP-27, TSPAN29	motility related protein; leukocyte antigen MIC3; antigen defined by monoclonal antibody 602-29; p24 antigen; growth-inhibiting gene 2 protein; 5H9 antigen; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein binding; go_process: cell adhesion; go_process: cell motility; go_process: platelet activation; go_process: paranodal junction assembly; go_process: fusion of sperm to egg plasma membrane	CD9 antigen
CDC25B_E83_F	124	0.05783407	3669.278	231.374	0.01885673	29	160.4824	0.02412639	8777.578	219.4792	5.217202E-08	18	434.9206	0.03012824	9868.327	309.6576	4.985709E-11	32	424.352	0.03170974	5317.995	177.4294	0.006550858	33	226.2305	0.03737093	8331.544	327.3271	6.283226E-08	30	323.7891	0.03250158	7989.376	271.7498	3.401778E-08	31	286.3209	0.0310434	9565.715	309.6698	3.597276E-08	26	379.1996	0.04367272	9726.08	448.7289	3.095327E-06	32	424.1735	0.04639304	7584.542	373.8534	1.090991E-06	38	327.8882	0.03005647	8630.954	270.5535	2.842615E-08	24	347.6021	CDC25B	CDC25B_E83_F	47078250	NM_004358.3	CDC25B	994	20	36.1	3724469	83	Y	TGGAGCGAGCGAATCCTGGCCCACCGCCTGCCCAACCGCGTGACCTTGA	.	isoform 2 is encoded by transcript variant 2; go_component: intracellular; go_component: intracellular; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine phosphatase activity; go_process: mitosis; go_process: cell division; go_process: M phase of mitotic cell cycle; go_process: protein amino acid dephosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of progression through cell cycle	cell division cycle 25B isoform 2
CDC25B_P11_R	3183	0.20937	1123.661	324.0428	0.544391	33	58.69398	0.0627923	6271.374	426.8779	0.0001397469	30	394.5706	0.05595231	6851.78	412.0217	1.320944E-05	36	529.3822	0.144096	716.4292	137.4502	0.7133598	27	46.95551	0.06121395	5930.23	393.2038	0.0002346301	31	449.7023	0.07133093	6831.759	532.4274	1.614893E-06	33	353.0806	0.05741217	7048.987	435.4383	8.859215E-05	20	749.6589	0.07833176	6260.808	540.5994	0.004592619	22	533.6031	0.09553052	4337.501	468.6912	0.01126859	23	364.5129	0.05360089	8156.372	467.6134	9.095954E-08	28	330.468	CDC25B	CDC25B_P11_R	47078250	NM_004358.3	CDC25B	994	20	36.1	3724375	-11	Y	CTCCTACGCTGGGCGCTTCTCCTGCGAATGACGTTTTGCTGCTGCTCAGCGCAGCC	.	isoform 2 is encoded by transcript variant 2; go_component: intracellular; go_component: intracellular; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine phosphatase activity; go_process: mitosis; go_process: cell division; go_process: M phase of mitotic cell cycle; go_process: protein amino acid dephosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of progression through cell cycle	cell division cycle 25B isoform 2
CDC25C_E168_R	147	0.2502562	897.3936	332.919	0.6200231	24	82.85778	0.4449376	4231.548	3472.165	6.189701E-06	32	531.3822	0.5374502	3699.681	4414.961	5.761039E-07	27	429.3848	0.4685853	555.5533	578.0469	0.6479412	16	38.49538	0.4839993	4021.793	3866.167	1.332363E-06	21	437.723	0.5302045	3328.917	3869.827	3.106334E-06	23	564.1345	0.5362539	4152.004	4916.816	6.686302E-07	25	302.7666	0.4873586	4748.506	4609.383	2.494589E-05	29	344.4297	0.4835841	3040.154	2940.515	0.0006971863	33	464.9445	0.5247622	4968.698	5596.905	1.066531E-11	23	412.3717	CDC25C	CDC25C_E168_R	12408657	NM_022809.1	CDC25C	995	5	36.1	137695247	168	Y	GAGAGAAAGTAGATAGGGATCGGACACAGGCGAAGACTTGAGCAGAATGAAAGGA	CDC25	isoform b is encoded by transcript variant 2; m-phase inducer phosphatase 3; dual specificity phosphatase CDC25C; mitosis inducer CDC25; phosphotyrosine phosphatase; go_component: nucleus; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_process: cell cycle; go_process: cell division; go_process: cell proliferation; go_process: regulation of mitosis; go_process: protein amino acid dephosphorylation; go_process: traversing start control point of mitotic cell cycle; go_process: regulation of cyclin dependent protein kinase activity	cell division cycle 25C protein isoform b
CDH1_P45_F	2352	0.06452283	2318.749	166.8288	0.2075692	35	76.56561	0.1112669	6030.701	767.5464	0.0001048983	25	300.3962	0.1069959	6722.762	817.4744	4.999342E-06	30	222.1935	0.04061933	4183.157	181.3451	0.0409943	34	224.1578	0.1022278	5995.571	694.0926	7.904084E-05	25	300.5881	0.1568664	5592.548	1059.108	2.378725E-05	30	220.6419	0.1102669	6229.868	784.477	0.0003043834	33	333.7811	0.1529795	7255.531	1328.475	0.0001490758	27	237.8128	0.1691049	5759.952	1192.626	3.864818E-05	32	259.0132	0.1102033	6388.67	803.6366	1.847599E-05	26	271.9052	CDH1	CDH1_P45_F	14589887	NM_004360.2	CDH1	999	16	36.1	67328651	-45	Y	CTCAGCCAATCAGCGGTACGGGGGGCGGTGCCTCCGGGGCTCACCT	UVO, CDHE, ECAD, LCAM, Arc-1, CD324	calcium-dependent adhesion protein, epithelial; cadherin 1, E-cadherin (epithelial); cell-CAM 120/80; uvomorulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: homophilic cell adhesion; go_process: homophilic cell adhesion	cadherin 1, type 1 preproprotein
CDH1_P52_R	2350	0.1009828	5013.202	574.3444	0.0001694548	28	249.2646	0.07787608	9284.049	792.5105	4.970334E-10	33	562.2184	0.08610438	11272.21	1071.454	1.811823E-16	25	584.3732	0.0551294	2936.757	177.1826	0.179031	24	134.1534	0.09089333	8785.379	888.3684	6.735527E-10	30	484.9769	0.1433139	7210.687	1222.995	1.523055E-08	29	483.118	0.1122447	8240.354	1054.525	3.036549E-07	29	718.9374	0.09038356	12442.41	1246.27	3.662462E-11	23	465.9096	0.1122942	6996.869	897.7496	1.392045E-06	29	444.9135	0.0865843	11922.76	1139.659	4.009235E-18	18	704.0269	CDH1	CDH1_P52_R	14589887	NM_004360.2	CDH1	999	16	36.1	67328644	-52	Y	CCCTCAGCCAATCAGCGGTACGGGGGGCGGTGCCTCCGGGGCTCACC	UVO, CDHE, ECAD, LCAM, Arc-1, CD324	calcium-dependent adhesion protein, epithelial; cadherin 1, E-cadherin (epithelial); cell-CAM 120/80; uvomorulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: homophilic cell adhesion; go_process: homophilic cell adhesion	cadherin 1, type 1 preproprotein
CDH11_E102_R	172	0.06377929	4061.005	283.4652	0.006678663	30	124.7955	0.07170006	9170.804	716.0587	1.176865E-09	25	519.1728	0.08367698	10937.26	1007.903	2.238211E-15	32	429.1365	0.05631939	4027.298	246.3195	0.04651229	19	113.8145	0.09923399	9457.057	1052.865	1.031302E-11	24	648.4313	0.1666683	10060.86	2032.196	5.633259E-18	26	549.4755	0.1103361	9751.16	1221.741	4.192E-10	31	493.9404	0.08330869	12962.07	1187.078	6.214157E-12	31	645.9105	0.1216462	8537.628	1196.255	4.734199E-10	25	449.2934	0.07776147	12011.54	1021.223	4.880773E-18	31	502.3008	CDH11	CDH11_E102_R	16306531	NM_001797.2	CDH11	1009	16	36.1	63713318	102	Y	GAGGGTGGACGCAACCTCCGAGCCGCCAGTCCCTGGCGCAGGGCAAGCG	OB, CAD11, CDHOB, OSF-4	osteoblast cadherin; cadherin-11; OB-cadherin; go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: ossification; go_process: homophilic cell adhesion; go_process: homophilic cell adhesion	cadherin 11, type 2 preproprotein
CDH11_P203_R	3237	0.1991418	4221.211	1074.515	0.0004450593	26	242.6228	0.09845276	9528.667	1051.491	4.600425E-11	33	733.0663	0.1013522	16498.98	1872.083	5.211866E-38	34	695.3285	0.07334805	3399.074	276.9651	0.098921	23	163.9271	0.0641848	12366.74	855.0572	8.423138E-19	30	737.5422	0.2015363	12577.14	3199.773	2.015154E-31	42	914.0392	0.09183106	10398.76	1061.6	4.863485E-11	29	1263.301	0.06061114	17702.47	1148.649	1.806765E-21	27	803.031	0.137128	8467.669	1361.577	2.963381E-10	33	488.7087	0.04612205	17494.67	850.7401	7.645123E-37	30	862.8486	CDH11	CDH11_P203_R	16306531	NM_001797.2	CDH11	1009	16	36.1	63713623	-203	Y	GAGAAGCCGAGGCTGCGAGAGGCAGCGAGATGGGCCTCGCAGAGGCT	OB, CAD11, CDHOB, OSF-4	osteoblast cadherin; cadherin-11; OB-cadherin; go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: ossification; go_process: homophilic cell adhesion; go_process: homophilic cell adhesion	cadherin 11, type 2 preproprotein
CDH11_P354_R	3284	0.06561673	7662.692	545.1323	1.591224E-09	29	344.8412	0.4323224	7042.501	5439.468	1.722224E-15	29	542.1463	0.3522485	10414.12	5717.596	6.663025E-29	27	1014.45	0.1435581	2407.882	420.375	0.2321773	24	272.2267	0.3468558	9662.735	5184.555	6.197612E-24	32	493.183	0.6034775	7832.188	12072.19	3.678E-38	34	1003.285	0.399618	9969.167	6702.1	5.200066E-24	36	712.0135	0.4043016	11207.9	7674.694	1.523271E-21	32	914.4257	0.4590539	7601.945	6535.97	6.695147E-22	24	648.4197	0.3465042	11411.58	6103.806	1.936656E-33	44	547.5109	CDH11	CDH11_P354_R	16306531	NM_001797.2	CDH11	1009	16	36.1	63713774	-354	Y	TCAGGGCTCAGATGGAGTCTGGAGCGACTGAAGTTGGGCTCCAGGG	OB, CAD11, CDHOB, OSF-4	osteoblast cadherin; cadherin-11; OB-cadherin; go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: ossification; go_process: homophilic cell adhesion; go_process: homophilic cell adhesion	cadherin 11, type 2 preproprotein
CDH13_E102_F	4061	0.07853639	4286.957	373.9005	0.002921248	37	204.9275	0.1433828	8421.286	1426.315	1.403394E-09	43	423.0165	0.1445753	10000.7	1707.118	9.564435E-15	31	480.4219	0.4615598	3076.183	2722.676	0.003681107	33	233.7462	0.1780112	8552.945	1873.895	1.5904E-11	34	710.8262	0.2706664	9153.763	3434.208	1.498337E-19	29	793.3713	0.1238673	8393.661	1200.83	1.029286E-07	23	463.819	0.1673075	10277.59	2085.101	4.171076E-09	34	592.2625	0.1259285	8399.199	1224.49	8.080429E-10	30	446.8738	0.0977984	10634.46	1163.613	1.121881E-14	28	610.034	CDH13	CDH13_E102_F	61676095	NM_001257.3	CDH13	1012	16	36.1	81218181	102	Y	GTGCATGAATGAAAACGCCGCCGGGCGCTTCTAGTCGGACAAAATGCAGCCGA	CDHH	H-cadherin; heart-cadherin; T-cadherin; truncated-cadherin; P105; go_component: membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: homophilic cell adhesion	cadherin 13 preproprotein
CDH13_P88_F	2356	0.06013597	4527.782	296.1026	0.001853928	28	218.4278	0.408708	5218.144	3675.963	7.877166E-08	32	323.045	0.3632304	6329.272	3667.429	1.254009E-10	24	384.7252	0.05902499	4165.303	267.5517	0.0372043	22	173.0771	0.289861	5288.996	2199.654	5.680314E-06	27	378.2144	0.6037589	3969.249	6200.378	1.561121E-12	31	284.3562	0.3100475	5957.153	2721.934	2.469706E-06	30	264.6433	0.269633	6939.068	2598.646	1.603869E-05	32	251.985	0.3842457	4878.421	3106.656	9.845556E-07	37	373.4028	0.2972189	6119.413	2630.303	5.399281E-08	34	238.1	CDH13	CDH13_P88_F	61676095	NM_001257.3	CDH13	1012	16	36.1	81217991	-88	Y	CCGTATCTGCCATGCAAAACGAGGGAGCGTTAGGAAGGAATCCGTCTTGTAA	CDHH	H-cadherin; heart-cadherin; T-cadherin; truncated-cadherin; P105; go_component: membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: homophilic cell adhesion	cadherin 13 preproprotein
CDH17_E31_F	5476	0.7600427	1141.412	3932.059	0.0008897279	23	140.4366	0.9706231	455.286	18346.88	3.4265E-36	20	1500.511	0.9773417	464.9385	24368	3.678E-38	18	1178.913	0.8883566	562.3704	5270.539	0.003442746	26	194.3889	0.9702075	433.7971	17383.38	4.933036E-35	14	894.9522	0.9637613	503.1961	16041.9	9.955517E-35	33	1221.178	0.9707268	485.1221	19403.2	9.524209E-35	28	1316.066	0.9707432	520.6277	20592.48	3.807415E-27	15	1495.014	0.9546325	484.9815	12309.31	9.424495E-18	39	816.9608	0.9780179	423.6263	23296.9	3.678E-38	22	1248.177	CDH17	CDH17_E31_F	16507959	NM_004063.2	CDH17	1015	8	36.1	95289955	31	N	CCATTCAGTGGTCGAGACTCTTGCTACGACTGGAGTATCTCCCCCGGGAACAC	HPT1, CDH16, HPT-1, MGC138218	LI cadherin; liver-intestine cadherin; cadherin-16; human peptide transporter 1; human intestinal peptide-associated transporter HPT-1; HPT-1 cadherin; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: protein binding; go_function: calcium ion binding; go_function: transporter activity; go_process: transport; go_process: cell adhesion; go_process: homophilic cell adhesion	cadherin 17 precursor
CDH17_P376_F	4279	0.596014	1806.546	2812.791	0.003269691	24	230.5899	0.9227534	1083.34	14135.65	2.541174E-23	26	1046.812	0.931362	1249.67	18313.94	3.678E-38	27	816.7781	0.7388977	605.8492	1997.495	0.2795486	28	115.3735	0.9324502	1022.326	15492.47	6.831769E-30	23	862.3791	0.9214545	1331.438	16792.86	3.678E-38	26	882.903	0.9278526	1151.184	16090.88	9.191934E-26	30	824.314	0.9203234	1555.992	19127.92	5.154452E-26	39	614.1512	0.9094536	1109.494	12148.24	3.948621E-19	27	1323.338	0.9391708	987.887	16796.42	1.596629E-34	26	676.9293	CDH17	CDH17_P376_F	16507959	NM_004063.2	CDH17	1015	8	36.1	95290362	-376	N	ATTCCATCTCAAACACAAAAGACGGAGCAGGGGCGCCATGTCTGAGCAATGACA	HPT1, CDH16, HPT-1, MGC138218	LI cadherin; liver-intestine cadherin; cadherin-16; human peptide transporter 1; human intestinal peptide-associated transporter HPT-1; HPT-1 cadherin; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: protein binding; go_function: calcium ion binding; go_function: transporter activity; go_process: transport; go_process: cell adhesion; go_process: homophilic cell adhesion	cadherin 17 precursor
CDH17_P532_F	4283	0.6750603	2274.156	4932.295	2.473755E-07	37	290.6243	0.968192	612.3737	21683.66	3.678E-38	21	1196.89	0.9693943	639.8527	23433.82	3.678E-38	22	1295.769	0.7166322	1368.859	3714.719	0.01352209	28	216.9592	0.9661901	579.0754	19406.04	3.678E-38	38	1071.503	0.9667619	617.5217	20869.82	3.678E-38	30	1917.166	0.9623202	711.002	20712.51	3.678E-38	30	1573.605	0.9707818	681.869	25977.79	3.678E-38	26	912.8366	0.9342226	641.2523	10527.84	2.319844E-13	28	999.1628	0.9743413	548.2279	24615.27	3.678E-38	36	1085.152	CDH17	CDH17_P532_F	16507959	NM_004063.2	CDH17	1015	8	36.1	95290518	-532	N	CCAAAGTCTGCAAGAAACAACCGATAGCAAATTTCCCCCAAACAC	HPT1, CDH16, HPT-1, MGC138218	LI cadherin; liver-intestine cadherin; cadherin-16; human peptide transporter 1; human intestinal peptide-associated transporter HPT-1; HPT-1 cadherin; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: protein binding; go_function: calcium ion binding; go_function: transporter activity; go_process: transport; go_process: cell adhesion; go_process: homophilic cell adhesion	cadherin 17 precursor
CDH3_E100_R	3057	0.1196894	3267.205	457.8141	0.02735402	33	147.2466	0.09647297	9434.607	1018.046	8.510618E-11	37	483.4409	0.1078203	11921.46	1452.797	1.753732E-19	37	578.9821	0.04204039	5353.875	239.3452	0.005461816	14	154.7684	0.1180623	10098	1365.176	5.391234E-14	31	588.6032	0.1222913	10109.04	1422.427	2.827588E-16	35	365.0037	0.1266943	10073.81	1475.959	3.237724E-11	30	609.3566	0.1128368	12617.54	1617.524	4.430092E-12	31	546.821	0.1289704	8798.799	1317.615	6.998164E-11	40	493.4145	0.09105525	13968.31	1409.319	1.81389E-25	26	581.181	CDH3	CDH3_E100_R	45269142	NM_001793.3	CDH3	1001	16	36.1	67236377	100	Y	ATGCGGAGCCTCCGTTTTCAGTCGACTTCAGATGTGTCTCCACTTTTTTCC	CDHP, HJMD, PCAD	placental cadherin; P-cadherin; cadherin 3, P-cadherin (placental); calcium-dependent adhesion protein, placental; go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: visual perception; go_process: sensory perception; go_process: homophilic cell adhesion	cadherin 3, type 1 preproprotein
CDH3_P87_R	230	0.1376595	1848.986	311.1258	0.3000073	32	86.12437	0.1633949	5162.362	1027.776	0.0005550338	28	300.5283	0.1634598	5470.63	1088.5	0.0001288172	29	242.0759	0.1938583	735.329	200.8772	0.6947051	28	57.41481	0.1680962	4482.426	925.9341	0.002576485	25	299.9787	0.1770394	5351.932	1172.847	3.709145E-05	24	271.8974	0.172946	5525.811	1176.418	0.0006545156	29	291.394	0.1803037	6424.972	1435.259	0.0006727583	31	377.6613	0.2079553	4917.335	1317.326	0.0003449013	40	346.9713	0.1529532	6750.311	1236.976	1.113392E-06	31	415.5132	CDH3	CDH3_P87_R	45269142	NM_001793.3	CDH3	1001	16	36.1	67236190	-87	Y	GGAAGTTGTATCCAATTCAGAAACGCGGTCCTTCGGGACCTGCTAGTTTTATACCC	CDHP, HJMD, PCAD	placental cadherin; P-cadherin; cadherin 3, P-cadherin (placental); calcium-dependent adhesion protein, placental; go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: visual perception; go_process: sensory perception; go_process: homophilic cell adhesion	cadherin 3, type 1 preproprotein
CDK10_E74_F	182	0.09123947	5687.648	581.0794	1.385495E-05	28	269.0706	0.0369783	12096.12	468.3089	1.060194E-15	33	716.0117	0.03464395	15190.04	548.717	1.936186E-27	27	1177.755	0.2172981	3966.032	1128.835	0.01326776	36	240.6228	0.05086782	12391.54	669.4721	2.495277E-18	26	877.9967	0.03669986	12695.61	487.4878	1.536612E-21	22	919.9682	0.03849544	12290.65	496.0804	7.975489E-14	35	850.0038	0.04243038	16653.61	742.3605	3.420538E-18	32	574.4798	0.06744735	9325.61	681.7121	1.217862E-10	28	761.7104	0.0750056	15526.26	1267.097	1.280636E-30	34	797.4108	CDK10	CDK10_E74_F	32528264	NM_052987.2	CDK10	8558	16	36.1	88280653	74	Y	GGAGCCAGATCTGGAGTGCGAGCAGATCCGTCTGAAGTGTATTCGTAAGGAGG	PISSLRE	isoform 2 is encoded by transcript variant 2; serine/threonine protein kinase PISSLRE; CDC2-related protein kinase; cell division protein kinase 10; cyclin-dependent kinase related protein; go_function: ATP binding; go_function: kinase activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: cyclin-dependent protein kinase activity; go_process: protein amino acid phosphorylation; go_process: negative regulation of cell proliferation; go_process: traversing start control point of mitotic cell cycle	cyclin-dependent kinase 10 isoform 2
CDK10_P199_R	3285	0.1296187	6376.656	964.5149	1.3125E-07	18	371.5314	0.3854499	5423.286	3464.242	8.085806E-08	33	296.6579	0.4658645	5091.06	4527.561	8.065032E-10	26	495.6077	0.1197825	4968.107	689.6824	0.004834038	36	251.0275	0.3948317	5579.837	3705.712	4.09215E-09	25	233.9109	0.4307005	4823.228	3724.641	8.852458E-09	41	360.8854	0.4564895	4307.455	3701.781	1.988711E-05	26	470.0927	0.3682047	6730.963	3981.025	7.013082E-07	24	494.7255	0.3555968	5992.687	3362.087	2.890484E-09	28	470.2067	0.3941406	6248.889	4130.257	2.791069E-11	33	325.7115	CDK10	CDK10_P199_R	32528264	NM_052987.2	CDK10	8558	16	36.1	88280380	-199	Y	CCTGGAAGACCTTCACCTGGGTAATCGCCGTGGCCTCCCACTACGGCGCAG	PISSLRE	isoform 2 is encoded by transcript variant 2; serine/threonine protein kinase PISSLRE; CDC2-related protein kinase; cell division protein kinase 10; cyclin-dependent kinase related protein; go_function: ATP binding; go_function: kinase activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: cyclin-dependent protein kinase activity; go_process: protein amino acid phosphorylation; go_process: negative regulation of cell proliferation; go_process: traversing start control point of mitotic cell cycle	cyclin-dependent kinase 10 isoform 2
CDK2_P330_R	2360	0.03268463	5363.989	184.6228	0.0001934687	25	127.5588	0.1460226	8344.254	1443.893	1.829304E-09	26	412.1076	0.1279859	9570.229	1419.304	6.323502E-13	34	437.5898	0.5229309	2766.552	3142.122	0.002961426	25	240.0193	0.1634743	6174.349	1226.136	7.729786E-06	26	273.1598	0.1484227	8147.291	1437.433	4.315448E-11	38	415.9493	0.1655018	7511.12	1509.475	7.888948E-07	24	315.7429	0.1271342	9533.374	1403.116	3.671981E-07	29	417.2494	0.1419243	7575.375	1269.494	2.881759E-08	29	556.4052	0.1392528	8638.714	1413.76	1.435655E-10	32	402.8221	CDK2	CDK2_P330_R	16936529	NM_052827.1	CDK2	1017	12	36.1	54646496	-330	N	AGGCCCAGGATTCCTTTGCAACGAGATTCCCGGCTTCCTGGTTTCCA	p33(CDK2)	isoform 2 is encoded by transcript variant 2; cdc2-related protein kinase; cell devision kinase 2; p33 protein kinase; go_component: nucleus; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: cyclin-dependent protein kinase activity; go_process: mitosis; go_process: cell cycle; go_process: cell division; go_process: regulation of DNA replication; go_process: protein amino acid phosphorylation; go_process: G2/M transition of mitotic cell cycle; go_process: positive regulation of cell proliferation; go_process: traversing start control point of mitotic cell cycle	cyclin-dependent kinase 2 isoform 2
CDK6_E256_F	205	0.1299807	19347.64	2905.472	3.678E-38	30	1646.807	0.2370559	12171.82	3813.001	8.019615E-26	30	886.703	0.2135676	14819.43	4051.595	3.678E-38	37	637.885	0.15085	9922.813	1780.534	2.842645E-11	20	1394.105	0.2284347	12565.44	3749.815	3.840552E-29	19	905.9208	0.1711148	17627.24	3659.606	3.678E-38	18	1049.737	0.242392	13873.08	4470.601	2.483491E-29	31	744.1977	0.2404956	15871.29	5057.276	1.175713E-26	26	874.7975	0.2193447	8741.743	2484.31	1.6716E-13	37	878.2937	0.2152313	14946.1	4126.557	3.678E-38	37	549.2531	CDK6	CDK6_E256_F	45827787	NM_001259.5	CDK6	1021	7	36.1	92300892	256	Y	CGAAGTCCTCAACACAGACACGATTACATAGCCTCTGCCCAAGCGCGT	PLSTIRE, MGC59692	cell division protein kinase 6; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_process: cell cycle; go_process: cell division; go_process: cell proliferation; go_process: G1 phase of mitotic cell cycle; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	cyclin-dependent kinase 6
CDK6_P291_R	3157	0.07447544	6015.439	492.0993	5.29812E-06	28	225.4516	0.0434137	7530.761	346.3144	3.431404E-06	21	430.928	0.0381056	10981.09	438.9792	5.319225E-14	28	594.6953	0.04201619	3123.267	141.3692	0.1543626	32	127.8044	0.03238645	9995.665	337.9063	2.574225E-11	24	571.9415	0.0468865	10672.11	529.9121	2.548132E-15	31	518.47	0.03254149	9827.519	333.9226	1.188505E-08	32	544.3508	0.02937188	12556.35	382.99	5.694044E-10	28	504.4037	0.05895641	8139.445	516.2015	6.506438E-08	42	367.4008	0.04636055	10784.56	529.1457	1.841721E-13	28	352.0669	CDK6	CDK6_P291_R	89027379	XM_499529.2	LOC442597	442597	7	36.1	92301439	-1465	Y	AGCGGAAGGACTGTGGGTCCATCCGTGTGGGGCCGCAGAATGTG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_499529
CDKN1A_E101_F	4066	0.04464339	6648.652	315.3615	7.471663E-07	24	441.6088	0.04897981	12654.97	656.9116	1.106653E-17	34	739.809	0.04744282	16337.87	818.7003	6.579252E-33	30	861.7139	0.3783937	1298.675	851.423	0.3870885	25	101.7392	0.05336498	12130.51	689.4745	1.235939E-17	27	811.4703	0.06409223	13470.94	929.3562	6.239053E-26	29	1003.219	0.0722008	12968.23	1016.962	1.209297E-16	25	876.3659	0.05342555	17768.74	1008.529	2.693286E-21	30	1013.838	0.07492773	11274.39	921.2875	4.692131E-16	36	804.805	0.04520214	16959.14	807.6154	1.881557E-34	21	1172.964	CDKN1A	CDKN1A_E101_F	17978496	NM_000389.2	CDKN1A	1026	6	36.1	36754566	101	Y	GGCACTCAGAGGAGGTGAGAGAGCGGCGGCAGACAACAGGGGACCCCGG	P21, CIP1, SDI1, WAF1, CAP20, CDKN1, MDA-6, p21CIP1	melanoma differentiation associated protein 6; CDK-interaction protein 1; wild-type p53-activated fragment 1; DNA synthesis inhibitor; go_component: nucleus; go_component: nucleus; go_function: kinase activity; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: protein kinase activity; go_function: cyclin-dependent protein kinase inhibitor activity; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: induction of apoptosis by intracellular signals; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 1A
CDKN1A_P242_F	2370	0.8145713	6256.638	27924.12	3.678E-38	26	950.563	0.04683587	7201.782	358.7895	9.957136E-06	28	400.3387	0.05003426	7854.143	418.9411	3.068801E-07	28	309.878	0.7657893	3514.166	11817.09	2.122837E-19	38	858.6738	0.04389772	6790.389	316.3599	2.090593E-05	22	506.8971	0.08428527	6620	618.53	2.65851E-06	27	378.5306	0.04604891	6995.27	342.5013	0.0001315786	33	443.9076	0.06577136	8174.432	582.5347	0.0001015738	24	288.8206	0.07963855	5183.325	457.1642	0.001689883	28	352.7391	0.05594477	6794.707	408.5807	1.781548E-05	27	294.8592	CDKN1A	CDKN1A_P242_F	17978496	NM_000389.2	CDKN1A	1026	6	36.1	36754223	-242	Y	CACTTCGTGGGGAAATGTGTCCAGCGCACCAACGCAGGCGAGGGACTG	P21, CIP1, SDI1, WAF1, CAP20, CDKN1, MDA-6, p21CIP1	melanoma differentiation associated protein 6; CDK-interaction protein 1; wild-type p53-activated fragment 1; DNA synthesis inhibitor; go_component: nucleus; go_component: nucleus; go_function: kinase activity; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: protein kinase activity; go_function: cyclin-dependent protein kinase inhibitor activity; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: induction of apoptosis by intracellular signals; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 1A
CDKN1B_P1161_F	2375	0.04543898	3353.132	164.3759	0.04128484	30	156.081	0.06235788	12513.78	838.8795	8.555113E-18	26	1094.005	0.07854754	16191.05	1388.701	1.214459E-34	34	813.1568	0.06505217	4294.184	305.7402	0.02913456	32	218.6196	0.0791277	13309.68	1152.252	1.17306E-22	22	766.1292	0.09906699	12882.23	1427.532	1.369915E-25	28	1167.662	0.0908513	10806.71	1089.908	6.451021E-12	26	1137.646	0.07613521	17816.81	1476.515	1.595811E-22	24	424.6445	0.09211562	9327.616	956.5433	2.944543E-11	33	772.816	0.08223251	18730.92	1687.262	3.678E-38	33	546.1021	CDKN1B	CDKN1B_P1161_F	17978497	NM_004064.2	CDKN1B	1027	12	36.1	12760415	-1161	N	AAGAGAAACGCTGGAATACTAGTATCGGACGTTAGGACATGGTTGTGGTGTT	KIP1, CDKN4, P27KIP1	go_component: nucleus; go_component: cytoplasm; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: cyclin-dependent protein kinase inhibitor activity; go_function: transforming growth factor beta receptor, cytoplasmic mediator activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 1B
CDKN1C_P6_R	234	0.3879659	3149.555	2059.88	0.0005849492	32	256.0297	0.1275454	6614.319	981.5762	8.863594E-06	23	513.717	0.1152649	8513.272	1122.153	7.438035E-10	34	427.7699	0.5443324	1321.557	1698.167	0.1956473	31	149.481	0.1049051	7156.553	850.4678	8.497659E-07	22	378.2229	0.1380605	6478.481	1053.703	8.159514E-07	33	674.4362	0.1434017	6833.819	1160.78	2.076786E-05	42	336.601	0.1307681	9405.211	1429.973	4.9266E-07	24	633.0214	0.182437	5602.978	1272.604	4.957179E-05	24	499.4645	0.1640153	5645.597	1127.253	7.060465E-05	27	456.1647	CDKN1C	CDKN1C_P6_R	4557440	NM_000076.1	CDKN1C	1028	11	36.1	2863557	-6	Y	TCGCTCAGGCCTGGCCGGCACCCCTCGAGCACAGCGCACTTGGCCTGTGGA	BWS, WBS, p57, BWCR, KIP2	p57KIP2; Beckwith-Wiedemann syndrome; go_component: nucleus; go_function: protein binding; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: G1 phase of mitotic cell cycle; go_process: negative regulation of cell proliferation; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 1C
CDKN1C_P626_F	240	0.1301097	3722.779	571.7737	0.007558946	32	157.4955	0.1265485	9496.622	1390.39	1.010682E-11	38	427.0754	0.1186289	10867.55	1476.186	1.810922E-16	37	630.8247	0.263343	701.6437	286.5747	0.6826488	22	61.68086	0.09405912	8857.024	929.9612	3.915212E-10	19	658.6108	0.1014125	8813.9	1006.002	1.167675E-11	30	490.9212	0.1415831	8641.956	1441.856	1.611114E-08	37	374.587	0.1388215	11490.31	1868.352	1.253276E-10	31	618.4546	0.1364157	7393.104	1183.645	9.080559E-08	26	396.999	0.09982389	8187.804	919.0656	1.168926E-08	18	341.9306	CDKN1C	CDKN1C_P626_F	4557440	NM_000076.1	CDKN1C	1028	11	36.1	2864177	-626	Y	CTGCCAGCTCGGCCCTGGCCTGCGCCGGATGGGGTCTTCGGCTGCCCCC	BWS, WBS, p57, BWCR, KIP2	p57KIP2; Beckwith-Wiedemann syndrome; go_component: nucleus; go_function: protein binding; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: G1 phase of mitotic cell cycle; go_process: negative regulation of cell proliferation; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 1C
CDKN2A_E121_R	4068	0.04097842	13101.53	564.0934	1.881693E-27	28	814.501	0.07937138	4868.794	428.3813	0.004576935	27	408.0372	0.08360874	6640.962	615.0248	1.356855E-05	22	248.664	0.05458506	9900.461	577.3928	4.50777E-09	32	604.3604	0.07491955	6103.886	502.4345	0.0001019118	39	289.1877	0.07959365	6879.551	603.5681	9.979016E-07	24	431.4971	0.08408662	6330.591	590.3688	0.0003844641	32	411.3799	0.1021134	6864.365	792.0317	0.0009994612	32	235.0923	0.1294836	4118.059	627.4083	0.01274486	22	282.5438	0.07512696	6253.372	516.0811	7.134712E-05	33	569.5953	CDKN2A	CDKN2A_E121_R	47132605	NM_058195.2	CDKN2A	1029	9	36.1	21984369	121	Y	CCAGGGCCGAGCTCGGCAGCCGCTGCGCCGCCCTTTGGCACCAGAGGTGA	ARF, MLM, p14, p16, p19, CMM2, INK4, MTS1, TP16, CDK4I, CDKN2, INK4a, p14ARF, p16INK4, p16INK4a	isoform 4 is encoded by transcript variant 4; multiple tumor suppressor 1; cyclin-dependent kinase inhibitor p16; cell cycle negative regulator beta; CDK4 inhibitor p16-INK4; cyclin-dependent kinase inhibitor 2A, p14ARF; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: protein binding; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: apoptosis; go_process: cell cycle; go_process: transcription; go_process: rRNA processing; go_process: cell cycle arrest; go_process: cell cycle checkpoint; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: negative regulation of progression through cell cycle; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 2A isoform 4
CDKN2B_E220_F	4069	0.5121046	3925.926	4225.691	2.156168E-09	26	459.6305	0.1870441	9121.733	2121.727	1.633098E-12	17	603.1937	0.1980031	10858.12	2705.422	4.575576E-20	29	787.239	0.2563959	5299.751	1861.843	0.0001759761	22	269.6812	0.1858546	7632.19	1765.118	2.455816E-09	28	506.4112	0.1864436	10306.96	2384.974	6.848953E-20	25	710.145	0.1929242	9763.405	2357.758	2.204242E-12	17	713.0519	0.1958251	11780.39	2893	7.60165E-13	36	594.2645	0.2071749	7397.188	1959.107	2.870072E-09	30	540.8166	0.1741284	13124.63	2788.308	2.34331E-27	17	1019.342	CDKN2B	CDKN2B_E220_F	47132608	NM_004936.3	CDKN2B	1030	9	36.1	21999092	220	Y	CTCAGCTTCATTACCCTCCCGTCGTCCTTCTGCGGCTTGGGGCCCC	P15, MTS2, TP15, INK4B	isoform 1 is encoded by transcript variant 1; p15 CDK inhibitor; cyclin-dependent kinases 4 and 6 binding protein; multiple tumor suppressor 2; p14_CDK inhibitor; p14_INK4B; p15_INK4B; CDK4B inhibitor; CDK inhibitory protein; cyclin-dependent kinase 4 inhibitor B; go_component: nucleus; go_component: cytoplasm; go_function: kinase activity; go_function: protein binding; go_function: cyclin-dependent protein kinase inhibitor activity; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 2B isoform 1
CDKN2B_seq_50_S294_F	6012	0.1546546	3882.187	728.5347	0.00334652	22	182.2623	0.1800762	9622.666	2135.345	1.044633E-13	24	458.0585	0.1225758	10874	1533.063	1.203951E-16	25	472.0933	0.03606622	4289.105	164.2213	0.03612659	25	233.962	0.1159096	10709.11	1417.14	1.024686E-15	26	498.5885	0.1606996	10206.91	1973.448	3.006971E-18	37	628.806	0.0999763	11521.8	1290.971	6.97515E-14	30	468.127	0.1017174	12292.03	1403.216	3.572641E-11	25	725.0164	0.08735561	8868.702	858.4576	4.892167E-10	25	425.188	0.11372	12512.7	1618.355	2.39511E-21	31	637.3038	CDKN2B	CDKN2B_seq_50_S294_F	47132608	NM_004936.3	CDKN2B	1030	9	36.1	21999010	302	Y	TGGGAAAGAAGGGAAGAGTGTCGTTAAGTTTACGGCCAACGGTGGA	P15, MTS2, TP15, INK4B	isoform 1 is encoded by transcript variant 1; p15 CDK inhibitor; cyclin-dependent kinases 4 and 6 binding protein; multiple tumor suppressor 2; p14_CDK inhibitor; p14_INK4B; p15_INK4B; CDK4B inhibitor; CDK inhibitory protein; cyclin-dependent kinase 4 inhibitor B; go_component: nucleus; go_component: cytoplasm; go_function: kinase activity; go_function: protein binding; go_function: cyclin-dependent protein kinase inhibitor activity; go_function: cyclin-dependent protein kinase inhibitor activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: regulation of cyclin dependent protein kinase activity	cyclin-dependent kinase inhibitor 2B isoform 1
CDM_seq_21_S260_R	6016	0.06804069	3744.897	280.7091	0.01428074	29	198.2796	0.1049817	7251.14	862.2559	1.497534E-06	34	340.394	0.1144538	7728.798	1011.845	4.391628E-08	29	441.0146	0.04774468	4028.634	207.0036	0.04898813	23	216.614	0.5857384	4918.863	7096.339	2.02541E-15	31	640.6782	0.5567198	4690.075	6015.899	6.083518E-14	32	608.9656	0.6067653	4653.88	7335.289	4.155457E-12	30	704.0434	0.5768394	5830.297	8083.997	1.548584E-11	26	591.6731	0.6050627	3470.733	5470.533	1.887814E-08	30	455.027	0.6113421	4903.073	7869.617	2.679516E-17	34	543.9193	CDM	CDM_seq_21_S260_R	.	.	.	.	X	36.1	152641701	.	N	CAGACAGGTTCTACCTGTTCCATCGGGTCCCAATTCCAGGGTCCAC	.	.	.
CEACAM1_E57_R	113	0.2562193	4699.845	1653.462	9.906182E-06	38	195.3289	0.04504739	10861.21	517.0665	8.054298E-13	28	864.6032	0.03634803	16050.34	609.1754	6.237539E-31	30	659.4105	0.1029766	5247.936	613.933	0.003251041	29	191.958	0.04050313	13790.49	586.3577	2.219462E-22	29	898.0032	0.05291061	15763.27	886.226	3.430444E-35	28	827.6252	0.04386432	13660.14	631.2694	2.0702E-17	28	878.6385	0.04704076	15254.18	757.9257	2.39567E-15	32	617.7435	0.06650441	9628.202	693.0599	2.425948E-11	36	659.1743	0.0397798	15572.67	649.2839	1.765644E-28	26	611.4349	CEACAM1	CEACAM1_E57_R	68161539	NM_001712.3	CEACAM1	634	19	36.1	47724422	57	N	GAGGAGAGCTTGGGCTCCAGGAACGCTTCGAGCACGGCTGCTCTGTC	BGP, BGP1, BGPI	isoform 1 precursor is encoded by transcript variant 1; antigen CD66; CD66a antigen; biliary glycoprotein adhesion molecule; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: receptor activity; go_process: pregnancy; go_process: angiogenesis; go_process: cell migration; go_process: homophilic cell adhesion; go_process: integrin-mediated signaling pathway	carcinoembryonic antigen-related cell adhesion molecule 1 isoform 1 precursor
CEACAM1_P44_R	3171	0.03811945	7353.429	295.3803	2.929098E-08	31	284.5495	0.291825	9222.032	3841.427	5.209714E-17	27	781.0131	0.377616	10347.27	6338.622	4.917282E-31	26	927.859	0.02318432	6835.181	164.6037	0.000262564	28	499.1734	0.2576507	9256.339	3247.349	9.587794E-17	31	762.6454	0.3363286	9408.435	4818.587	2.797607E-25	29	692.9395	0.286668	9000.235	3657.127	1.54483E-13	25	876.7018	0.1997137	12339.79	3104.385	2.956294E-14	27	910.1774	0.370135	5777.075	3453.615	5.130157E-09	21	508.0879	0.1744093	13394.13	2850.69	1.454877E-28	30	708.754	CEACAM1	CEACAM1_P44_R	68161539	NM_001712.3	CEACAM1	634	19	36.1	47724523	-44	N	TTGTCTGATCATGTGTGCTGGGGCGGGGTTTGTCCAGGAAGCTC	BGP, BGP1, BGPI	isoform 1 precursor is encoded by transcript variant 1; antigen CD66; CD66a antigen; biliary glycoprotein adhesion molecule; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: receptor activity; go_process: pregnancy; go_process: angiogenesis; go_process: cell migration; go_process: homophilic cell adhesion; go_process: integrin-mediated signaling pathway	carcinoembryonic antigen-related cell adhesion molecule 1 isoform 1 precursor
CEBPA_P1163_R	3305	0.2306439	7892.457	2396.045	3.670867E-15	23	579.5172	0.08866043	10042.01	986.6735	4.9372E-12	33	340.8476	0.08028522	10503.03	925.5767	5.058884E-14	28	456.8233	0.1242051	8294.507	1190.508	1.722743E-07	27	343.5602	0.05817357	9402.823	586.9587	1.454903E-10	33	359.094	0.1111557	10510.62	1326.926	3.435291E-17	29	617.7159	0.08327184	10942.63	1003.068	5.111363E-12	32	537.9215	0.08201408	16362.32	1470.766	3.805377E-19	23	664.2344	0.09144309	8340.479	849.5048	6.180291E-09	24	764.0261	0.07025107	10520.3	802.4611	1.750016E-13	31	490.5158	CEBPA	CEBPA_P1163_R	28872793	NM_004364.2	CEBPA	1050	19	36.1	38486323	.	Y	TCCAGGCCGCCGGGCTGCCAGGTCCGAGCACGCACAGGGAGAACTCTGCCC	CEBP, C/EBP-alpha	go_component: nucleus; go_component: nucleus; go_function: protein dimerization activity; go_function: sequence-specific DNA binding; go_function: transcription factor binding; go_function: RNA polymerase II transcription factor activity, enhancer binding; go_function: RNA polymerase II transcription factor activity, enhancer binding; go_process: transcription; go_process: transcription; go_process: transcription; go_process: myeloid cell differentiation; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter; go_process: generation of precursor metabolites and energy; go_process: cytokine and chemokine mediated signaling pathway	CCAAT/enhancer binding protein alpha
CEBPA_P706_F	3294	0.1399716	3702.307	618.8344	0.007078106	31	137.5596	0.1771822	8247.001	1797.409	5.759777E-10	33	486.2783	0.159883	10309.17	1980.973	2.553413E-16	27	593.2448	0.07022106	3299.174	256.7208	0.1133457	34	130.0885	0.2058061	7913.585	2076.627	1.451815E-10	21	384.7885	0.2012802	7556.742	1929.526	7.377834E-11	30	459.2119	0.2209768	7030.428	2022.608	7.059064E-07	32	640.8562	0.1927846	10063.45	2427.304	2.704551E-09	25	459.182	0.2054801	6756.952	1773.356	1.103026E-07	29	358.3788	0.2032138	7900.984	2040.586	2.469121E-10	34	373.9168	CEBPA	CEBPA_P706_F	89056753	XR_000538.1	FLJ12355	80054	19	36.1	38485866	293	Y	TCCAGGCTACCCCTGTGATTCCGCGCAGAGGTACCTCTCGGAGGACGCC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	.
CFTR_P115_F	247	0.4906898	2441.774	2448.846	0.001530388	28	244.4883	0.05555739	8747.965	520.4867	1.714879E-08	30	437.1152	0.07757833	10431.44	885.7242	9.709077E-14	31	416.9667	0.4687977	939.3231	917.2253	0.4624008	32	98.81575	0.04821187	9984.523	510.8213	1.113055E-11	33	512.2318	0.1000675	8570.215	964.0797	5.68421E-11	23	791.2682	0.06835686	10298.62	762.971	2.855903E-10	42	464.9908	0.07748034	10652.29	903.0604	5.688163E-08	29	573.9673	0.08113192	7964.989	712.1022	5.939084E-08	32	442.1325	0.04065964	11031.12	471.7694	6.273149E-14	38	426.8631	CFTR	CFTR_P115_F	6995995	NM_000492.2	CFTR	1080	7	36.1	116907138	-115	Y	GTGCGTAGTGGGTGGAGAAAGCCGCTAGAGCAAATTTGGGGCCGG	CF, MRP7, ABC35, ABCC7, TNR-CFTR, dJ760C5.1	CFTR/MRP; ATP-binding cassette, sub-family C member 7; cystic fibrosis transmembrane conductance regulator ATP-binding cassette subfamily C member 7; cystic fibrosis transmembrane conductance regulator/ATP-binding cassette sub-family C member 7; go_component: membrane; go_component: integral to membrane; go_component: apical plasma membrane; go_component: basolateral plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: protein binding; go_function: ion channel activity; go_function: PDZ domain binding; go_function: channel-conductance-controlling ATPase activity; go_function: ATP-binding and phosphorylation-dependent chloride channel activity; go_process: ion transport; go_process: respiratory gaseous exchange	cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)
CFTR_P372_R	256	0.135462	3477.207	560.5025	0.01389316	28	139.3169	0.2847749	5705.708	2311.608	2.105194E-06	28	251.5404	0.2304258	6446.598	1960.181	1.783223E-07	20	280.8087	0.08492663	2272.264	220.1664	0.3045218	16	181.153	0.2863213	5341.792	2183.197	4.996587E-06	18	269.4618	0.4716753	4817.835	4390.521	3.237442E-10	27	416.3422	0.3058333	6382.973	2856.243	3.695908E-07	25	237.2093	0.3815284	5459.615	3429.667	7.527262E-05	30	399.2524	0.3325059	4860.298	2470.925	1.081015E-05	41	258.2137	0.1569519	6338.284	1198.628	5.709129E-06	25	405.6823	CFTR	CFTR_P372_R	6995995	NM_000492.2	CFTR	1080	7	36.1	116906881	-372	Y	TCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGCCGGTGGCTTCTTCTG	CF, MRP7, ABC35, ABCC7, TNR-CFTR, dJ760C5.1	CFTR/MRP; ATP-binding cassette, sub-family C member 7; cystic fibrosis transmembrane conductance regulator ATP-binding cassette subfamily C member 7; cystic fibrosis transmembrane conductance regulator/ATP-binding cassette sub-family C member 7; go_component: membrane; go_component: integral to membrane; go_component: apical plasma membrane; go_component: basolateral plasma membrane; go_function: ATP binding; go_function: ATPase activity; go_function: nucleotide binding; go_function: protein binding; go_function: ion channel activity; go_function: PDZ domain binding; go_function: channel-conductance-controlling ATPase activity; go_function: ATP-binding and phosphorylation-dependent chloride channel activity; go_process: ion transport; go_process: respiratory gaseous exchange	cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)
CHD2_P451_F	261	0.6022629	1205.403	1976.672	0.07542089	30	111.2552	0.950482	716.6192	15674.75	3.32178E-27	25	1282.521	0.9589912	824.0714	21609.4	3.678E-38	31	892.889	0.9127891	482.3129	6094.752	0.0007104405	28	277.6949	0.9514486	732.8713	16321.53	5.705791E-32	23	1213.757	0.9463409	848.3314	16724.92	3.678E-38	25	909.2783	0.9380857	939.4003	15748.34	4.638332E-24	28	817.996	0.9541593	868.6306	20161.74	6.32057E-27	16	1045.672	0.9332926	719.8645	11470.59	4.850352E-16	26	1090.501	0.9543682	786.4456	18539.62	3.678E-38	23	785.5013	CHD2	CHD2_P451_F	4557448	NM_001271.1	CHD2	1106	15	36.1	91243972	-451	N	TGCTCCAGTGCAACTTGAACACTAGGGAGGCGCTCTTGAGTTGTAAAAGTTACCCCTT	DKFZp781D1727	go_component: nucleus; go_component: chromatin; go_function: ATP binding; go_function: DNA binding; go_function: chromatin binding; go_function: helicase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: ATP-dependent DNA helicase activity; go_process: regulation of transcription; go_process: chromatin assembly or disassembly; go_process: chromosome organization and biogenesis (sensu Eukaryota); go_process: regulation of transcription from RNA polymerase II promoter	chromodomain helicase DNA binding protein 2
CHD2_P667_F	263	0.7195765	581.9799	1749.985	0.2489579	32	94.45789	0.9268364	652.72	9535.463	2.96674E-10	25	654.8842	0.9396275	703.0837	12499.06	5.84053E-19	31	644.7186	0.6264742	923.3268	1716.315	0.2715972	29	123.1696	0.9247853	696.3682	9791.567	1.157007E-11	35	394.0784	0.9276069	776.3744	11229.4	1.04988E-17	31	426.3143	0.9297525	720.6347	10861.41	2.792848E-11	19	769.8573	0.942337	765.0671	14137.05	2.957789E-13	29	507.5858	0.9099162	720.2032	8284.684	1.4237E-08	30	639.3726	0.9259874	743.229	10549.82	2.069035E-13	36	481.738	CHD2	CHD2_P667_F	4557448	NM_001271.1	CHD2	1106	15	36.1	91243756	-667	N	CTTGGGTTACTGATTTAAAGGTGATCGTGTTTGGACCATACTCTTGAATTTT	DKFZp781D1727	go_component: nucleus; go_component: chromatin; go_function: ATP binding; go_function: DNA binding; go_function: chromatin binding; go_function: helicase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: ATP-dependent DNA helicase activity; go_process: regulation of transcription; go_process: chromatin assembly or disassembly; go_process: chromosome organization and biogenesis (sensu Eukaryota); go_process: regulation of transcription from RNA polymerase II promoter	chromodomain helicase DNA binding protein 2
CHFR_P501_F	273	0.0126458	17642.36	227.24	3.678E-38	19	790.4785	0.08044487	7027.423	623.5239	7.384339E-06	32	438.7838	0.06973127	8356.874	633.9121	1.472527E-08	36	374.1415	0.01538321	11061.47	174.3818	2.115337E-10	31	739.3363	0.08276524	6801.879	622.7803	7.106736E-06	34	251.7702	0.1056846	6666.334	799.6031	1.070382E-06	47	253.2506	0.09263714	6795.551	704.0007	8.500431E-05	32	349.1624	0.1186062	7843.512	1068.932	7.138646E-05	27	438.632	0.1194169	5363.264	740.8796	0.0004974503	32	265.5592	0.1347094	7825.79	1233.895	1.436724E-08	29	326.2518	CHFR	CHFR_P501_F	8922674	NM_018223.1	CHFR	55743	12	36.1	131974758	-501	Y	CGTTTTGCGGGGTCTTCCTGTTCTGAACGCGCGTAACTTTTGCCTCAGTATCTCACTTC	RNF116, RNF196, FLJ10796	go_component: nucleus; go_component: ubiquitin ligase complex; go_function: ligase activity; go_function: zinc ion binding; go_function: metal ion binding; go_function: ubiquitin-protein ligase activity; go_process: mitosis; go_process: cell cycle; go_process: cell division; go_process: mitotic checkpoint; go_process: protein ubiquitination	checkpoint with forkhead and ring finger domains
CHFR_P635_R	270	0.1435394	6150.896	1047.625	2.566674E-07	32	362.9723	0.06053876	15063.34	977.1236	5.213799E-26	29	906.6601	0.05052153	17687.42	946.4644	3.678E-38	23	889.893	0.0874442	6375.741	620.5275	0.0002648261	24	359.1354	0.06358277	15070.31	1030.065	2.402688E-28	22	1058.109	0.07883287	12399.2	1069.673	1.56521E-22	22	1195.727	0.08099529	14924.8	1324.191	9.339404E-23	41	761.6841	0.06971101	17928.61	1350.97	1.722405E-22	28	799.4573	0.1027952	9771.927	1131.054	1.045437E-12	38	874.6851	0.05813089	17658.43	1096.026	3.678E-38	21	1035.111	CHFR	CHFR_P635_R	8922674	NM_018223.1	CHFR	55743	12	36.1	131974892	-635	Y	GAAAGAGGAGTAAAGACGGCGAGACGCGTCCACGCAGGGGGAGTCTGT	RNF116, RNF196, FLJ10796	go_component: nucleus; go_component: ubiquitin ligase complex; go_function: ligase activity; go_function: zinc ion binding; go_function: metal ion binding; go_function: ubiquitin-protein ligase activity; go_process: mitosis; go_process: cell cycle; go_process: cell division; go_process: mitotic checkpoint; go_process: protein ubiquitination	checkpoint with forkhead and ring finger domains
CHGA_E52_F	3075	0.535713	5068.4	5963.507	1.562852E-17	33	463.1207	0.1022128	6606.78	763.565	1.842588E-05	27	422.1857	0.09310676	9471.99	982.7144	1.174901E-11	19	501.8512	0.3698107	3197.266	1934.917	0.01245624	31	295.9867	0.09086141	7735.728	783.1207	1.121955E-07	15	660.8889	0.1966743	6141.289	1528.024	4.609866E-07	26	540.5744	0.08521211	7798.098	735.7045	3.949753E-06	34	472.1146	0.1177895	8732.895	1179.335	6.191079E-06	26	262.5058	0.08545537	5222.313	497.3187	0.001383353	27	341.2668	0.06939166	8029.984	606.2197	8.649764E-08	26	361.595	CHGA	CHGA_E52_F	10800418	NM_001275.2	CHGA	1113	14	36.1	92459297	52	Y	TCGAGCCCCGTGCAGGGGAGCTTGCGGGAGGATCGACCGACAGAC	CGA	parathyroid secretory protein 1; go_component: synaptic vesicle; go_component: extracellular space; go_function: calcium ion binding; go_process: blood pressure regulation	chromogranin A precursor
CHGA_P243_F	285	0.0837683	3051.58	288.1394	0.0573661	29	112.9458	0.3733755	6293.67	3809.682	4.393919E-10	22	519.132	0.3444785	8175.848	4348.983	5.599819E-17	27	572.1127	0.3193805	1852.439	916.1813	0.244286	39	103.008	0.3565897	6996.442	3932.977	1.089518E-12	21	581.3746	0.29247	7658.21	3206.993	2.236942E-14	30	657.3629	0.2354151	7312.655	2282.351	1.027337E-07	33	390.1003	0.3196185	8637.355	4104.491	1.139514E-09	40	341.0307	0.4012457	5219.397	3564.709	3.751719E-08	23	505.6587	0.4050442	6926.793	4783.821	1.877972E-14	35	364.2576	CHGA	CHGA_P243_F	10800418	NM_001275.2	CHGA	1113	14	36.1	92459002	-243	Y	GGACACAAGGCAAATCGGTGGAATCGTCGAGGGGTGGAGGATCAGCCACA	CGA	parathyroid secretory protein 1; go_component: synaptic vesicle; go_component: extracellular space; go_function: calcium ion binding; go_process: blood pressure regulation	chromogranin A precursor
CHI3L2_E10_F	3077	0.264224	1125.666	440.148	0.5024253	25	66.17944	0.7595446	2031.785	6733.831	1.307166E-07	28	552.4988	0.7969475	1989.259	8199.997	4.704807E-11	19	570.6413	0.57433	574.7208	910.3587	0.5593202	23	99.34576	0.7442123	2187.296	6654.87	2.892468E-08	26	558.1483	0.8022739	1932.055	8245.068	1.493875E-12	26	700.4486	0.7601214	2127.483	7058.392	4.455877E-07	16	545.3885	0.8091984	2197.955	9745.729	1.66044E-08	32	452.5282	0.7786053	1613.221	6025.089	3.618904E-06	29	316.4052	0.7661096	2211.961	7572.845	5.250994E-10	22	511.0176	CHI3L2	CHI3L2_E10_F	68533259	NM_001025199.1	CHI3L2	1117	1	36.1	111571814	10	N	TGCTTCTTTCGTGTAGGACAGGCTGTCGAAACCTCAGTGGATAAAAGACCTAGAG	YKL39, YKL-39	isoform c is encoded by transcript variant 3; chondrocyte protein 39; go_component: extracellular space; go_function: catalytic activity; go_function: chitinase activity; go_function: hydrolase activity; go_process: chitin catabolism; go_process: carbohydrate metabolism	chitinase 3-like 2 isoform c
CHI3L2_P226_F	300	0.09226436	2634.612	277.9523	0.1158474	28	91.21343	0.7637445	3449.775	11475.38	2.131028E-22	23	806.3745	0.8286937	3143.748	15691.62	3.678E-38	22	1004.007	0.04625377	3835.426	190.8561	0.0645783	29	146.5905	0.7915448	2465.981	9743.528	6.119384E-16	26	1085.541	0.8248564	2498.775	12239.19	3.160768E-27	35	792.8982	0.7706467	3250.36	11257.5	5.792111E-18	23	1168.227	0.8202564	3351.293	15749.91	4.615345E-22	45	652.6747	0.8026655	2055.829	8768.911	1.614557E-12	28	795.865	0.740202	3844.868	11239.5	1.832126E-24	28	1119.513	CHI3L2	CHI3L2_P226_F	68533259	NM_001025199.1	CHI3L2	1117	1	36.1	111571578	-226	N	TGATGAGGAAGGAGATTCAGGGCCGAGGGTGATACCAGGAGGCAGA	YKL39, YKL-39	isoform c is encoded by transcript variant 3; chondrocyte protein 39; go_component: extracellular space; go_function: catalytic activity; go_function: chitinase activity; go_function: hydrolase activity; go_process: chitin catabolism; go_process: carbohydrate metabolism	chitinase 3-like 2 isoform c
CLDN4_P1120_R	4287	0.1865047	3115.977	737.3058	0.02089154	39	190.3156	0.8294748	2359.242	11962.34	1.455798E-20	26	930.6826	0.8683128	2357.992	16207.39	3.678E-38	26	990.4984	0.2191362	3535.727	1020.305	0.03109908	38	326.091	0.8250801	2401.986	11801.62	8.0255E-22	32	593.6663	0.7515892	3205.262	10000.37	1.285942E-21	25	472.1876	0.8586729	2043.318	13022.34	1.967305E-19	27	758.407	0.8677721	2234.896	15323.23	1.52542E-18	36	904.8119	0.7720172	2244.099	7937.812	5.000903E-11	23	909.4407	0.8753577	1911.249	14124.92	8.412025E-28	36	667.1597	CLDN4	CLDN4_P1120_R	34335232	NM_001305.3	CLDN4	1364	7	36.1	72882009	-1120	N	CTGGATTCCTGGCTGTTCCCAGAACGAGCTGCCTTTCCCCACCTTGCC	CPER, CPE-R, CPETR, CPETR1, WBSCR8, hCPE-R	Clostridium perfringens enterotoxin receptor 1; go_component: tight junction; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: identical protein binding; go_function: structural molecule activity; go_function: transmembrane receptor activity; go_process: pathogenesis; go_process: calcium-independent cell-cell adhesion	claudin 4
CLDN4_P431_R	4285	0.5229682	1049.701	1260.413	0.2551824	34	68.23995	0.9531449	509.9254	12407.35	1.276638E-16	41	778.1227	0.9697086	515.0833	19690.45	3.678E-38	31	953.8038	0.673202	310.0297	844.6586	0.642794	26	64.74564	0.9243397	401.1548	6122.589	0.0001305963	41	205.5057	0.9080203	421.6696	5149.906	0.0007485614	27	275.3542	0.9561931	475.3991	12559.49	2.195898E-14	21	802.0073	0.9593372	491.5138	13955.28	1.905149E-12	26	563.5374	0.9408798	512.2935	9744.452	3.395905E-11	25	1020.228	0.9672996	477.4762	17082.13	1.288532E-33	22	973.8866	CLDN4	CLDN4_P431_R	34335232	NM_001305.3	CLDN4	1364	7	36.1	72882698	-431	Y	GGCTCCTCACTCCCCTACACGTAACTTTATCCGGCCAATGCCGCAA	CPER, CPE-R, CPETR, CPETR1, WBSCR8, hCPE-R	Clostridium perfringens enterotoxin receptor 1; go_component: tight junction; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: identical protein binding; go_function: structural molecule activity; go_function: transmembrane receptor activity; go_process: pathogenesis; go_process: calcium-independent cell-cell adhesion	claudin 4
CLK1_P538_F	4290	0.07399307	7700.413	623.2961	8.439603E-10	26	284.7999	0.3053766	7718.056	3437.043	2.581996E-12	34	408.1265	0.347403	8632.698	4648.758	3.3623E-19	24	550.8467	0.05334755	4813.657	276.9037	0.0133643	29	182.5807	0.4056627	6638.276	4599.185	1.960958E-13	23	585.4426	0.3200946	6735.957	3218.319	5.441929E-12	30	610.1573	0.3695205	7448.228	4423.974	7.239791E-12	32	442.0869	0.374432	8675.513	5252.559	1.468521E-11	29	453.3654	0.3223852	7424.776	3580.023	5.905984E-13	31	514.5786	0.4247713	6975.607	5224.904	9.906919E-16	26	414.6797	CLK1	CLK1_P538_F	67551260	NM_004071.2	CLK1	1195	2	36.1	201438205	-538	N	CATGGTGCCTGCATCAGGCCCAACGTGGGCAGCCAGCATACCTCCCTGTC	CLK, STY, CLK/STY	isoform 1 is encoded by transcript variant 1; dual specificity protein kinase CLK1; CDC28/CDC2-like kinase; protein tyrosine kinase STY; go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: cell proliferation; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	CDC-like kinase 1 isoform 1
COL18A1_P365_R	3346	0.05343261	5228.729	300.8004	0.0002063662	27	273.3351	0.07882312	8620.783	746.2186	1.13406E-08	41	274.7346	0.07906087	10040.97	870.5828	9.785476E-13	32	578.5541	0.05662701	6989.496	425.5549	9.203591E-05	28	363.9019	0.102508	8192.63	947.152	7.880253E-09	27	429.4823	0.1376592	8679.396	1401.493	2.621403E-12	23	922.4258	0.107351	9097.337	1106.082	1.007067E-08	28	335.1926	0.1040814	10347.71	1213.74	5.581159E-08	26	589.9807	0.09524146	7906.625	842.8356	4.356451E-08	30	329.5674	0.08103401	8257.912	736.9969	1.903149E-08	26	320.2757	COL18A1	COL18A1_P365_R	18765745	NM_130444.1	COL18A1	80781	21	36.1	45649160	-365	Y	CGGGCAGCGGTGTTCACCTTCCGCATAAACCTGGGCTTCCTCGCGGGGCA	KNO, MGC74745	isoform 3 precursor is encoded by transcript variant 3; endostatin; antiangiogenic agent; multi-functional protein MFP; go_component: cytoplasm; go_component: collagen; go_component: extracellular matrix; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: structural molecule activity; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: phosphate transport; go_process: visual perception; go_process: organ morphogenesis; go_process: negative regulation of cell proliferation	alpha 1 type XVIII collagen isoform 3 precursor
COL18A1_P494_R	3245	0.1640135	7023.953	1397.659	4.899109E-10	28	344.3521	0.1073767	10005.88	1215.67	1.830292E-12	31	345.0197	0.1067441	12056.04	1452.647	6.768547E-20	34	529.3278	0.07447425	5991.417	490.1578	0.0008807493	13	244.4915	0.13785	9531.425	1539.978	4.976195E-13	33	428.8875	0.1843178	9368.996	2139.687	3.299655E-16	31	548.6995	0.1293055	10482.13	1571.536	3.051373E-12	40	463.4443	0.1129271	12994.57	1666.979	7.97852E-13	37	538.6696	0.1188619	9035.51	1232.342	3.205423E-11	25	584.0243	0.109564	10618	1318.799	4.911017E-15	30	375.3565	COL18A1	COL18A1_P494_R	18765745	NM_130444.1	COL18A1	80781	21	36.1	45649031	-494	Y	CCCTGCAGGGGCCTTGCGGGCCGGAGGTGCCGGCTTCCTCCTCCGT	KNO, MGC74745	isoform 3 precursor is encoded by transcript variant 3; endostatin; antiangiogenic agent; multi-functional protein MFP; go_component: cytoplasm; go_component: collagen; go_component: extracellular matrix; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: structural molecule activity; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: phosphate transport; go_process: visual perception; go_process: organ morphogenesis; go_process: negative regulation of cell proliferation	alpha 1 type XVIII collagen isoform 3 precursor
COL1A1_P117_R	3366	0.08899986	3120.034	314.5802	0.04825866	32	132.1219	0.3030611	7871.276	3466.278	9.981501E-13	27	429.3197	0.3223217	9546.536	4588.148	6.972671E-22	24	678.8658	0.07615904	3013.356	256.657	0.1535261	38	148.5556	0.3275982	8494.737	4187.407	3.039584E-17	23	529.1746	0.3008285	8338.703	3630.873	1.357081E-17	26	550.7588	0.267943	8883.625	3288.131	1.725012E-12	24	861.6593	0.3261259	9947.406	4862.509	4.335881E-13	28	608.1035	0.2897265	6906.755	2858.114	4.068109E-10	30	550.1194	0.337113	8493.505	4370.25	1.482532E-17	33	634.8585	COL1A1	COL1A1_P117_R	14719826	NM_000088.2	COL1A1	1277	17	36.1	45634109	-117	Y	CGTGCCCCAGCCAATCAGAGCTGCCTGGCCCGGCCCCCAATTTGGGAGTTGG	OI4, aa 694-711	Collagen I, alpha-1 polypeptide; osteogenesis imperfecta type IV; collagen of skin, tendon and bone, alpha-1 chain; pro-alpha-1 collagen type 1; type I collagen pro alpha 1(I) chain propeptide; collagen alpha 1 chain type I; type I collagen alpha 1 chain; type II procollagen gene fragment; Collagen alpha 1 chain; go_component: collagen; go_component: cytoplasm; go_component: collagen type I; go_function: structural constituent of bone; go_function: extracellular matrix structural constituent; go_process: phosphate transport; go_process: skeletal development; go_process: epidermis development; go_process: sensory perception of sound	alpha 1 type I collagen preproprotein
COL1A1_P5_F	3253	0.4388049	2262.87	1847.555	0.01175037	17	166.2217	0.4774411	4697.023	4382.848	3.730458E-08	31	291.1451	0.4543575	5376.954	4560.669	1.686634E-10	33	346.275	0.3257417	780.766	425.5078	0.6300946	21	57.12686	0.452088	4526.444	3817.328	2.28038E-07	32	289.6268	0.5888304	4389.469	6429.308	2.999895E-14	31	425.9281	0.5346465	4411.31	5183.063	1.029734E-07	26	472.4219	0.4358203	5690.559	4473.12	3.18901E-06	27	380.1464	0.5139179	3985.466	4319.423	2.784809E-07	33	334.6396	0.4159921	5738.987	4159.143	3.047595E-10	19	381.4001	COL1A1	COL1A1_P5_F	14719826	NM_000088.2	COL1A1	1277	17	36.1	45633997	-5	Y	AGAAACTCCCGTCTGCTCCGACGACTGGCCCGGGCCCCTTTTATACTGTC	OI4, aa 694-711	Collagen I, alpha-1 polypeptide; osteogenesis imperfecta type IV; collagen of skin, tendon and bone, alpha-1 chain; pro-alpha-1 collagen type 1; type I collagen pro alpha 1(I) chain propeptide; collagen alpha 1 chain type I; type I collagen alpha 1 chain; type II procollagen gene fragment; Collagen alpha 1 chain; go_component: collagen; go_component: cytoplasm; go_component: collagen type I; go_function: structural constituent of bone; go_function: extracellular matrix structural constituent; go_process: phosphate transport; go_process: skeletal development; go_process: epidermis development; go_process: sensory perception of sound	alpha 1 type I collagen preproprotein
COL1A2_E299_F	3083	0.1133909	4857.501	634.0284	0.0002344761	28	244.6883	0.1237281	14615.59	2077.817	2.946482E-28	19	521.7335	0.1203643	15094.9	2079.183	5.58898E-33	32	821.9724	0.1086926	4178.142	521.7081	0.02504435	35	281.3059	0.1205358	12853.01	1775.288	3.330882E-23	35	735.5216	0.1244581	14941.13	2138.095	3.952192E-37	23	912.7218	0.1211722	13641.1	1894.615	1.017155E-20	31	899.6663	0.1444581	14617.7	2485.08	1.442025E-17	27	690.6588	0.1424751	9975.953	1674.089	1.371812E-14	16	1086.897	0.1232524	16130.65	2281.69	3.993684E-37	23	847.849	COL1A2	COL1A2_E299_F	48762933	NM_000089.3	COL1A2	1278	7	36.1	93862108	299	Y	ACCCTAGGGCCAGGGAAACTTTTGCCGTATAAATAGGGCAGATCCGGGCTTT	OI4	Collagen I, alpha-2 polypeptide; osteogenesis imperfecta type IV; Collagen of skin, tendon and bone, alpha-2 chain; alpha 2(I)-collagen; alpha-2 collagen type I; type I procollagen; go_component: collagen; go_component: cytoplasm; go_component: collagen type I; go_component: collagen type I; go_function: structural constituent of bone; go_function: extracellular matrix structural constituent; go_function: extracellular matrix structural constituent; go_process: phosphate transport; go_process: skeletal development; go_process: sensory perception of sound; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	alpha 2 type I collagen
COL1A2_P407_R	331	0.2356741	5968.741	1871.25	1.111568E-08	29	339.3871	0.6214637	5871.159	9803.179	8.598274E-25	26	1009.882	0.6271752	7376.021	12576.35	3.678E-38	34	1146.683	0.07252461	4258.447	340.812	0.02916352	25	154.82	0.8214126	3666.995	17326.29	3.678E-38	23	1038.841	0.8275985	4030.631	19828.73	3.678E-38	34	1227.818	0.6542889	6555.074	12595.32	4.231712E-32	25	1735.419	0.5860713	9792.434	14006.45	8.298977E-35	35	795.0114	0.7311025	3979.295	11091.15	4.6782E-25	28	951.5472	0.6016015	8823.808	13475.4	3.678E-38	29	946.3723	COL1A2	COL1A2_P407_R	48762933	NM_000089.3	COL1A2	1278	7	36.1	93861402	-407	N	CAAAGCCTATCCTCCCTGTAGCCGGGTGCCAAGCAGCCTCGAGCCTGCTC	OI4	Collagen I, alpha-2 polypeptide; osteogenesis imperfecta type IV; Collagen of skin, tendon and bone, alpha-2 chain; alpha 2(I)-collagen; alpha-2 collagen type I; type I procollagen; go_component: collagen; go_component: cytoplasm; go_component: collagen type I; go_component: collagen type I; go_function: structural constituent of bone; go_function: extracellular matrix structural constituent; go_function: extracellular matrix structural constituent; go_process: phosphate transport; go_process: skeletal development; go_process: sensory perception of sound; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	alpha 2 type I collagen
COL1A2_P48_R	315	0.1004052	3754.121	430.1647	0.009873506	31	171.8791	0.06352846	9698.642	664.7214	1.302695E-10	24	853.5268	0.05274029	13147.04	737.5516	4.461233E-21	30	616.4144	0.1546593	3488.218	656.4824	0.05534469	36	172.6946	0.05645305	10664.86	644.0688	1.307034E-13	22	694.5173	0.1567038	11685.13	2189.947	5.537552E-24	17	915.7084	0.07409213	10721.03	865.9105	2.730832E-11	30	835.5795	0.07756429	13179.53	1116.628	3.477791E-12	25	545.0698	0.08314233	7737.735	710.7402	1.549156E-07	31	581.3807	0.04920305	14298.99	745.1375	2.506511E-24	26	558.4268	COL1A2	COL1A2_P48_R	48762933	NM_000089.3	COL1A2	1278	7	36.1	93861761	-48	Y	GACTGGACAGCTCCTGCTTTGATCGCCGGAGATCTGCAAATTCTGCCCATGTCGGGG	OI4	Collagen I, alpha-2 polypeptide; osteogenesis imperfecta type IV; Collagen of skin, tendon and bone, alpha-2 chain; alpha 2(I)-collagen; alpha-2 collagen type I; type I procollagen; go_component: collagen; go_component: cytoplasm; go_component: collagen type I; go_component: collagen type I; go_function: structural constituent of bone; go_function: extracellular matrix structural constituent; go_function: extracellular matrix structural constituent; go_process: phosphate transport; go_process: skeletal development; go_process: sensory perception of sound; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	alpha 2 type I collagen
COL4A3_E205_R	125	0.05878431	14871.72	935.0696	2.865676E-37	34	990.5684	0.03809822	9223.899	369.2934	4.306137E-09	31	622.4227	0.02968911	11777.84	363.4326	6.572434E-16	29	421.0973	0.04800384	10907.14	555.0286	8.09816E-11	27	894.6196	0.04316502	8815.041	402.1779	5.572E-09	37	630.4427	0.04944532	11822.72	620.1882	4.412749E-19	26	517.3605	0.05428201	9974.603	578.2587	2.45827E-09	28	727.0693	0.04544092	12486.31	599.1597	3.381205E-10	22	648.0093	0.09432366	7224.279	762.8033	9.769692E-07	29	544.8587	0.04260992	11798.04	529.538	4.51632E-16	29	468.6747	COL4A3	COL4A3_E205_R	14165449	NM_031366.1	COL4A3	1285	2	36.1	227737730	205	Y	CAGGCCGCAGGTGCTCCTGCTGCCGCTCCTGCTGGTGCTCCTGGCGGCGGCGCC	.	isoform 5, precursor is encoded by transcript variant 6; Goodpasture antigen; collagen IV, alpha-3 polypeptide; tumstatin; alpha3 type IV collagen; go_component: collagen; go_component: cytoplasm; go_component: collagen type IV; go_function: protein binding; go_function: integrin binding; go_function: serine carboxypeptidase activity; go_function: extracellular matrix structural constituent; go_function: metalloendopeptidase inhibitor activity; go_process: proteolysis; go_process: cell adhesion; go_process: circulation; go_process: phosphate transport; go_process: caspase activation; go_process: cell proliferation; go_process: induction of apoptosis; go_process: sensory perception of sound; go_process: negative regulation of angiogenesis; go_process: negative regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	alpha 3 type IV collagen isoform 5, precursor
COL4A3_P545_F	3280	0.1120729	6459.428	827.9216	1.69354E-07	20	615.5358	0.04986714	9637.17	511.0494	3.571417E-10	29	735.3062	0.05757156	13540.57	833.2821	1.141212E-22	27	524.0304	0.07828375	4385.605	380.9741	0.02259019	40	211.377	0.04617868	10733.94	524.5186	1.741158E-13	30	663.0245	0.06235434	12013.33	805.5483	2.607201E-20	25	692.808	0.0522897	13295.21	739.0774	9.13954E-17	31	597.0358	0.06349193	13764.39	939.9567	6.69623E-13	33	591.0754	0.09798526	6808.752	750.4931	4.821881E-06	27	554.6	0.05949135	13242.62	843.98	3.304523E-21	17	760.0529	COL4A3	COL4A3_P545_F	14165449	NM_031366.1	COL4A3	1285	2	36.1	227736980	-545	Y	GGCGCCTTACCTGTGGGGACGCCCGCAGCGCCAGGAGCTGCCGCCTTG	.	isoform 5, precursor is encoded by transcript variant 6; Goodpasture antigen; collagen IV, alpha-3 polypeptide; tumstatin; alpha3 type IV collagen; go_component: collagen; go_component: cytoplasm; go_component: collagen type IV; go_function: protein binding; go_function: integrin binding; go_function: serine carboxypeptidase activity; go_function: extracellular matrix structural constituent; go_function: metalloendopeptidase inhibitor activity; go_process: proteolysis; go_process: cell adhesion; go_process: circulation; go_process: phosphate transport; go_process: caspase activation; go_process: cell proliferation; go_process: induction of apoptosis; go_process: sensory perception of sound; go_process: negative regulation of angiogenesis; go_process: negative regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	alpha 3 type IV collagen isoform 5, precursor
COL6A1_P283_F	1990	0.2598066	1320.763	498.6854	0.4128149	26	65.74739	0.02694461	11755.99	328.3009	1.699594E-14	21	763.0831	0.02439064	13681.75	344.5496	1.565723E-21	24	602.7587	0.1973424	5015.873	1257.795	0.001388513	28	408.1851	0.03422567	9955.032	356.3361	2.884787E-11	25	730.5834	0.0373014	11402.16	445.6708	3.196755E-17	21	546.6028	0.02759347	11353.47	325.0092	1.790812E-11	32	683.574	0.03501387	14888.22	543.8374	3.115626E-14	29	547.0567	0.0561103	8252.269	496.5075	4.369313E-08	30	544.6914	0.02483776	14599.62	374.405	4.317912E-24	34	557.3311	COL6A1	COL6A1_P283_F	15011912	NM_001848.1	COL6A1	1291	21	36.1	46225813	-283	Y	TGACACGGGAACTGAACTGCAGGCCGCGGCGAGCCAGCCAGGGAAACCGC	OPLL	collagen VI, alpha-1 polypeptide; alpha 1 (VI) chain (61 AA); go_component: collagen; go_component: cytoplasm; go_component: collagen type VI; go_function: protein binding; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: phosphate transport	collagen, type VI, alpha 1 precursor
COL6A1_P425_F	1998	0.1235921	5050.87	726.3816	8.740253E-05	36	230.7171	0.06259257	12903.75	868.2863	5.757763E-19	23	1127.709	0.08146475	12596.74	1126.072	1.452942E-20	26	623.06	0.05114518	4096.177	226.1824	0.04348312	30	200.9078	0.06911074	13802.38	1032.135	6.841585E-24	20	1036.675	0.08918694	14582.69	1437.731	1.883908E-32	30	935.597	0.09225494	13541.34	1386.382	4.601915E-19	31	649.41	0.0777856	16694.75	1416.579	9.111744E-20	31	747.7583	0.1000213	8423.502	947.2802	2.682493E-09	17	586.377	0.06215604	13964.66	932.1418	7.835096E-24	29	866.4802	COL6A1	COL6A1_P425_F	15011912	NM_001848.1	COL6A1	1291	21	36.1	46225671	-425	Y	GAAGAGGCGAGTGAGCCTGCCCGTGCGTCCCGCATGGAGACGTCTGGA	OPLL	collagen VI, alpha-1 polypeptide; alpha 1 (VI) chain (61 AA); go_component: collagen; go_component: cytoplasm; go_component: collagen type VI; go_function: protein binding; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: phosphate transport	collagen, type VI, alpha 1 precursor
COMT_E401_F	130	0.04393754	6270.861	292.7842	4.200425E-06	34	259.7253	0.1699111	10752.44	2221.388	9.038014E-17	24	773.8484	0.1669095	14559.6	2937.047	2.682372E-34	26	947.4866	0.06303859	6342.362	433.4409	0.0004489421	23	347.2607	0.139866	11323.07	1857.499	1.114439E-18	25	693.5575	0.1548121	10204.27	1887.422	5.688694E-18	29	849.1563	0.1783164	11103.57	2431.326	1.498166E-15	34	699.2043	0.1603494	13739.08	2642.872	4.414149E-16	34	697.7007	0.1484097	8179.556	1442.908	8.128268E-10	34	497.9662	0.1494287	15339.2	2712.366	1.282596E-35	27	882.4176	COMT	COMT_E401_F	22035669	NM_145748.1	TXNRD2	10587	22	36.1	18309710	-195	N	GGGCTCCAGATAGCGGTGAGAGATCCCGCTTCAAGACTGGGTTGGG	TR, TR3, SELZ, TRXR2, TR-BETA	isoform 3 is encoded by transcript variant 3; thioredoxin reductase 3; selenoprotein Z; thioredoxin reductase beta; go_component: mitochondrion; go_function: FAD binding; go_function: selenium binding; go_function: disulfide oxidoreductase activity; go_function: thioredoxin-disulfide reductase activity; go_function: oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor; go_process: electron transport; go_process: response to oxygen radical	thioredoxin reductase 2 isoform 3
COPG2_P298_F	361	0.05332809	4452.797	256.4689	0.002557507	21	178.0549	0.1468106	7453.421	1299.737	1.372327E-07	33	340.133	0.1685004	8042.808	1650.11	5.631919E-10	32	330.7352	0.08061077	2887.808	261.9668	0.1729512	25	89.81155	0.1879344	6593.853	1549.142	5.034705E-07	14	435.9984	0.1808889	7592.686	1698.819	2.091143E-10	27	356.1417	0.1994569	7204.998	1820.055	7.769592E-07	19	514.9575	0.1789462	7807.288	1723.37	1.632216E-05	25	309.576	0.1415935	7513.935	1255.912	3.990062E-08	41	336.2439	0.187727	7193.364	1685.593	3.12945E-08	25	405.7115	COPG2	COPG2_P298_F	66348036	NM_012133.2	COPG2	26958	7	36.1	130004406	-298	Y	GGGGTCTGTGTTCACCCGATGACCGTGGCCTTTTTGATAATCCACTGCGGGGCC	2-COP, FLJ11781	coat protein, nonclathrin, gamma-2-cop; go_component: membrane; go_component: Golgi stack; go_component: COPI vesicle coat; go_function: binding; go_function: methionine synthase activity; go_process: protein transport; go_process: methionine biosynthesis; go_process: intra-Golgi transport; go_process: retrograde transport, Golgi to ER	coatomer protein complex, subunit gamma 2
CPA4_E20_F	3087	0.3605149	1048.363	647.3991	0.4562402	29	78.06587	0.6934935	2844.503	6662.154	6.256819E-09	33	444.9173	0.7446164	2927.166	8826.241	7.254769E-15	34	567.2196	0.5710339	713.8481	1083.384	0.4778765	34	87.63403	0.6996514	2638.976	6380.346	1.342001E-08	29	345.0785	0.715789	2556.462	6690.333	2.646668E-10	32	369.2413	0.7380913	2547.592	7461.246	2.155762E-08	27	502.3223	0.7362937	2744.271	7941.481	7.556213E-07	30	472.042	0.6289679	2807.885	4929.403	2.513726E-06	28	532.7536	0.7504195	2516.784	7867.946	2.712578E-11	30	354.7659	CPA4	CPA4_E20_F	61743915	NM_016352.2	CPA4	51200	7	36.1	129720250	20	N	CTTGACTCAGCCACTGTATGACTGACTCCCCGGGGACATGAGGTGGATACT	CPA3	carboxypeptidase A3; go_component: cellular component unknown; go_function: metal ion binding; go_function: carboxypeptidase activity; go_function: metallopeptidase activity; go_function: carboxypeptidase A activity; go_process: proteolysis; go_process: histone acetylation	carboxypeptidase A4 preproprotein
CPA4_P1265_R	377	0.4583579	807.635	768.0748	0.4989015	34	58.37766	0.9312662	870.5618	13150.03	1.113036E-19	31	753.505	0.9377952	829.3404	14010.67	3.037878E-24	27	857.4849	0.7821359	708.7857	2903.555	0.106392	21	202.236	0.9374681	736.5779	12541.83	5.726492E-19	22	693.4574	0.9418541	861.2526	15570.47	3.140117E-34	24	1153.585	0.9278538	877.9316	12576.93	2.320473E-15	19	856.9067	0.9470929	823.7853	16536.74	4.076322E-18	26	692.7952	0.9143311	830.8711	9935.041	2.233228E-12	20	888.6719	0.9450071	788.1525	15262.17	7.473623E-28	17	674.4446	CPA4	CPA4_P1265_R	61743915	NM_016352.2	CPA4	51200	7	36.1	129718965	-1265	N	CACTGATCCTCTCTGTTTTCTTTGCCGTATTCAGTGTTAAGCACAGTAAGTCTTTCC	CPA3	carboxypeptidase A3; go_component: cellular component unknown; go_function: metal ion binding; go_function: carboxypeptidase activity; go_function: metallopeptidase activity; go_function: carboxypeptidase A activity; go_process: proteolysis; go_process: histone acetylation	carboxypeptidase A4 preproprotein
CPA4_P961_R	368	0.2514582	6577.155	2243.062	4.954393E-11	37	332.0104	0.9632322	686.6237	20607.74	3.678E-38	23	1067.556	0.9601232	781.5646	21225.63	3.678E-38	35	911.5875	0.3249952	2292.354	1151.849	0.1280471	25	192.2831	0.9450462	826.6843	15936.3	7.723304E-31	26	841.6072	0.9431793	1010.047	18425.91	3.678E-38	35	1072.905	0.9440523	969.0438	18038.87	1.333688E-31	24	1256.288	0.9418429	1421.812	24645.42	3.678E-38	25	793.6746	0.9231738	796.7076	10775.2	2.192339E-14	28	828.8742	0.9668311	655.4932	22021.64	3.678E-38	28	776.1926	CPA4	CPA4_P961_R	61743915	NM_016352.2	CPA4	51200	7	36.1	129719269	-961	N	TCTTCCATTTATTCAGCTGTGACTTGGCGGAAAGGACACCAGACCCACAGT	CPA3	carboxypeptidase A3; go_component: cellular component unknown; go_function: metal ion binding; go_function: carboxypeptidase activity; go_function: metallopeptidase activity; go_function: carboxypeptidase A activity; go_process: proteolysis; go_process: histone acetylation	carboxypeptidase A4 preproprotein
CPNE1_P138_F	401	0.04234367	4948.596	223.2284	0.0006578098	34	141.3082	0.04861572	9806.285	506.2111	1.657114E-10	23	385.205	0.04877342	10832.98	560.58	6.21505E-14	26	518.9586	0.06313505	3954.002	273.198	0.04955223	35	194.5001	0.06765182	8354.174	613.4406	1.68228E-08	23	275.0239	0.05185755	9514.099	525.8319	3.324011E-12	27	591.5892	0.06240499	9907.412	666.0791	2.257966E-09	34	335.4467	0.05613191	11173.61	670.4427	2.287534E-08	29	443.3172	0.08839745	7690.038	755.3945	1.568724E-07	28	429.8864	0.05025289	10343.73	552.5975	1.844008E-12	21	690.2842	CPNE1	CPNE1_P138_F	23397699	NM_152927.1	CPNE1	8904	20	36.1	33716400	-138	Y	ATTCAGTCCCTGCTTGCGACTGTTGGCGCACAGGACCGACCTTGGGCTAGTGGCC	CPN1, COPN1, MGC1142	go_function: transporter activity; go_function: calcium-dependent phospholipid binding; go_process: lipid metabolism; go_process: vesicle-mediated transport	copine I
CREB1_P819_F	4297	0.1003814	1846.867	217.2355	0.3304454	31	67.16328	0.1733023	5395.58	1152.05	0.0002132166	34	213.354	0.1292362	6597.728	994.0573	4.150479E-06	28	289.9514	0.23057	362.1391	138.4862	0.7866681	28	16.28923	0.2299842	4814.853	1467.942	0.0002635317	27	288.6716	0.2180346	5252.861	1492.532	1.701718E-05	39	267.1263	0.1931305	5736.9	1397.107	0.0002243883	25	271.8068	0.1725858	6485.851	1373.707	0.0006736525	25	297.1229	0.1726399	4825.836	1027.842	0.0009777048	29	231.1212	0.2265991	6200.414	1845.962	8.909524E-07	33	239.2778	CREB1	CREB1_P819_F	22219460	NM_134442.2	CREB1	1385	2	36.1	208102112	-819	Y	TGTAGAAAACAGGCTGAGGAAAGAAAGCGACACAGGATGTTGTCTGGAGAAA	CREB, MGC9284	isoform B is encoded by transcript variant B; cAMP-response element-binding protein-1; active transcription factor CREB; transactivator protein; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: protein binding; go_function: transcription factor activity; go_function: transcription cofactor activity; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	cAMP responsive element binding protein 1 isoform B
CREBBP_P712_R	3290	0.8575334	1462.991	9407.941	5.287857E-17	23	390.9228	0.8716218	1871.681	13386.71	1.90412E-23	34	479.2667	0.8815362	1818.463	14276.05	9.20302E-29	43	679.592	0.8188158	1379.601	6686.677	1.543272E-05	20	348.9154	0.8829139	1556.994	12494.94	2.437879E-21	23	619.4918	0.8737513	1762.699	12891.5	6.672127E-27	31	618.4675	0.8750223	1906.099	14045.56	6.790885E-22	40	690.2085	0.8918239	1951.848	16915.82	1.651763E-21	24	1155.446	0.8713952	1639.223	11784.56	1.227892E-19	22	563.3218	0.8487164	2030.3	11951.2	7.040781E-21	26	421.8885	CREBBP	CREBBP_P712_R	4758055	NM_004380.1	CREBBP	1387	16	36.1	3871424	-712	Y	AGTGAGGGGGCCTCACGCCTGTTCGCATCCCAAGGCGGCAGGGCAGACACC	CBP, RTS, RSTS	CREB-binding protein; go_component: nucleus; go_component: nucleus; go_component: cytoplasm; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: signal transducer activity; go_function: signal transducer activity; go_function: transcription factor activity; go_function: histone acetyltransferase activity; go_function: transcription coactivator activity; go_function: transcription coactivator activity; go_process: homeostasis; go_process: response to hypoxia; go_process: signal transduction; go_process: protein complex assembly; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	CREB binding protein
CRIP1_P274_F	427	0.3032317	5384.024	2386.633	1.584762E-08	35	277.6785	0.3349417	9420.933	4795.004	2.989107E-20	35	810.3501	0.262305	12793.29	4584.514	8.271588E-34	22	934.2063	0.5247648	2642.087	3027.871	0.004723206	35	200.989	0.3370392	9554.729	4908.318	1.163252E-22	27	809.9108	0.3504634	10297.81	5610.232	5.652134E-32	25	1207.274	0.4778711	8399.661	7779.195	1.496769E-22	24	685.3837	0.3977765	12757.6	8492.616	1.635882E-27	22	659.0953	0.4585338	6302.756	5422.093	8.727367E-15	21	825.7457	0.3374104	9120.667	4695.438	2.285744E-20	21	453.9886	CRIP1	CRIP1_P274_F	39725694	NM_001311.3	CRIP1	1396	14	36.1	105024320	-274	Y	AGACATCACAGCGCTGGGCTAGGGGCGCGGCTTGAACTCGCCTAAAGAGCTG	CRHP, CRIP, CRP1	cysteine-rich heart protein; go_component: cytoplasm; go_function: metal ion binding; go_function: zinc ion binding; go_process: cell proliferation; go_process: antimicrobial humoral response (sensu Vertebrata)	cysteine-rich protein 1 (intestinal)
CRIP1_P874_R	403	0.2854687	7967.169	3222.986	4.622767E-18	30	506.1776	0.5103166	6010.005	6367.454	3.168847E-15	17	789.9462	0.3652804	8645.974	5033.297	1.991094E-20	20	750.8005	0.2940494	4012.112	1712.817	0.004250275	36	219.4852	0.451207	5433.237	4549.32	1.507742E-10	31	446.1805	0.3617786	6445.156	3710.15	1.697916E-12	24	632.2682	0.3698618	7015.266	4176.33	1.616506E-10	30	704.9658	0.3421873	9234.34	4855.627	7.834671E-12	27	614.5466	0.4145737	4558.887	3299.223	1.598716E-06	36	702.6863	0.4563202	4911.609	4206.333	1.113486E-08	24	361.0219	CRIP1	CRIP1_P874_R	39725694	NM_001311.3	CRIP1	1396	14	36.1	105023720	-874	Y	CCTCAACTTTGCAGCGTACTTGGACCGCTCTGGCCGCCCTGGGCGCTACCC	CRHP, CRIP, CRP1	cysteine-rich heart protein; go_component: cytoplasm; go_function: metal ion binding; go_function: zinc ion binding; go_process: cell proliferation; go_process: antimicrobial humoral response (sensu Vertebrata)	cysteine-rich protein 1 (intestinal)
CRK_P721_F	3392	0.1280186	1371.852	216.0877	0.4945469	28	46.30614	0.5359055	4575.053	5398.441	7.957717E-10	29	725.8872	0.5051054	5894.506	6118.186	1.471529E-15	25	526.171	0.7731147	303.3612	1374.459	0.5091087	23	68.95879	0.5285154	4331.946	4968.035	3.832576E-09	29	465.0903	0.618558	3885.156	6462.452	5.43321E-13	21	519.999	0.4791286	5503.278	5154.23	1.594101E-09	29	668.0165	0.574669	4918.929	6781.126	3.614937E-08	35	375.0134	0.4155186	4470.995	3249.605	2.674093E-06	24	579.7737	0.5967734	5069.096	7650.237	3.781861E-17	26	632.3027	CRK	CRK_P721_F	41327709	NM_005206.3	CRK	1398	17	36.1	1307015	-721	Y	AGCTTCTCCACAGACCAGCTGACGTTCTCATTTTCATTGATTCACCTAGGAC	CRKII	isoform b is encoded by transcript variant I; v-crk avian sarcoma virus CT10 oncogene homolog; avian sarcoma virus CT10 (v-crk) oncogene homolog; go_component: nucleus; go_component: cytoplasm; go_function: protein binding; go_function: SH2 domain binding; go_function: SH3/SH2 adaptor activity; go_process: cell motility; go_process: intracellular signaling cascade; go_process: actin cytoskeleton organization and biogenesis; go_process: regulation of transcription from RNA polymerase II promoter	v-crk sarcoma virus CT10 oncogene homolog isoform b
CSF1_P217_F	430	0.1498232	1362.563	257.7416	0.4830268	29	43.9876	0.2284515	3983.063	1208.974	0.005716853	38	179.3255	0.2018604	5131.172	1323.035	0.0001764675	36	191.1959	0.2839301	1270.005	543.2229	0.473699	36	77.47183	0.2339956	4456.162	1391.796	0.000862824	15	206.3558	0.256566	3961.023	1401.497	0.001338501	25	235.6614	0.2776394	3998.206	1575.146	0.007321515	33	265.777	0.2500986	4931.974	1678.207	0.00627067	24	192.1865	0.2212264	3478.221	1016.466	0.02074505	32	219.6338	0.1977968	4984.125	1253.578	0.0003392413	31	182.8727	CSF1	CSF1_P217_F	27262662	NM_172210.1	CSF1	1435	1	36.1	110254763	-217	Y	TTTGCTGAAGGCTTGGAAGTGCAGCGCAGAAGACAGAGGGTGACTAGGAA	MCSF, MGC31930	isoform b precursor is encoded by transcript variant 2; macrophage colony stimulating factor; go_component: membrane; go_component: extracellular space; go_component: integral to membrane; go_function: macrophage colony stimulating factor receptor binding; go_process: hemopoiesis; go_process: cell proliferation; go_process: cell differentiation; go_process: macrophage differentiation; go_process: positive regulation of cell proliferation	colony stimulating factor 1 isoform b precursor
CSF1_P339_F	433	0.1096465	2730.081	348.5228	0.08944053	30	136.2808	0.07177258	8806.913	688.7021	6.560478E-09	31	594.6578	0.1041897	11706.61	1373.201	1.358873E-18	28	686.4882	0.08103471	1888.995	175.3903	0.4087742	42	87.44553	0.1165082	10130.01	1349.056	4.917423E-14	24	496.2149	0.1097486	9788.851	1219.08	8.993072E-15	31	669.2031	0.09438639	11801.26	1240.394	2.119187E-14	20	568.7732	0.1018189	12141.71	1387.736	6.659131E-11	26	730.6757	0.1029073	7369.298	856.8177	3.822055E-07	28	500.1468	0.107889	10375.59	1266.884	2.796928E-14	25	738.8558	CSF1	CSF1_P339_F	27262662	NM_172210.1	CSF1	1435	1	36.1	110254641	-339	Y	GGAAAGTCCCTTGGGACGATCATAGAGCGCTAGCACTGAATCAGCCTGGAGAGCG	MCSF, MGC31930	isoform b precursor is encoded by transcript variant 2; macrophage colony stimulating factor; go_component: membrane; go_component: extracellular space; go_component: integral to membrane; go_function: macrophage colony stimulating factor receptor binding; go_process: hemopoiesis; go_process: cell proliferation; go_process: cell differentiation; go_process: macrophage differentiation; go_process: positive regulation of cell proliferation	colony stimulating factor 1 isoform b precursor
CSF1R_E26_F	210	0.3736856	3730.348	2285.348	3.659082E-05	30	263.4788	0.8891576	1632.653	13899.03	2.513606E-24	28	970.4382	0.898966	2213.57	20585.34	3.678E-38	35	797.1572	0.3966637	1974.228	1363.702	0.1432183	28	227.4702	0.8552182	2588.504	15880.85	9.066563E-38	22	760.6586	0.8907437	2233.548	19024.93	3.678E-38	27	1052.03	0.9051671	2195.933	21914.36	3.678E-38	19	1176.706	0.8817534	2731.174	21111.8	6.093679E-35	23	832.9283	0.8611977	1918.794	12525.59	6.511641E-23	33	964.5379	0.9363029	1575.462	24628.13	3.678E-38	32	880.9402	CSF1R	CSF1R_E26_F	27262658	NM_005211.2	CSF1R	1436	5	36.1	149473102	26	N	TTCTCCTCACTTCGTGCTCTCACGCTTTTGGACACTCTGTCTGCCCTTCTCC	FMS, CSFR, FIM2, C-FMS, CD115	CD115 antigen; FMS proto-oncogene; macrophage colony stimulating factor I receptor; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: macrophage colony stimulating factor receptor activity; go_process: development; go_process: cell proliferation; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: transmembrane receptor protein tyrosine kinase signaling pathway	colony stimulating factor 1 receptor precursor
CSF1R_P73_F	3420	0.2982269	5857.322	2531.636	5.878398E-10	26	307.3602	0.7755666	2743.813	9827.264	1.019348E-15	30	626.5351	0.8704034	2254.628	15814.27	1.052211E-36	26	765.5585	0.5756181	3007.475	4214.881	0.0001510097	41	221.7474	0.7845315	3105.907	11672.87	1.051992E-23	27	435.7543	0.7407534	4291.824	12548.89	4.780454E-36	40	858.7983	0.8277892	2899.56	14418.4	5.314064E-26	33	900.0458	0.7785969	4630.834	16636.68	1.469913E-27	27	694.8209	0.779158	2918.736	10650.47	4.35525E-20	25	754.0199	0.88981	1671.71	14306.98	1.358006E-27	36	674.3638	CSF1R	CSF1R_P73_F	27262658	NM_005211.2	CSF1R	1436	5	36.1	149473201	-73	N	TCTAGCAGCTGCCTGTCACAGAGCACGCCGGCCTCAATCCGGGCCTGTGGGC	FMS, CSFR, FIM2, C-FMS, CD115	CD115 antigen; FMS proto-oncogene; macrophage colony stimulating factor I receptor; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: macrophage colony stimulating factor receptor activity; go_process: development; go_process: cell proliferation; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: transmembrane receptor protein tyrosine kinase signaling pathway	colony stimulating factor 1 receptor precursor
CSF2_E248_R	213	0.7084266	1335.53	3487.861	0.001856539	24	130.7926	0.911338	1144.591	12792.88	1.935342E-19	28	1087.724	0.9223382	1403.463	17855.66	3.678E-38	35	862.1405	0.7057235	1000.611	2639.446	0.1030927	28	157.6307	0.910676	1334.677	14626.82	7.74721E-28	32	595.072	0.8953645	1817.625	16409.1	3.678E-38	29	683.7523	0.9234354	1407.669	18183.8	1.140665E-33	31	1089.82	0.9245984	1499.749	19616.63	3.731696E-27	42	741.7252	0.8958294	1006.904	9518.973	8.213089E-12	24	933.6824	0.9248254	1316.113	17421.54	3.678E-38	34	623.6121	CSF2	CSF2_E248_R	27437029	NM_000758.2	CSF2	1437	5	36.1	131437632	248	N	CAGCTGGCCCCTGACTGGCCACGCCTGTCAGCTTGATAACATGACATTTTCCT	GMCSF, MGC131935	sargramostim; molgramostin; granulocyte-macrophage colony stimulating factor; go_component: extracellular space; go_function: cytokine activity; go_function: granulocyte macrophage colony-stimulating factor receptor binding; go_process: development; go_process: cellular defense response; go_process: cell surface receptor linked signal transduction	colony stimulating factor 2 precursor
CSF2_P605_F	3448	0.5618675	2324.125	3108.733	0.0002849738	21	169.7294	0.9233261	814.473	11012.31	7.157604E-14	28	530.1463	0.9361124	869.6193	14207.33	4.575993E-25	32	702.7918	0.1145888	2896.813	387.8437	0.1512631	36	106.3327	0.9172464	877.5913	10835.69	1.245772E-14	25	545.3552	0.9324977	877.2548	13500.09	7.619606E-26	32	773.7898	0.9308254	921.0582	13739.52	2.327272E-18	23	883.7245	0.9340547	972.89	15196.51	1.173041E-15	37	578.5239	0.9180054	781.1855	9865.69	4.278245E-12	26	517.6288	0.9249116	837.401	11546.56	3.17764E-16	32	581.4803	CSF2	CSF2_P605_F	27437029	NM_000758.2	CSF2	1437	5	36.1	131436779	-605	N	GAAGCTTGCTGAGAGTGGCTGCAGTCTCGCTGCTGGATGTGCACATGGTG	GMCSF, MGC131935	sargramostim; molgramostin; granulocyte-macrophage colony stimulating factor; go_component: extracellular space; go_function: cytokine activity; go_function: granulocyte macrophage colony-stimulating factor receptor binding; go_process: development; go_process: cellular defense response; go_process: cell surface receptor linked signal transduction	colony stimulating factor 2 precursor
CSF3_E242_R	215	0.268305	4341.241	1628.557	4.341256E-05	33	213.6593	0.9027369	1543.081	15250.08	1.309829E-28	27	953.1544	0.9085407	1652.936	17413.35	3.678E-38	30	714.8978	0.369377	1187.486	754.1235	0.4403131	18	156.1326	0.8782957	1576.668	12099.91	3.599693E-20	31	878.6896	0.8985968	1535.969	14497.33	1.660121E-32	24	605.2626	0.8780159	1709.557	13024.81	1.492289E-18	23	897.5196	0.8808814	2352.419	18135.62	1.659947E-25	27	722.6917	0.9024419	1034.411	10493.64	2.847702E-14	28	1037.039	0.8879878	1663.461	13980.01	2.135911E-26	21	962.7289	CSF3	CSF3_E242_R	27437050	NM_172220.1	CSF3	1440	17	36.1	35425456	242	N	GGAACAGCATGTCTCCTGAGCCCGCTCTGTCCCCAGCCCTGCAGCTGCT	GCSF, G-CSF, MGC45931	isoform c is encoded by transcript variant 3; granulocyte colony stimulating factor; pluripoietin; filgrastim; lenograstim; go_component: extracellular space; go_component: extracellular space; go_function: cytokine activity; go_function: cytokine activity; go_function: interleukin-6 receptor binding; go_function: granulocyte colony-stimulating factor receptor binding; go_process: development; go_process: immune response; go_process: cell-cell signaling; go_process: cellular defense response; go_process: granulocyte differentiation; go_process: positive regulation of cell proliferation; go_process: cytokine and chemokine mediated signaling pathway	colony stimulating factor 3 isoform c
CSF3_P309_R	3453	0.2973145	5057.111	2182.034	2.123809E-07	32	365.2708	0.7742016	3100.983	10975.3	7.666726E-20	26	408.3053	0.7983673	3153.141	12880.85	1.553536E-28	24	882.3116	0.3124824	2605.726	1229.774	0.08191443	31	182.75	0.764401	3064.79	10268.16	3.94117E-19	31	464.6377	0.7575099	3281.769	10564.24	7.059639E-24	24	601.2154	0.789398	3131.485	12112.56	6.469769E-20	22	557.8734	0.7842488	3574.926	13358.24	3.273877E-17	26	697.1198	0.7918355	2699.602	10649.39	2.082238E-19	30	636.2042	0.7810882	2918.575	10770.43	5.589669E-20	34	540.8232	CSF3	CSF3_P309_R	27437050	NM_172220.1	CSF3	1440	17	36.1	35424905	-309	N	CACAGGCTGCTGCCGCTTCCAGGCGTCTATCAGCGGCTCAGCCTTTGTTCAGC	GCSF, G-CSF, MGC45931	isoform c is encoded by transcript variant 3; granulocyte colony stimulating factor; pluripoietin; filgrastim; lenograstim; go_component: extracellular space; go_component: extracellular space; go_function: cytokine activity; go_function: cytokine activity; go_function: interleukin-6 receptor binding; go_function: granulocyte colony-stimulating factor receptor binding; go_process: development; go_process: immune response; go_process: cell-cell signaling; go_process: cellular defense response; go_process: granulocyte differentiation; go_process: positive regulation of cell proliferation; go_process: cytokine and chemokine mediated signaling pathway	colony stimulating factor 3 isoform c
CSF3R_P472_F	3461	0.4123858	1670.502	1242.533	0.1157654	27	81.00077	0.8235003	1945.915	9545.693	4.413111E-13	28	556.6115	0.8236072	2156.867	10537.69	1.831252E-17	34	571.7231	0.287831	4431.312	1831.38	0.0014216	25	298.2576	0.7752252	2441.156	8764.186	2.350874E-13	28	471.2365	0.8158081	2203.295	10201.57	5.844416E-19	27	407.3099	0.8201428	2031.684	9720.406	1.271967E-11	39	580.5768	0.8059762	2509.813	10841.19	1.289081E-10	30	616.6702	0.8251182	1685.393	8423.754	7.262827E-11	29	401.6438	0.836875	2193.686	11767.22	8.159814E-21	36	525.4799	CSF3R	CSF3R_P472_F	27437044	NM_172313.1	CSF3R	1441	1	36.1	36721568	-472	N	CTCACTGCTCCCCTCTTCATTACGTATTCTGTGCATTGCCCATAGACCAGGCA	CD114, GCSFR	isoform d precursor is encoded by transcript variant 4; granulocyte colony stimulating factor receptor; CD114 antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: receptor activity; go_function: receptor activity; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: cell adhesion; go_process: defense response; go_process: signal transduction	colony stimulating factor 3 receptor isoform d precursor
CSF3R_P8_F	3463	0.07276124	7463.142	593.4863	3.583068E-09	35	337.2815	0.5949808	5166.009	7735.867	1.402144E-16	35	723.484	0.5951171	6982.557	10410.3	7.175557E-34	31	673.1238	0.08080887	5013.422	449.5364	0.006952675	28	347.8402	0.5946187	5990.278	8933.302	3.427374E-24	35	699.0001	0.6300932	5862.229	10155.96	1.925496E-32	40	813.7419	0.4871348	7443.618	7165.156	3.174689E-18	27	1142.359	0.4931688	8514.775	8382.552	3.888517E-17	20	1188.415	0.5681481	5134.713	6886.834	1.404726E-15	38	768.4177	0.5568471	7726.919	9834.975	1.261581E-33	31	712.9773	CSF3R	CSF3R_P8_F	27437044	NM_172313.1	CSF3R	1441	1	36.1	36721104	-8	N	GCTTCTCTCCCCGAGCTCTGTCGTTAATGGCTCAGCCTCTGACAGGCCCG	CD114, GCSFR	isoform d precursor is encoded by transcript variant 4; granulocyte colony stimulating factor receptor; CD114 antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: receptor activity; go_function: receptor activity; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: cell adhesion; go_process: defense response; go_process: signal transduction	colony stimulating factor 3 receptor isoform d precursor
CSK_P740_R	3479	0.4481511	3517.36	2937.623	6.570843E-06	32	231.5016	0.1660988	8393.245	1691.708	4.782237E-10	30	551.6094	0.1481777	10303.96	1809.808	7.815668E-16	27	479.6501	0.5146472	1758.207	1970.362	0.0930547	31	180.0139	0.1637716	7909.598	1568.644	1.689161E-09	34	488.3365	0.1450057	8752.593	1501.385	9.491656E-13	30	642.5792	0.1650819	9123.057	1823.604	4.692876E-10	29	480.1299	0.1809011	10163.56	2266.747	3.320324E-09	24	434.8151	0.1847756	8632.198	1979.206	5.184315E-12	21	485.5704	0.1694821	9022.935	1861.698	1.964207E-12	20	370.5554	CSK	CSK_P740_R	4758077	NM_004383.1	CSK	1445	15	36.1	72861028	-740	Y	CCACTTTGATCAATTATTTCCTTGCCGTTGTCTGTCGGCCTGTCAGCCTACCCC	MGC117393	go_component: cytoplasm; go_component: plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein C-terminus binding; go_function: protein-tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	c-src tyrosine kinase
CSPG2_E38_F	4073	0.06062119	1989.181	134.8217	0.3113069	30	89.60114	0.07670639	5174.842	438.2291	0.002270621	31	284.9963	0.06372975	6462.33	446.6826	4.308954E-05	37	333.4534	0.2269915	279.6939	111.496	0.8069435	42	11.11944	0.07047289	5973.682	460.4813	0.0001701833	35	300.1519	0.09680007	6853.791	745.2696	6.185876E-07	29	345.2763	0.05206304	6818.164	379.9626	0.0001900708	28	402.7701	0.04877573	8370.943	434.3628	9.109711E-05	45	251.9515	0.05312964	5432.097	310.4103	0.001304736	28	441.2296	0.04990065	6586.058	351.1619	4.223922E-05	34	446.1436	CSPG2	CSPG2_E38_F	21361115	NM_004385.2	CSPG2	1462	5	36.1	82803377	38	Y	TCTGGGGAAGAACTCCAGGCGTGCGGACGCAACAGCCGAGAACATTAGGTG	VERSICAN, DKFZp686K06110	go_component: extracellular matrix (sensu Metazoa); go_function: sugar binding; go_function: calcium ion binding; go_function: hyaluronic acid binding; go_process: development; go_process: cell recognition	chondroitin sulfate proteoglycan 2 (versican)
CSPG2_P82_R	2409	0.1466439	2545.731	454.6522	0.1012626	23	89.20326	0.3895848	5947.1	3859.436	1.685666E-09	30	441.377	0.3181022	7483.571	3537.701	5.288537E-13	41	306.7355	0.1982577	4544.146	1148.421	0.004523293	30	305.3733	0.3339881	6908.303	3514.487	1.624182E-11	32	380.7593	0.3508182	7703.225	4216.866	1.924754E-17	20	663.1144	0.3382786	6790.671	3522.58	6.503905E-09	32	296.4432	0.3795977	6905.532	4286.386	1.725422E-07	33	278.3953	0.3600779	6107.059	3492.651	9.068762E-10	28	391.4115	0.3557016	6705.919	3757.384	1.812437E-11	34	391.4649	CSPG2	CSPG2_P82_R	21361115	NM_004385.2	CSPG2	1462	5	36.1	82803257	-82	Y	CTCCCTCCTCCTTCTTCTCGCTGAGTCTCCTCCTCGGCTCTGACGGT	VERSICAN, DKFZp686K06110	go_component: extracellular matrix (sensu Metazoa); go_function: sugar binding; go_function: calcium ion binding; go_function: hyaluronic acid binding; go_process: development; go_process: cell recognition	chondroitin sulfate proteoglycan 2 (versican)
CSTB_E410_F	3099	0.03494578	5889.419	216.8841	2.59879E-05	25	227.9026	0.04823549	11229.47	574.1783	8.130708E-14	28	476.6175	0.04604073	15337.33	745.0488	1.022284E-28	29	540.9057	0.8617729	604.6703	4393.247	0.01559276	26	449.0327	0.05244821	11003.91	614.6155	2.179435E-14	27	632.5447	0.0779791	12062.26	1028.612	3.173949E-21	34	605.8696	0.05293093	11498.71	648.2428	1.945562E-12	35	615.333	0.05684353	14297.27	867.7158	9.79385E-14	24	762.6674	0.05964399	9696	621.3312	2.476351E-11	25	474.821	0.07000607	14510.88	1099.846	2.785968E-26	30	657.6709	CSTB	CSTB_E410_F	20357564	NM_000100.2	CSTB	1476	21	36.1	44020277	410	Y	CCGGGCTATCAATTCCCACTCGCCCTTGCTGTATTCAGCGGAGCCCAA	PME, CST6, EPM1, STFB, cystatin B	stefin B; liver thiol proteinase inhibitor; CPI-B; go_component: nucleus; go_function: cysteine protease inhibitor activity	cystatin B
CTAG1B_P4_R	480	0.776554	1153.41	4356.042	0.0002208009	34	191.6227	0.9165129	1143.47	13650.69	5.418452E-22	32	1159.809	0.9474671	1137.601	22321	3.678E-38	15	844.4077	0.7592145	1134.138	3891.327	0.014899	32	191.4678	0.9448586	1099.908	20560.67	3.678E-38	20	1557.589	0.9409321	1267.314	21780.86	3.678E-38	24	1310.5	0.9384781	1329.319	21803.35	3.678E-38	26	1135.456	0.9475453	1250.304	24391.98	3.678E-38	22	1433.32	0.9054293	1142.38	11894.67	1.81758E-18	38	1063.93	0.9347959	1337.531	20609.11	3.678E-38	29	882.5127	CTAG1B	CTAG1B_P4_R	4503118	NM_001327.1	CTAG1B	1485	X	36.1	153500718	-4	Y	AGAGAAGGTCAGGGCCCACGAGGATGCGGAGGCAGAGAGGCTGCAGGAA	CTAG, ESO1, CTAG1, LAGE-2, LAGE2B, NY-ESO-1	cancer antigen 3; New York esophageal squamous cell carcinoma 1; go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown	cancer/testis antigen 1B
CTAG1B_P77_F	482	0.3498802	2957.465	1645.46	0.003417432	33	149.9184	0.94339	993.8228	18228.23	6.789955E-38	29	1495.011	0.9615761	882.4628	24586.59	3.678E-38	29	563.7146	0.3201837	3672.528	1776.806	0.007127682	38	224.6114	0.9622054	866.9361	24617.02	3.678E-38	34	917.8351	0.9503236	1243.94	25709.96	3.678E-38	30	774.6971	0.95281	1164.842	25538.38	3.678E-38	31	1041.627	0.9580116	1182.913	29271.04	3.678E-38	29	764.9893	0.9329944	867.9413	13477.72	1.387901E-22	27	1652.374	0.9683797	719.321	25091.96	3.678E-38	22	1012.956	CTAG1B	CTAG1B_P77_F	4503118	NM_001327.1	CTAG1B	1485	X	36.1	153500791	-77	Y	CCGGGATCCTCAGGGCGCCTGCGCACAGGGGCCCTACTTCCGGCCC	CTAG, ESO1, CTAG1, LAGE-2, LAGE2B, NY-ESO-1	cancer antigen 3; New York esophageal squamous cell carcinoma 1; go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown	cancer/testis antigen 1B
CTAG2_P1426_F	509	0.2772756	3848.237	1514.754	0.0003582718	43	185.5244	0.9340405	971.7501	15176.85	2.247468E-26	37	1014.807	0.9477025	946.0347	18955.59	3.678E-38	28	1093.322	0.5712946	2215.98	3086.285	0.00927862	32	133.4161	0.9562073	868.7658	21152.86	3.678E-38	36	1457.277	0.9501672	1021.785	21389.18	3.678E-38	28	1728.574	0.955556	990.5941	23447.99	3.678E-38	43	1369.323	0.9563721	1125.01	26853.57	3.678E-38	28	1084.665	0.8993738	1114.384	10853.88	1.957602E-15	28	787.4139	0.9676014	810.7698	27200.62	3.678E-38	25	1022.122	CTAG2	CTAG2_P1426_F	50428920	NM_172377.2	CTAG2	30848	X	36.1	153536462	-1426	Y	GGCTGCAGCACCCAATTAAAGCCGTCTTCCCTGGTAATGCTCTTCGTCTCAGT	ESO2, CAMEL, LAGE-1, LAGE-2b, MGC3803	isoform LAGE-1a is encoded by transcript variant 1; CTL-recognized antigen on melanoma; go_component: integral to membrane; go_function: molecular function unknown; go_process: biological process unknown	cancer/testis antigen 2 isoform LAGE-1a
CTGF_E156_F	1277	0.04801421	5786.438	296.8875	2.836042E-05	24	241.826	0.08504313	8832.478	830.2532	3.180257E-09	21	438.7807	0.08825403	10530.53	1029.001	2.329956E-14	34	241.5361	0.08531874	4889.908	465.4437	0.008444289	23	185.8529	0.1078802	8623.088	1054.845	6.602658E-10	23	409.6838	0.09310241	9120.823	946.6128	2.834403E-12	24	419.3781	0.1106404	9576.801	1203.838	9.514723E-10	27	408.7416	0.1326869	11383.37	1756.797	2.777061E-10	27	555.7533	0.08648658	7313.285	701.8502	8.765963E-07	28	592.2281	0.1073678	8860.308	1077.766	2.511404E-10	34	324.5976	CTGF	CTGF_E156_F	4503122	NM_001901.1	CTGF	1490	6	36.1	132313999	156	Y	GGACGGGGCCCATACTGGCGGCGGTCATGGTTGGCACTGCGGGCGGAGCGGA	CCN2, NOV2, IGFBP8, MGC102839	go_component: soluble fraction; go_component: extracellular space; go_component: plasma membrane; go_component: extracellular matrix (sensu Metazoa); go_function: heparin binding; go_function: protein binding; go_function: insulin-like growth factor binding; go_process: cell motility; go_process: cell adhesion; go_process: DNA replication; go_process: response to wounding; go_process: epidermis development; go_process: regulation of cell growth	connective tissue growth factor
CTGF_P693_R	5560	0.7798321	424.2182	1856.774	0.2636034	30	86.17986	0.9596947	445.9333	12999.01	4.762116E-18	29	957.1158	0.9681715	490.109	17950.13	3.678E-38	21	1092.747	0.8704541	384.5809	3256.032	0.1030272	28	124.0005	0.9641361	401.6707	13486.49	7.971494E-21	22	1202.728	0.9627659	443.2496	14046.88	2.842912E-26	23	1286.297	0.9616608	458.86	14017.86	6.965911E-18	32	769.452	0.966126	504.7733	17248.87	5.697684E-19	20	840.8515	0.9499915	545.374	12259.91	8.754592E-18	31	728.6046	0.9643142	465.3315	15276.59	9.573209E-27	25	875.9953	CTGF	CTGF_P693_R	4503122	NM_001901.1	CTGF	1490	6	36.1	132314848	-693	N	GGTTTTGGGACAAGAAAGAGAACAAAGACGCGTGTGACTCAGGATGCAGTCTCC	CCN2, NOV2, IGFBP8, MGC102839	go_component: soluble fraction; go_component: extracellular space; go_component: plasma membrane; go_component: extracellular matrix (sensu Metazoa); go_function: heparin binding; go_function: protein binding; go_function: insulin-like growth factor binding; go_process: cell motility; go_process: cell adhesion; go_process: DNA replication; go_process: response to wounding; go_process: epidermis development; go_process: regulation of cell growth	connective tissue growth factor
CTLA4_E176_R	3115	0.2786822	3477.314	1382.1	0.00167466	29	214.9942	0.7755515	2679.99	9605.882	5.381488E-15	22	894.4401	0.8067896	3082.212	13287.98	8.242502E-30	34	531.7058	0.09289929	4276.204	448.182	0.02411716	35	126.2554	0.7867099	2485.658	9537.071	1.934432E-15	19	933.884	0.7418475	3163.012	9376.851	2.147159E-19	24	755.667	0.8141452	2466.198	11241.34	5.771594E-16	25	662.2532	0.7970879	3441.073	13910.19	4.267119E-18	33	560.6195	0.7505971	3125.625	9707.765	7.24749E-18	30	558.2706	0.6790321	4548.856	9835.012	3.758338E-22	22	680.4336	CTLA4	CTLA4_E176_R	21361211	NM_005214.2	CTLA4	1493	2	36.1	204440932	176	N	AAGCCATGGCTTGCCTTGGATTTCAGCGGCACAAGGCTCAGCTGAACCTGGCTACC	CD152, CTLA-4	cytotoxic T-lymphocyte-associated serine esterase-4; CTLA-4 V domain region; go_component: membrane; go_component: integral to plasma membrane; go_process: immune response; go_process: immune response	cytotoxic T-lymphocyte-associated protein 4
CTLA4_P1128_F	594	0.642258	3646.958	6726.956	2.004247E-15	23	504.0088	0.920736	1557.424	19252.75	3.678E-38	30	1474.882	0.9359061	1713.135	26475.61	3.678E-38	25	1572.921	0.3948911	4326.273	2888.564	0.0001539083	32	313.0328	0.9160792	1769.7	20409.64	3.678E-38	31	1333.75	0.9016746	2370.36	22653.97	3.678E-38	31	1096.854	0.9039696	2714.958	26498.25	3.678E-38	26	1505.644	0.9044795	2492.134	24544.82	3.678E-38	27	1317.262	0.8765766	1930.478	14420.85	9.239164E-30	34	1107.676	0.9483315	1414.648	27800.05	3.678E-38	32	1027.225	CTLA4	CTLA4_P1128_F	21361211	NM_005214.2	CTLA4	1493	2	36.1	204439628	-1128	N	GGTGATGAGGCCTGAAAGAGGCACGTGGAAGGAAAGACAAATGCAGG	CD152, CTLA-4	cytotoxic T-lymphocyte-associated serine esterase-4; CTLA-4 V domain region; go_component: membrane; go_component: integral to plasma membrane; go_process: immune response; go_process: immune response	cytotoxic T-lymphocyte-associated protein 4
CTLA4_P992_F	587	0.2680049	13670.78	5041.885	3.678E-38	25	1182.954	0.8484101	2211.949	12939.4	4.163084E-23	18	1412.271	0.9648528	779.464	24142.84	3.678E-38	33	1537.653	0.316197	7033.083	3298.405	7.91515E-09	30	436.9904	0.9500668	730.5292	15802.28	5.839215E-30	30	1307.421	0.8328331	2091.336	10917.33	6.029542E-21	25	1025.313	0.8351718	2720.307	14290.28	4.809285E-25	31	657.0928	0.8474549	2820.687	16225.7	6.235209E-22	24	758.8293	0.834022	1959.019	10346.36	2.329949E-16	25	759.8237	0.8244647	2995.871	14540.87	1.590911E-33	22	880.9072	CTLA4	CTLA4_P992_F	21361211	NM_005214.2	CTLA4	1493	2	36.1	204439764	-992	N	GTGTGGACAATGGGAAACCATGGACGGACTGGAGTAGGCAAATGTCATATT	CD152, CTLA-4	cytotoxic T-lymphocyte-associated serine esterase-4; CTLA-4 V domain region; go_component: membrane; go_component: integral to plasma membrane; go_process: immune response; go_process: immune response	cytotoxic T-lymphocyte-associated protein 4
CTNNA1_P185_R	3503	0.485714	4731.535	4563.111	2.757203E-12	26	296.7368	0.03848809	9111.084	368.7079	7.020734E-09	26	234.0285	0.0422801	9351.941	417.2713	3.881881E-10	19	326.8979	0.2192709	6066.453	1731.873	3.285985E-05	25	441.5462	0.03402912	8099.781	288.861	1.9045E-07	36	390.2754	0.04855998	8264.546	426.9131	4.419762E-09	23	478.0488	0.04086959	8618.713	371.5139	8.750202E-07	33	394.4403	0.02436906	10578.32	266.7203	4.788411E-07	27	474.4843	0.04461203	7070.802	334.842	8.333773E-06	35	362.9831	0.03170146	10353.11	342.2281	5.397626E-12	36	268.503	CTNNA1	CTNNA1_P185_R	55770843	NM_001903.2	CTNNA1	1495	5	36.1	138116821	-185	Y	CCGGCGTTGCCAGACTCTCTTCGCGGTGGGGGCCTTCCCTTTCCC	CAP102, FLJ36832	catenin (cadherin-associated protein), alpha 1 (102kD); cadherin-associated protein,102kDa; alpha-E-catenin; alphaE-catenin; alpha-catenin; go_component: actin cytoskeleton; go_function: cadherin binding; go_function: protein binding; go_function: vinculin binding; go_function: structural molecule activity; go_process: cell adhesion; go_process: cell adhesion; go_process: apical junction assembly	catenin, alpha 1
CTNNA1_P382_R	3487	0.2335056	8910.532	2744.977	1.147328E-19	28	566.1616	0.06761278	12621.78	922.5297	2.521597E-18	16	1238.369	0.06589728	17519.09	1242.958	3.678E-38	23	1222.889	0.06563863	8998.236	639.1486	1.011565E-07	21	418.1893	0.06875687	14211.95	1056.7	2.254304E-25	28	1499.016	0.09515292	15404.29	1630.417	6.312778E-37	28	810.1436	0.102456	15156.27	1741.527	1.067385E-24	38	729.5443	0.09377358	18434.81	1917.926	3.69703E-25	26	781.1998	0.1079578	11734.47	1432.246	7.43771E-19	25	762.1824	0.07597603	19335.75	1598.066	3.678E-38	23	1298.559	CTNNA1	CTNNA1_P382_R	55770843	NM_001903.2	CTNNA1	1495	5	36.1	138116624	-382	Y	CCCCTGAGCCTCACCTGTGCGCGGAGCGGTGACTCACCTGCCCTCGCG	CAP102, FLJ36832	catenin (cadherin-associated protein), alpha 1 (102kD); cadherin-associated protein,102kDa; alpha-E-catenin; alphaE-catenin; alpha-catenin; go_component: actin cytoskeleton; go_function: cadherin binding; go_function: protein binding; go_function: vinculin binding; go_function: structural molecule activity; go_process: cell adhesion; go_process: cell adhesion; go_process: apical junction assembly	catenin, alpha 1
CTNNB1_P757_F	2415	0.4159175	1604.989	1214.1	0.1329465	34	122.3763	0.1101497	5018.167	633.5502	0.002076952	29	320.519	0.1223563	5475.427	777.2954	0.0003173283	24	275.7409	0.2121363	2293.415	644.4391	0.210821	34	133.4054	0.1200418	5016.404	697.9677	0.001216547	23	396.8949	0.1180154	6177.533	839.9754	6.230642E-06	31	448.2169	0.1331337	5622.339	878.8395	0.001047781	25	334.8931	0.1476764	6148.32	1082.604	0.002193624	21	263.1948	0.1353004	4596.836	734.9185	0.003567485	24	457.8108	0.1046067	6204.246	736.5104	4.17681E-05	24	304.4711	CTNNB1	CTNNB1_P757_F	88968769	XM_945657.1	CTNNB1	1499	3	36.1	41215247	-757	Y	GGCTCGGCCCGGTGATTCAGGTCGAAATTCAAGCTGAACAGCCTGCTGA	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Beta-catenin isoform 10
CTSD_P726_F	3523	0.1879192	1445.838	357.7139	0.4183481	20	85.38012	0.8257892	2419.912	11944.81	1.083304E-20	33	931.5934	0.810008	3348.633	14702.83	1.249322E-36	28	1004.645	0.2179221	4572.437	1301.951	0.003171176	31	207.3169	0.706565	3563.479	8821.33	2.039996E-16	31	516.5557	0.7673776	3488.83	11838.87	1.4363E-29	32	840.2263	0.7163299	4055.019	10492.35	4.579812E-18	26	1174.234	0.716345	4662.833	12028.1	1.039236E-16	22	505.209	0.7732434	2533.24	8979.385	3.121187E-14	18	484.4345	0.718804	3916.155	10266.25	1.649131E-21	28	580.2556	CTSD	CTSD_P726_F	23110949	NM_001909.3	CTSD	1509	11	36.1	1742524	-726	Y	GAAGCTCCTTCCCTTAGGAGGTCGGGCACCTTTTGTCCACTCACGTCA	CPSD, MGC2311	cathepsin D (lysosomal aspartyl protease); go_component: lysosome; go_component: extracellular region; go_function: pepsin A activity; go_function: peptidase activity; go_function: cathepsin D activity; go_process: proteolysis	cathepsin D preproprotein
CTSH_E157_R	3125	0.1746567	2602.374	571.8682	0.07641979	31	86.72532	0.1596234	7003.592	1349.275	6.275855E-07	26	469.2505	0.1680934	7679.56	1571.923	4.534159E-09	29	350.7049	0.134354	3574.775	570.3494	0.05531356	34	183.1436	0.1909432	6408.571	1536.07	1.076635E-06	23	328.5042	0.2017357	7094.113	1818.081	1.479331E-09	18	644.073	0.1865751	6858.353	1596.036	5.085014E-06	31	255.6899	0.1780326	7543.19	1655.463	3.658159E-05	21	403.4545	0.1325801	5587.18	869.2523	0.0001810325	24	515.6068	0.162974	7187.496	1418.919	9.776735E-08	29	334.3474	CTSH	CTSH_E157_R	23110956	NM_148979.1	CTSH	1512	15	36.1	77024318	157	Y	AAGGAGTTCACGCACAGTTCGGCGGCACCGCAGACGGGGACTCCCAGGAGC	CPSB, MGC1519, minichain, DKFZp686B24257	isoform b precursor is encoded by transcript variant 2; aleurain; cathepsin B3; cathepsin BA; N-benzoylarginine-beta-naphthylamide hydrolase; go_component: lysosome; go_function: cathepsin H activity; go_function: cysteine-type endopeptidase activity; go_process: proteolysis; go_process: proteolysis	cathepsin H isoform b precursor
CTSH_P238_F	601	0.1373193	3022.364	497.0101	0.04113776	24	123.8456	0.05649864	9319.287	564.0446	1.195684E-09	26	478.2679	0.04798335	12636.64	641.9498	3.430191E-19	38	667.8198	0.04339914	4068.832	189.1319	0.04752027	31	211.3743	0.06206837	9113.987	609.7429	5.305963E-10	27	571.5981	0.06687509	9255.154	670.4641	6.410703E-12	18	741.9527	0.05318092	10022.98	568.5875	2.095561E-09	33	473.2779	0.04505994	12840.04	610.5906	8.926038E-11	31	646.6912	0.06231895	7915.801	532.7359	1.548759E-07	21	515.0941	0.04306477	12922.19	586.035	1.962561E-19	39	595.8195	CTSH	CTSH_P238_F	23110956	NM_148979.1	CTSH	1512	15	36.1	77024713	-238	Y	GATCTGCCTGGACTGGCTGGCACCGCGCGGGGAGGTCTCAGCCTGGCCTCTCCC	CPSB, MGC1519, minichain, DKFZp686B24257	isoform b precursor is encoded by transcript variant 2; aleurain; cathepsin B3; cathepsin BA; N-benzoylarginine-beta-naphthylamide hydrolase; go_component: lysosome; go_function: cathepsin H activity; go_function: cysteine-type endopeptidase activity; go_process: proteolysis; go_process: proteolysis	cathepsin H isoform b precursor
CTSL_P264_R	5548	0.2901104	2653.64	1125.329	0.02445687	29	98.49028	0.5114824	5212.728	5562.474	1.765771E-11	18	749.471	0.5707216	5075.818	6881.203	2.079684E-15	29	393.8476	0.03258062	4763.908	163.806	0.01748724	16	158.6861	0.5665495	4291.772	5740.347	1.179749E-10	35	456.088	0.5329667	5036.64	5861.805	1.811401E-14	30	465.0248	0.5486443	4498.639	5589.864	1.581891E-08	28	568.3589	0.4699346	6064.103	5464.844	6.174268E-08	23	303.4781	0.4397278	4779.764	3829.867	7.906254E-08	28	359.0743	0.5743403	5066.718	6971.424	2.667066E-15	37	478.3849	CTSL	CTSL_P264_R	22202617	NM_001912.2	CTSL	1514	9	36.1	89530536	-264	Y	CTGAAACAGTCCACACAGGGCTTGCGGTAAACGTCTTTTCAGGAGCCACTCG	MEP, CATL	major excreted protein; go_component: lysosome; go_component: extracellular region; go_function: cathepsin L activity; go_function: cysteine-type endopeptidase activity; go_process: proteolysis	cathepsin L preproprotein
CTSL_P81_F	5565	0.28191	3134.104	1269.655	0.005751801	27	143.1366	0.07878456	8482.536	733.9991	2.12794E-08	41	336.1567	0.08247786	9537.586	866.3415	1.536953E-11	20	543.459	0.1056041	2861.488	349.672	0.1628462	26	139.3486	0.0803974	7248.839	642.4814	1.3157E-06	26	376.347	0.09667306	7756.505	840.7946	6.980487E-09	39	363.655	0.07504334	8389.344	688.7551	6.476104E-07	36	346.328	0.08100408	9369.188	834.6532	2.8632E-06	29	485.6913	0.06582449	7836.372	559.2178	1.925379E-07	34	463.6839	0.05876333	10586.67	667.1903	2.578388E-13	17	542.2294	CTSL	CTSL_P81_F	22202617	NM_001912.2	CTSL	1514	9	36.1	89530719	-81	Y	TCTGGGACAGTCAGTAAACAAGCCACGAACCGCGCCAGGGATCAGAGCACCCAGAGTCC	MEP, CATL	major excreted protein; go_component: lysosome; go_component: extracellular region; go_function: cathepsin L activity; go_function: cysteine-type endopeptidase activity; go_process: proteolysis	cathepsin L preproprotein
CTTN_E29_R	1286	0.1194401	2381.747	336.6268	0.153231	36	90.67814	0.05525832	4366.929	261.2724	0.01718521	23	196.2446	0.0542626	5359.649	313.2527	0.001510471	21	181.6424	0.1363863	1041.871	180.3302	0.6261439	26	79.64952	0.09002742	5091.822	513.6488	0.001598225	32	206.8745	0.09548154	4933.459	531.3351	0.001010767	23	291.7014	0.09508169	5423.071	580.3209	0.003114015	29	135.4169	0.09028744	5108.954	516.9799	0.02632159	29	163.5769	0.1359843	3100.414	503.7016	0.08930553	22	335.1057	0.1147861	3595.662	479.2184	0.04011025	22	116.0994	CTTN	CTTN_E29_R	20357551	NM_005231.2	CTTN	2017	11	36.1	69922321	29	Y	TAGAGCCTGGTGCCTGGGAGCGGCTGGCGCGGCGGAATCCAGGGCCGACCC	EMS1	isoform a is encoded by transcript variant 1; oncogene EMS1; ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate); 1110020L01Rik; go_component: ruffle; go_component: cell cortex; go_component: lamellipodium; go_component: cytoskeleton; go_component: soluble fraction; go_function: protein binding	cortactin isoform a
CXCL9_E268_R	2584	0.6856743	446.912	1193.041	0.4760395	28	67.07098	0.8670372	1365.658	9557.414	8.430505E-12	26	761.3089	0.8997	1348.685	12994.83	1.438398E-22	23	685.7178	0.7790157	302.112	1417.528	0.4981673	27	60.5978	0.8826195	1117.436	9154.268	3.533297E-11	27	461.8093	0.8421361	1618.299	9166.391	3.717751E-14	40	673.4128	0.9044458	1076.121	11132.29	1.443203E-12	28	511.4647	0.8996607	1440.207	13809.78	6.818873E-14	29	700.84	0.8398426	1362.886	7671.164	1.249977E-08	39	546.9805	0.9088605	1201.788	12981.68	1.636316E-21	25	713.4708	CXCL9	CXCL9_E268_R	4505186	NM_002416.1	CXCL9	4283	4	36.1	77147397	268	N	AAAGACTTGTGTTTGACTTGGCAGATCGAAGTTATGAACTTTGGATAACTGG	CMK, MIG, Humig, SCYB9, crg-10	monokine induced by gamma interferon; go_component: extracellular space; go_function: chemokine activity; go_process: chemotaxis; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: inflammatory response; go_process: cellular defense response; go_process: G-protein coupled receptor protein signaling pathway	small inducible cytokine B9 precursor
CYP1A1_P382_F	2416	0.1763249	5180.081	1130.312	1.175239E-05	20	308.4859	0.07641062	7143.824	599.2978	5.420285E-06	39	369.7456	0.0978924	7839.776	861.5865	5.196355E-08	23	477.5891	0.08331911	4808.16	446.1133	0.01009411	20	255.5141	0.1168286	6795.696	912.1835	2.590914E-06	28	338.107	0.1125821	7298.418	938.5994	3.799996E-08	22	516.2498	0.1090196	6672.991	828.7375	8.449936E-05	29	315.0076	0.08562906	9358.457	885.7661	2.567863E-06	24	301.138	0.1248414	6193.219	897.7283	2.449699E-05	23	289.7891	0.1010323	8682.931	987.0872	9.043911E-10	20	282.1632	CYP1A1	CYP1A1_P382_F	13325053	NM_000499.2	CYP1A1	1543	15	36.1	72805312	-382	Y	CGTCATTTTTGCACCCACTGGAACGCTGGGCGTGCAGATGCCTCCCCAGC	AHH, AHRR, CP11, CYP1, P1-450, P450-C, P450DX	aryl hydrocarbon hydroxylase; flavoprotein-linked monooxygenase; cytochrome P1-450, dioxin-inducible; P450 form 6; xenobiotic monooxygenase; microsomal monooxygenase; cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1; go_component: membrane; go_component: microsome; go_component: endoplasmic reticulum; go_function: heme binding; go_function: iron ion binding; go_function: metal ion binding; go_function: oxygen binding; go_function: unspecific monooxygenase activity; go_process: electron transport	cytochrome P450, family 1, subfamily A, polypeptide 1
CYP1B1_E83_R	185	0.05654275	2907.773	180.2602	0.08808777	20	133.403	0.07492972	5940.341	489.2613	0.0002945122	32	213.208	0.05252893	6931.131	389.8143	1.084502E-05	31	295.6349	0.0424645	2806.761	128.9082	0.2112351	22	165.7043	0.04778209	6098.636	311.0462	0.0001828119	26	266.2899	0.1135382	6216.065	808.963	6.055862E-06	29	295.3315	0.07986093	6346.375	559.4953	0.0003991079	24	243.2816	0.05643291	5529.794	336.707	0.01902141	18	215.8875	0.07598225	5092.884	427.0124	0.002277025	23	332.9506	0.07254889	6816.151	541.0087	1.062164E-05	31	254.0149	CYP1B1	CYP1B1_E83_R	13325059	NM_000104.2	CYP1B1	1545	2	36.1	38156713	83	Y	GTTGAGATTGAGACTGGGGGTCGGTGAGTGGCGTCAATTCCCATG	CP1B, GLC3A	aryl hydrocarbon hydroxylase; microsomal monooxygenase; xenobiotic monooxygenase; flavoprotein-linked monooxygenase; cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile); go_component: membrane; go_component: microsome; go_component: endoplasmic reticulum; go_function: heme binding; go_function: iron ion binding; go_function: metal ion binding; go_function: oxygen binding; go_function: monooxygenase activity; go_function: electron transporter activity; go_function: unspecific monooxygenase activity; go_process: electron transport; go_process: visual perception; go_process: eye development (sensu Mammalia)	cytochrome P450, family 1, subfamily B, polypeptide 1
CYP1B1_P212_F	3526	0.5428196	4208.46	5115.523	2.292921E-12	37	648.5009	0.08423735	9786.178	909.3901	2.616832E-11	36	521.619	0.07366775	13989.4	1120.478	3.508144E-25	28	781.5075	0.3868508	3722.824	2411.913	0.001864127	30	199.9174	0.09220992	11904.17	1219.338	1.639017E-18	27	753.554	0.109705	11646.32	1447.418	3.103525E-21	41	716.6949	0.1127825	12964.99	1660.813	2.867088E-18	17	1063.109	0.1181364	13327.9	1798.831	1.151878E-13	34	595.4181	0.1417994	7257.013	1215.589	1.402109E-07	25	848.5857	0.05896334	12835.07	810.4837	7.572304E-20	27	1079.305	CYP1B1	CYP1B1_P212_F	13325059	NM_000104.2	CYP1B1	1545	2	36.1	38157008	-212	Y	CCACGTTTCCATTGTGCGGTAACCGCGCTTCATCACAGCCACCTCC	CP1B, GLC3A	aryl hydrocarbon hydroxylase; microsomal monooxygenase; xenobiotic monooxygenase; flavoprotein-linked monooxygenase; cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile); go_component: membrane; go_component: microsome; go_component: endoplasmic reticulum; go_function: heme binding; go_function: iron ion binding; go_function: metal ion binding; go_function: oxygen binding; go_function: monooxygenase activity; go_function: electron transporter activity; go_function: unspecific monooxygenase activity; go_process: electron transport; go_process: visual perception; go_process: eye development (sensu Mammalia)	cytochrome P450, family 1, subfamily B, polypeptide 1
CYP2E1_E53_R	5510	0.5228547	2204.597	2525.372	0.002414846	21	194.3936	0.9128802	869.5592	10159.48	4.928073E-12	22	611.0145	0.9284396	884.0807	12767.67	2.4285E-20	30	549.2327	0.1303436	2241.732	350.9775	0.2818992	44	73.87479	0.9051729	902.0927	9565.491	1.286666E-11	29	467.9383	0.88515	1224.953	10211.42	5.373584E-16	14	509.2397	0.927043	844.1738	11997.33	6.01423E-14	27	822.228	0.9176192	1174.336	14194.51	4.094166E-14	30	659.61	0.8943691	787.4335	7513.833	2.825873E-07	31	485.1671	0.85374	1503.058	9357.272	2.238956E-12	26	491.8974	CYP2E1	CYP2E1_E53_R	75709190	NM_000773.3	CYP2E1	1571	10	36.1	135190910	53	N	CATGTCTGCCCTCGGAGTCACCGTGGCCCTGCTGGTGTGGGCGGCCTTCCTC	CPE1, CYP2E, P450-J, P450C2E	microsomal monooxygenase; xenobiotic monooxygenase; flavoprotein-linked monooxygenase; cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1; putative cytochrome P450 2E1; go_component: membrane; go_component: microsome; go_component: endoplasmic reticulum; go_function: heme binding; go_function: iron ion binding; go_function: metal ion binding; go_function: oxygen binding; go_function: unspecific monooxygenase activity; go_process: electron transport	cytochrome P450, family 2, subfamily E, polypeptide 1
CYP2E1_P416_F	4300	0.4538264	1566.908	1385.067	0.1091275	35	103.9627	0.9501098	596.7097	13268.16	3.128536E-19	33	852.3235	0.9607307	679.2417	19064.29	3.678E-38	29	700.5995	0.3945311	338.0209	285.4199	0.7624987	24	20.49546	0.9551739	603.9417	14999.91	1.500039E-26	26	1109.19	0.9462699	702.459	14132.52	1.32268E-27	32	705.4547	0.9653347	488.9941	16401.91	1.120475E-24	34	782.0251	0.9588427	827.1846	21600.65	9.022444E-31	33	749.7845	0.9459046	513.0939	10720.47	1.600697E-13	28	866.7062	0.952459	781.5408	17661.23	2.970444E-37	26	561.6872	CYP2E1	CYP2E1_P416_F	75709190	NM_000773.3	CYP2E1	1571	10	36.1	135190441	-416	N	GCTGTTGCACCAGGAGGGCCGGTACCGTGTCTAGAGGTGGTCGGCATG	CPE1, CYP2E, P450-J, P450C2E	microsomal monooxygenase; xenobiotic monooxygenase; flavoprotein-linked monooxygenase; cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1; putative cytochrome P450 2E1; go_component: membrane; go_component: microsome; go_component: endoplasmic reticulum; go_function: heme binding; go_function: iron ion binding; go_function: metal ion binding; go_function: oxygen binding; go_function: unspecific monooxygenase activity; go_process: electron transport	cytochrome P450, family 2, subfamily E, polypeptide 1
DAB2_P35_F	3377	0.08666494	5326.372	514.9	6.947485E-05	27	337.2592	0.04653818	9619.054	474.384	4.599188E-10	31	421.5795	0.03403597	11811.92	419.7194	3.708221E-16	35	754.2689	0.0332971	6310.132	220.7905	0.0007885377	31	306.5229	0.03657981	10299.05	394.8383	3.896882E-12	30	416.9993	0.05127348	10715	584.4918	1.339717E-15	30	713.0052	0.04023911	10928.19	462.37	6.665005E-11	37	968.6973	0.05200212	12466.41	689.3262	2.625324E-10	27	365.692	0.0533107	8518.051	485.3063	1.433432E-08	20	399.0135	0.02935686	12398.31	378.0081	2.617338E-17	17	598.1876	DAB2	DAB2_P35_F	4503250	NM_001343.1	DAB2	1601	5	36.1	39460738	-35	Y	TCCAGGCTACAGCGCAGCGGATGCGGCGGGCCTCGCTTAAATAGCCGCC	DOC2, DOC-2	mitogen-responsive phosphoprotein; disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein); go_process: cell proliferation	disabled homolog 2
DAB2_P468_F	3569	0.07246071	4008.761	320.9823	0.006928443	29	165.6496	0.06830018	8007.953	594.3702	2.457439E-07	29	420.3238	0.06697801	8637.949	627.2633	4.256695E-09	18	712.9986	0.03973637	4051.623	171.797	0.04980657	35	232.5666	0.0669608	8151.33	592.1677	4.402116E-08	16	399.8989	0.06846724	9208.745	684.1887	7.722645E-12	27	557.0067	0.06688298	8606.705	624.0701	3.807241E-07	29	442.9207	0.05668078	10618.26	644.0228	1.396341E-07	26	291.6751	0.08414299	6138.007	573.1075	8.340411E-05	32	340.2578	0.06915884	8199.038	616.5948	4.092947E-08	32	744.6785	DAB2	DAB2_P468_F	4503250	NM_001343.1	DAB2	1601	5	36.1	39461171	-468	Y	TCCGTTCCCTGGATTGCCACTGCGAGTGATGTGGCACACGGAGTCATCCTAACC	DOC2, DOC-2	mitogen-responsive phosphoprotein; disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein); go_process: cell proliferation	disabled homolog 2
DAB2IP_E18_R	3132	0.06169024	6044.285	403.963	6.753609E-06	29	224.63	0.1243069	9150.056	1313.069	8.093934E-11	26	484.4444	0.1280263	12941	1914.727	2.682275E-24	27	601.7974	0.1079988	4888.749	604.0112	0.006583042	33	202.4432	0.1553066	11528.84	2138.095	3.853527E-20	29	721.9761	0.2066872	10890.11	2863.328	1.523939E-23	30	995.8195	0.1669909	10926.39	2210.428	1.282258E-14	33	859.9831	0.1674363	14481.19	2932.412	3.134283E-18	31	695.3042	0.1344191	8861.488	1391.661	3.459917E-11	36	542.9482	0.1893986	8730.295	2063.216	3.203516E-12	18	636.2916	DAB2IP	DAB2IP_E18_R	20070108	NM_032552.1	DAB2IP	153090	9	36.1	123501488	18	Y	GAGCCAGCCCAAGCTGGACCGCAACCACAGCTTCCGCCACATC	AIP1, AF9Q34, DIP1/2, KIAA1743	isoform 1 is encoded by transcript variant 1; nGAP-like protein; DOC-2/DAB2 interactive protein; ASK-interacting protein; go_function: GTPase activator activity	DAB2 interacting protein isoform 1
DAB2IP_P671_F	1562	0.2395318	424.1738	165.1039	0.8099515	25	18.08018	0.2557445	794.3735	307.3286	0.6809232	24	55.29406	0.1970891	801.6766	221.3329	0.7419829	29	40.31251	0.2274456	276.4343	110.825	0.8076492	29	11.07266	0.2430172	589.9774	221.5061	0.7646607	31	33.91076	0.2587242	715.345	284.5762	0.7259713	24	20.27694	0.2628886	830.9835	332.0325	0.7185778	28	46.22715	0.2954985	783.2698	370.4818	0.7260022	33	36.61226	0.2709772	691.1496	294.0697	0.7563097	19	47.06226	0.2794965	497.3123	231.7084	0.7884948	21	34.42057	DAB2IP	DAB2IP_P671_F	20070108	NM_032552.1	DAB2IP	153090	9	36.1	123500799	-671	Y	GGGAAGGAAAGTCGCCCGGAATCGGGGTCTAAGTGGCCAGGGCA	AIP1, AF9Q34, DIP1/2, KIAA1743	isoform 1 is encoded by transcript variant 1; nGAP-like protein; DOC-2/DAB2 interactive protein; ASK-interacting protein; go_function: GTPase activator activity	DAB2 interacting protein isoform 1
DAB2IP_P9_F	614	0.07973636	2011.982	182.993	0.289277	46	64.05873	0.09396943	6769.656	712.4899	1.28621E-05	28	221.2685	0.09836328	7104.758	785.9969	1.368298E-06	31	229.4041	0.05521907	3155.914	190.2965	0.1419944	19	268.252	0.09934635	5765.982	647.0456	0.0001810358	18	286.8599	0.1027954	5746.873	669.8935	5.369581E-05	27	326.2983	0.1221619	6237.496	881.9404	0.0002329549	27	273.0871	0.1157716	7608.648	1009.29	0.0001383663	25	232.7346	0.1303604	6144.166	936.0107	2.539215E-05	32	259.4555	0.1027306	5280.652	616.0439	0.0008499686	33	157.0779	DAB2IP	DAB2IP_P9_F	20070108	NM_032552.1	DAB2IP	153090	9	36.1	123501461	-9	Y	CTCAGCCGCCGCCTCAAGGGCTCCATCAAGCGCACCAAGAGCCAGCCCAAGCTGGACCG	AIP1, AF9Q34, DIP1/2, KIAA1743	isoform 1 is encoded by transcript variant 1; nGAP-like protein; DOC-2/DAB2 interactive protein; ASK-interacting protein; go_function: GTPase activator activity	DAB2 interacting protein isoform 1
DAPK1_E46_R	4075	0.06469869	3420.459	243.5248	0.03097112	24	147.6758	0.1927493	7819.59	1890.981	2.577919E-09	23	371.8156	0.1786326	9187.887	2019.949	1.827273E-13	30	408.2583	0.7245913	2925.868	7960.96	8.915176E-10	29	646.8242	0.2276883	8074.689	2410.013	1.176717E-11	23	487.7804	0.2588647	7122.44	2522.663	3.096023E-11	25	566.0776	0.260286	7182.134	2562.392	5.896679E-08	20	654.7603	0.2285155	10234.48	3061.097	1.579362E-10	26	459.1308	0.2739757	6585.597	2522.906	8.945879E-09	26	441.3585	0.1512181	8599.776	1549.943	8.872895E-11	19	604.9272	DAPK1	DAPK1_E46_R	4826683	NM_004938.1	DAPK1	1612	9	36.1	89302662	46	Y	CGGGGACTTTGTTCCCTCCGCGGAGGGGACTCGGCAACTCGCAGCGGC	DAPK, DKFZp781I035	go_component: actin cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: calmodulin binding; go_function: protein serine/threonine kinase activity; go_function: calmodulin-dependent protein kinase I activity; go_function: calcium- and calmodulin-dependent protein kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein kinase cascade; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	death-associated protein kinase 1
DAPK1_P10_F	2420	0.1840233	5424.973	1246.02	2.675893E-06	38	250.8053	0.1121375	11193.71	1426.401	7.624567E-16	31	508.0559	0.07983407	14130.2	1234.619	4.386016E-26	26	742.6064	0.05965841	7288.631	468.7594	3.678604E-05	33	181.2001	0.07475123	13378.93	1088.968	1.12157E-22	22	774.9152	0.1036697	12121.59	1413.551	9.143618E-23	21	1066.377	0.07487642	12609.32	1028.65	8.490857E-16	22	867.7943	0.1114576	16029.9	2023.313	1.230676E-19	25	743.4678	0.09658947	9076.729	981.1435	9.429431E-11	28	542.6995	0.07289661	14596.33	1155.548	8.823638E-27	28	839.6904	DAPK1	DAPK1_P10_F	4826683	NM_004938.1	DAPK1	1612	9	36.1	89302606	-10	Y	CGGCAAGGAGCCGAGAGGCTGCTTCGGAGTGTGAGGAGGACAGCCG	DAPK, DKFZp781I035	go_component: actin cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: calmodulin binding; go_function: protein serine/threonine kinase activity; go_function: calmodulin-dependent protein kinase I activity; go_function: calcium- and calmodulin-dependent protein kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein kinase cascade; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	death-associated protein kinase 1
DAPK1_P345_R	2421	0.1609059	6356.185	1238.047	3.842447E-08	24	484.205	0.05102906	9178.543	498.9356	2.981298E-09	29	556.7054	0.04748383	11450.34	575.7955	1.353206E-15	22	724.8124	0.05835481	6067.047	382.1788	0.0009464691	26	311.3105	0.0572468	8069.4	496.0704	9.26137E-08	29	829.2198	0.08813744	9836.271	960.4052	3.44789E-14	25	976.8669	0.06728117	9323.666	679.7711	2.201242E-08	33	455.9935	0.04228633	12681.12	564.3301	1.89628E-10	28	685.1858	0.06971911	6527.072	496.6603	3.061269E-05	26	647.6614	0.04381659	11819.86	546.2214	3.55306E-16	20	530.1923	DAPK1	DAPK1_P345_R	4826683	NM_004938.1	DAPK1	1612	9	36.1	89302271	-345	Y	ATCCCAGTACACATCTCGGGACGGAAGAACCGTGTTTCCCTAGAACCC	DAPK, DKFZp781I035	go_component: actin cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: calmodulin binding; go_function: protein serine/threonine kinase activity; go_function: calmodulin-dependent protein kinase I activity; go_function: calcium- and calmodulin-dependent protein kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein kinase cascade; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	death-associated protein kinase 1
DBC1_E204_F	3141	0.230763	3627.568	1118.231	0.002310663	32	157.1542	0.4389489	5642.317	4492.609	3.798017E-10	32	522.0405	0.4034315	7902.551	5411.753	2.671965E-19	31	809.7583	0.1249312	1461.996	223.002	0.5072311	24	134.4559	0.3484574	7878.745	4267.185	9.074768E-16	25	419.7299	0.5613426	6166.682	8019.369	3.977317E-25	32	645.8464	0.3981232	5989.354	4027.923	2.086511E-08	32	803.0573	0.413352	8210.085	5855.283	8.624075E-12	32	532.339	0.3967555	6247.152	4174.539	1.430086E-11	25	969.8819	0.2897522	9902.977	4080.808	6.926517E-21	28	437.5834	DBC1	DBC1_E204_F	7657008	NM_014618.1	DBC1	1620	9	36.1	121171318	204	Y	CTAGCAGCCTGGCTCATACTCAGCCGTAAAGTCCCCTTCGCTGGTCCC	FAM5A, DBCCR1	deleted in bladder cancer chromosome region candidate 1; bA574M5.1 (deleted in bladder cancer chromosome region candidate 1 (IB3089A)); go_component: cellular component unknown; go_function: protein binding; go_process: cell cycle; go_process: cell death	deleted in bladder cancer 1
DBC1_P351_R	629	0.05719115	3790.823	236.0188	0.01424076	24	165.7229	0.2393528	7806.54	2487.95	1.803871E-10	36	486.8645	0.1732074	11031.95	2332.069	1.884661E-19	28	705.6705	0.02419099	6995.99	175.9146	0.0001714841	27	322.6508	0.1778146	8696.96	1902.524	6.4367E-12	30	499.1726	0.4006362	7600.623	5147.372	4.476793E-20	30	900.4019	0.2756073	8280.986	3188.686	4.66254E-11	22	1014.645	0.2026292	10677.65	2738.833	1.012804E-10	20	588.8715	0.2168685	7967.256	2234.023	4.525653E-11	22	568.0159	0.1433107	11676.56	1970.032	7.517886E-20	26	585.7792	DBC1	DBC1_P351_R	7657008	NM_014618.1	DBC1	1620	9	36.1	121171873	-351	Y	GCACGAGCATCCAAAGGGACCGCGCATACGCGCAAACCCGGAATCCTGGTGC	FAM5A, DBCCR1	deleted in bladder cancer chromosome region candidate 1; bA574M5.1 (deleted in bladder cancer chromosome region candidate 1 (IB3089A)); go_component: cellular component unknown; go_function: protein binding; go_process: cell cycle; go_process: cell death	deleted in bladder cancer 1
DCC_E53_R	4077	0.2416645	3898.261	1274.156	0.0006565977	30	195.4413	0.4336808	7341.58	5698.677	6.010714E-17	37	537.6354	0.4446748	8031.508	6511.277	3.113057E-23	32	528.2518	0.05874142	5382.602	342.1544	0.004251695	26	340.2391	0.460628	6270.529	5440.483	1.262652E-14	24	704.3992	0.5612177	6250.545	8122.567	7.905484E-26	36	846.8611	0.5702032	6188.098	8342.299	5.066239E-18	27	809.9285	0.4100215	9147.635	6426.893	1.67568E-14	25	446.6772	0.4207328	6358.02	4690.583	4.610761E-13	34	544.732	0.365795	9258.908	5398.005	4.879425E-23	32	491.155	DCC	DCC_E53_R	4885174	NM_005215.1	DCC	1630	18	36.1	48121209	53	Y	GGTACCCAAGCTGGCTTTTGTACTCTTCGGAGCTTCCTTGTTCAGCGCGCATCTTC	CRC18, CRCR1	deleted in colorectal cancer protein; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: cell cycle; go_process: development; go_process: axonogenesis; go_process: induction of apoptosis; go_process: negative regulation of progression through cell cycle	deleted in colorectal carcinoma
DCC_P177_F	2424	0.1665785	5211.664	1061.658	1.360665E-05	16	342.6007	0.1649406	8972.127	1791.923	1.86614E-11	26	451.5095	0.1238845	12183.13	1736.859	3.438368E-21	29	671.4536	0.08429406	6142.297	574.6262	0.0005151909	33	261.39	0.1604474	10355.47	1998.152	2.483519E-16	21	740.6582	0.2690063	9952.529	3699.339	3.521802E-23	33	927.167	0.1299398	11533.37	1737.394	6.277378E-15	22	708.7527	0.1172408	11045.85	1480.3	2.397162E-09	21	617.4879	0.1663822	7945.64	1605.834	1.142633E-09	30	562.7444	0.1244475	12072.28	1730.119	2.51823E-20	26	891.6789	DCC	DCC_P177_F	4885174	NM_005215.1	DCC	1630	18	36.1	48120979	-177	Y	CTGTCAGTGGACAAGGAAAAAGGCTTCGAAGGCAGCAGAGGCGCAGGGG	CRC18, CRCR1	deleted in colorectal cancer protein; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: cell cycle; go_process: development; go_process: axonogenesis; go_process: induction of apoptosis; go_process: negative regulation of progression through cell cycle	deleted in colorectal carcinoma
DCC_P471_R	2425	0.02767722	6558.67	189.5394	1.924152E-06	28	256.653	0.2830268	8356.534	3338.237	1.475669E-13	37	582.6974	0.25106	10671.89	3610.959	2.281293E-22	25	1070.296	0.06055321	2263.126	152.3182	0.3224186	28	68.34785	0.2480751	8317.591	2777.132	4.370385E-13	24	689.8497	0.4039734	10369.81	7096.203	3.678E-38	26	1268.9	0.2237211	8819.917	2570.691	6.663625E-11	24	896.4985	0.2886167	10977.32	4494.203	2.625465E-14	31	735.7985	0.2684962	7079.494	2635.211	5.198501E-10	31	485.5977	0.2025668	12574.44	3219.606	6.244827E-27	24	841.2928	DCC	DCC_P471_R	4885174	NM_005215.1	DCC	1630	18	36.1	48120685	-471	Y	CCAACAGCATCTCCAGCTCTCGCGCGGAATTGTCTCTTCAACTTTACCCA	CRC18, CRCR1	deleted in colorectal cancer protein; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: cell cycle; go_process: development; go_process: axonogenesis; go_process: induction of apoptosis; go_process: negative regulation of progression through cell cycle	deleted in colorectal carcinoma
DCN_P1320_R	3592	0.3265754	4733.652	2344.066	4.474164E-07	28	245.9348	0.9594592	673.1921	18298.77	7.09799E-37	35	1170.203	0.9674826	589.0366	20500.78	3.678E-38	29	1181.696	0.7480913	1419.542	4512.571	0.002825317	23	247.5354	0.9618521	638.4579	18619.31	3.678E-38	21	1160.989	0.9582373	764.2551	19830.17	3.678E-38	33	1109.104	0.9633392	704.8911	21150.2	3.678E-38	21	1272.259	0.9683576	675.4135	23730.08	1.12149E-36	28	1071.841	0.9289578	758.7852	11229.59	1.727497E-15	23	753.7029	0.9718276	534.1174	21874.32	3.678E-38	18	1183.18	DCN	DCN_P1320_R	47419923	NM_133505.2	DCN	1634	12	36.1	90102257	-1320	N	GTAAAGACAATCAAATGATTGGCTATGGACCGTACCCGGACTGGTGTTTTGCC	PG40, PGII, PGS2, DSPG2, SLRR1B	isoform c precursor is encoded by transcript variant C; small leucine-rich protein 1B; dermatan sulphate proteoglycans II; bone proteoglycan II; proteoglycan core protein; go_component: extracellular matrix (sensu Metazoa); go_process: organ morphogenesis	decorin isoform c precursor
DCN_P1326_F	3625	0.7852693	2265.683	8651.29	3.739206E-17	27	461.0782	0.9604571	835.1454	22713.75	3.678E-38	28	1660.178	0.9638301	934.3121	27561.57	3.678E-38	33	1502.472	0.7678393	1744.988	6102.042	2.870497E-05	36	255.8077	0.9604982	799.1891	21864.07	3.678E-38	50	1121.087	0.9531092	1162.956	25671.03	3.678E-38	31	1315.279	0.9389441	1293.303	21426.83	3.678E-38	37	1373.156	0.9559196	1175.561	27661.59	3.678E-38	35	1176.255	0.9171482	1304.852	15551.34	9.852934E-32	31	1195.877	0.9642839	915.0114	27403.86	3.678E-38	26	876.4258	DCN	DCN_P1326_F	47419923	NM_133505.2	DCN	1634	12	36.1	90102263	-1326	N	TCAAATGATTGGCTATGGACCGTACCCGGACTGGTGTTTTGCCCCAATCCTGGCTTAC	PG40, PGII, PGS2, DSPG2, SLRR1B	isoform c precursor is encoded by transcript variant C; small leucine-rich protein 1B; dermatan sulphate proteoglycans II; bone proteoglycan II; proteoglycan core protein; go_component: extracellular matrix (sensu Metazoa); go_process: organ morphogenesis	decorin isoform c precursor
DDB2_P407_F	3399	0.04665739	3662.052	184.118	0.0212126	23	197.3635	0.1386926	9419.44	1532.875	7.273851E-12	36	592.6949	0.1154576	9899.476	1305.212	1.86065E-13	32	928.6442	0.3237897	1721.642	872.2567	0.2816359	30	132.0877	0.1878371	7742.764	1813.875	1.171366E-09	34	790.8555	0.2069332	10254.27	2701.718	9.074868E-21	31	872.2332	0.08123472	10889.47	971.6591	7.627924E-12	23	723.8978	0.1283021	15276.7	2263.241	1.670634E-18	22	717.1456	0.1552754	7576.6	1411.095	1.53686E-08	25	694.1077	0.2063961	11261.65	2954.875	1.28587E-21	32	751.1029	DDB2	DDB2_P407_F	4557514	NM_000107.1	DDB2	1643	11	36.1	47192682	-407	Y	GATGATCGCTTAAGCCCAGGAGTTAAAGACCGGCCCGGACAACAAAGCGAGACCCC	.	damage-specific DNA binding protein p48 subunit; implicated in xeroderma pigmentosum group E; xeroderma pigmentosum group E protein; go_component: nucleus; go_function: damaged DNA binding; go_process: nucleotide-excision repair	damage-specific DNA binding protein 2 (48kD)
DDB2_P613_R	3632	0.198897	4387.802	1114.226	0.0002263724	35	198.4296	0.2829505	8146.303	3254.022	7.168499E-13	19	553.4744	0.2701218	10472.99	3912.973	1.040325E-22	33	527.5408	0.3101168	2995.043	1391.286	0.03975136	25	275.0233	0.3439176	6315.675	3363.089	6.576607E-10	32	326.8352	0.395546	7620.962	5052.486	7.875916E-20	26	871.6504	0.2121457	9208.384	2506.471	1.512743E-11	30	622.7896	0.2351911	9794.833	3042.822	8.151191E-10	26	499.9937	0.3085229	6234.034	2826.116	1.112074E-08	22	562.2758	0.4612236	8840.867	7653.897	1.720402E-29	31	809.1045	DDB2	DDB2_P613_R	4557514	NM_000107.1	DDB2	1643	11	36.1	47192476	-613	Y	AAAGGCACTAGCTCTCTACAAAGCCGCCACTCCCCAACTACACCCTGTAG	.	damage-specific DNA binding protein p48 subunit; implicated in xeroderma pigmentosum group E; xeroderma pigmentosum group E protein; go_component: nucleus; go_function: damaged DNA binding; go_process: nucleotide-excision repair	damage-specific DNA binding protein 2 (48kD)
DDIT3_P1313_R	3712	0.491461	1033.053	1095.002	0.3100295	23	85.70061	0.8259597	2271.498	11254.65	2.833467E-18	34	743.5742	0.8354625	2687.108	14151.93	1.225862E-31	27	633.412	0.7462295	548.8151	1907.885	0.3127732	25	119.9468	0.8383707	2250.545	12192.28	1.354175E-22	18	762.1263	0.8574812	2087.985	13164.27	2.901645E-29	27	693.1145	0.8566376	2190.202	13684.71	1.12571E-21	31	690.2863	0.8363806	2977.451	15731.15	3.897763E-21	29	642.3068	0.8402591	1723.129	9589.913	1.009594E-13	27	840.4263	0.856672	1989.447	12488.63	1.867154E-22	23	577.3797	DDIT3	DDIT3_P1313_R	46852160	NM_052897.3	MBD6	114785	12	36.1	56201880	-1046	Y	GGGTCGAGATTTACAGCGGAGTCTCATCCCGGGACGTGTGAGTGCACTTCAGC	KIAA1887	go_function: DNA binding	methyl-CpG binding domain protein 6
DDR1_E23_R	5511	0.06252223	3930.194	268.7816	0.009533143	34	137.7446	0.1394842	7982.023	1310.045	1.553799E-08	32	402.5612	0.1041069	9867.986	1158.326	5.140249E-13	28	395.5617	0.09902506	1060.3	127.5272	0.634653	28	35.07119	0.08704434	8583.506	827.9153	2.301292E-09	20	568.9004	0.2212178	6894.467	1986.821	1.727696E-09	29	595.3685	0.1141636	8725.386	1137.385	3.774067E-08	33	436.05	0.09950191	10605.67	1182.939	2.730386E-08	35	404.9241	0.1394163	7274.708	1194.717	1.420675E-07	30	435.939	0.07407331	8769.997	709.5918	2.192347E-09	28	681.817	DDR1	DDR1_E23_R	38327631	NM_001954.3	DDR1	780	6	36.1	30959863	23	Y	TTCCCCTCGTGGGCCCTGAGCGGGACTGCAGCCAGCCCCCTGGGG	CAK, DDR, NEP, PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, NTRK4, PTK3A	isoform b is encoded by transcript variant 2; cell adhesion kinase; mammarian carcinoma kinase 10; PTK3A protein tyrosine kinase 3A; neuroepithelial tyrosine kinase; epithelial discoidin domain receptor 1; neurotrophic tyrosine kinase, receptor, type 4; discoidin domain receptor DDR1d; discoidin receptor tyrosine kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	discoidin domain receptor family, member 1 isoform b
DDR1_P332_R	4303	0.5009478	692.6647	795.6755	0.5299847	31	52.07139	0.8617082	1595.799	10566.68	1.090784E-14	21	451.5283	0.8729975	1808.256	13117.09	1.542285E-24	24	590.2291	0.6515989	291.2603	731.7566	0.674472	31	35.71237	0.7503268	2509.668	7842.666	2.337478E-11	16	638.6452	0.8876661	1257.238	10724.93	1.241258E-17	31	962.9734	0.8281056	2077.013	10487.82	2.467133E-13	26	556.1603	0.749521	3589.167	11039.28	9.132739E-13	35	500.6674	0.8802512	1032.76	8326.71	2.827899E-09	32	760.5345	0.8430517	1943.032	10974.19	1.044985E-17	24	583.3627	DDR1	DDR1_P332_R	38327631	NM_001954.3	DDR1	780	6	36.1	30959508	-332	N	GGCCTGGGCGTCTGGACCCCCGGGTCCCTTAGAACGCCCTTCAGA	CAK, DDR, NEP, PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, NTRK4, PTK3A	isoform b is encoded by transcript variant 2; cell adhesion kinase; mammarian carcinoma kinase 10; PTK3A protein tyrosine kinase 3A; neuroepithelial tyrosine kinase; epithelial discoidin domain receptor 1; neurotrophic tyrosine kinase, receptor, type 4; discoidin domain receptor DDR1d; discoidin receptor tyrosine kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	discoidin domain receptor family, member 1 isoform b
DDR1_P667_R	4302	0.368428	2266.42	1380.453	0.03205344	31	118.8026	0.6934575	2417.112	5694.187	1.508781E-06	31	630.074	0.7358076	2085.434	6086.697	4.591863E-07	25	313.519	0.2408503	386.4021	154.3175	0.7789397	27	18.85568	0.7497869	1809.453	5721.855	4.886002E-06	32	194.3838	0.7973294	2007.673	8291.828	7.242052E-13	33	472.8253	0.6726056	3477.125	7348.916	7.852291E-10	24	431.8023	0.2822728	1443.276	606.9504	0.5366069	32	51.10764	0.7547232	1605.781	5248.732	5.303454E-05	32	241.5912	0.6353719	4145.117	7397.203	4.999018E-14	24	634.0645	DDR1	DDR1_P667_R	38327631	NM_001954.3	DDR1	780	6	36.1	30959173	-667	N	CCACCACAAGCTGTTCTGTCCCGCTCCATCCTCTGCCCAGTAGCTCT	CAK, DDR, NEP, PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, NTRK4, PTK3A	isoform b is encoded by transcript variant 2; cell adhesion kinase; mammarian carcinoma kinase 10; PTK3A protein tyrosine kinase 3A; neuroepithelial tyrosine kinase; epithelial discoidin domain receptor 1; neurotrophic tyrosine kinase, receptor, type 4; discoidin domain receptor DDR1d; discoidin receptor tyrosine kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	discoidin domain receptor family, member 1 isoform b
DDR2_E331_F	5516	0.5217313	1347.414	1578.948	0.113462	21	161.6221	0.9586494	602.7765	16292.79	5.666781E-29	20	1518.714	0.9580969	702.5505	18349.95	3.678E-38	40	650.0798	0.3164123	551.7288	301.6657	0.7134681	24	55.76344	0.9489154	631.3456	13585.02	7.304825E-22	26	783.572	0.9551169	661.7205	16209.49	3.483259E-36	31	785.6014	0.930133	957.6678	14080.63	2.330084E-19	27	753.6417	0.9533531	707.2756	16498.81	8.712358E-18	23	797.6937	0.9335067	749.4719	11925.82	2.084761E-17	23	1023.115	0.9611676	625.4181	17955.32	7.707876E-38	39	641.5438	DDR2	DDR2_E331_F	62420885	NM_001014796.1	DDR2	4921	1	36.1	160869183	331	N	GCGTTTTAAGTCAGACAAGGAAGGGAACGTAATGAGGCACCACAGACTCGAGAAAT	TKT, NTRKR3, TYRO10	neurotrophic tyrosine kinase receptor related 3; tyrosylprotein kinase; hydroxyaryl-protein kinase; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: cell adhesion; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	discoidin domain receptor family, member 2 precursor
DDR2_P743_R	4305	0.2979763	4148.45	1803.269	4.641626E-05	36	206.4904	0.926532	1041.315	14393.54	5.174124E-24	26	1243.011	0.9466139	995.7753	19429.71	3.678E-38	32	1063.547	0.5642454	3755.279	4992.083	1.978757E-06	29	413.1197	0.9298243	835.8942	12400.55	7.624486E-19	25	1357.653	0.9172171	1280.484	15295.46	7.272304E-35	30	916.5173	0.928288	983.5457	14026.13	2.780421E-19	25	733.3322	0.9354127	1271.546	19863.99	3.317354E-27	28	700.2598	0.9004458	1041.919	10328.4	7.225853E-14	16	1065.349	0.9378859	915.5489	15334.2	1.395412E-28	26	1803.027	DDR2	DDR2_P743_R	62420885	NM_001014796.1	DDR2	4921	1	36.1	160868109	-743	N	TCCTCCCCTGTTGCCTACCCGCCCCTTTCACATGATCTCTGACTATAGCTG	TKT, NTRKR3, TYRO10	neurotrophic tyrosine kinase receptor related 3; tyrosylprotein kinase; hydroxyaryl-protein kinase; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: cell adhesion; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	discoidin domain receptor family, member 2 precursor
DES_E228_R	5517	0.1108311	5878.496	745.194	3.267622E-06	29	216.2587	0.1945622	9931.899	2423.314	3.605325E-15	39	756.6409	0.1990739	13792.37	3453.013	2.871898E-33	33	630.4799	0.05299956	5828.799	331.8095	0.001765657	37	299.3676	0.1872997	11905	2766.744	2.391198E-23	38	607.465	0.2979539	10543.61	4517.233	1.697961E-28	34	754.4889	0.2141224	11242.61	3090.437	1.62307E-17	32	913.8873	0.209352	13368.52	3566.267	3.248451E-17	36	802.1281	0.2691003	8704.795	3241.721	2.240579E-15	29	981.5872	0.2072722	12407.14	3270.206	1.621563E-26	31	661.4601	DES	DES_E228_R	55749931	NM_001927.3	DES	1674	2	36.1	219991571	228	Y	GGCTCTAAGGGCTCCTCCAGCTCGGTGACGTCCCGCGTGTACCAGGTGTC	CSM1, CSM2, CMD1I, FLJ12025, FLJ39719, FLJ41013, FLJ41793	intermediate filament protein; go_component: intermediate filament; go_function: structural constituent of cytoskeleton; go_process: muscle development; go_process: muscle contraction; go_process: regulation of heart contraction rate; go_process: cytoskeleton organization and biogenesis	desmin
DES_P1006_R	4312	0.0767446	3698.583	315.7531	0.01464995	32	132.4297	0.9090477	1332.778	14320.3	1.009561E-24	32	809.2418	0.9314278	1243.406	18247.73	3.678E-38	33	797.1688	0.554612	349.8503	560.1686	0.7006973	36	28.45602	0.8949347	1319.022	12087.07	2.38169E-19	42	769.9662	0.8292565	2636.638	13291.14	4.663101E-32	26	797.5957	0.8934984	1662.138	14783.51	2.458375E-23	26	988.8864	0.9110239	1848.494	19950.58	5.236669E-29	26	610.7189	0.8632472	1205.845	8243.101	1.858823E-09	30	620.861	0.9380695	1034.708	17187.56	2.507502E-36	30	463.8841	DES	DES_P1006_R	55749931	NM_001927.3	DES	1674	2	36.1	219990337	-1006	N	TCACCCTAGCCTTCCTTATCTGACGCCCACCCATGCCTCCTCAGGTA	CSM1, CSM2, CMD1I, FLJ12025, FLJ39719, FLJ41013, FLJ41793	intermediate filament protein; go_component: intermediate filament; go_function: structural constituent of cytoskeleton; go_process: muscle development; go_process: muscle contraction; go_process: regulation of heart contraction rate; go_process: cytoskeleton organization and biogenesis	desmin
DHCR24_P406_R	1777	0.0486082	5302.124	276.0035	0.0001749943	25	212.0036	0.02486956	12290.45	316.0038	8.268021E-16	28	901.5229	0.0295084	16924.57	517.6427	4.497586E-34	39	918.3898	0.09241898	5948.918	615.9614	0.0007303405	36	228.4623	0.02723243	15417.47	434.4083	1.936557E-27	37	779.0201	0.02489431	13765.93	353.9954	7.000853E-25	24	1078.239	0.0228878	16068.49	378.7295	2.432142E-23	27	1098.05	0.02687722	18094.01	502.5107	7.102678E-21	31	811.4089	0.03939725	8483.003	352.0152	3.00813E-08	34	739.3444	0.02808775	18665.72	542.3195	3.678E-38	23	741.8212	DHCR24	DHCR24_P406_R	56790943	NM_014762.2	DHCR24	1718	1	36.1	55125899	-406	Y	GAAACCTGGCGGTAACCTCTGCAGGTCGTGCCACTCGGTGTGCGCAAGGT	KIAA0018, SELADIN1, Nbla03646, seladin-1	diminuto/dwarf1 homolog; selective AD indicator 1; 3 beta-hydroxysterol delta 24-reductase; putative protein product of Nbla03646; go_component: Golgi stack; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: oxidoreductase activity; go_process: electron transport; go_process: cholesterol biosynthesis	24-dehydrocholesterol reductase precursor
DHCR24_P652_R	1780	0.05909417	2806.528	182.5463	0.1030619	27	135.9443	0.7471794	3064.829	9353.256	2.50184E-15	26	1100.234	0.7706427	2992.869	10392.07	1.626544E-19	39	805.3263	0.056576	2102.517	132.0823	0.3660489	27	149.1453	0.6959499	3417.313	8050.887	5.236818E-14	27	674.2369	0.7468709	3119.98	9500.723	1.171938E-19	35	859.3493	0.7338422	3299.841	9373.938	1.421118E-13	24	1058.407	0.69884	4416.872	10481.38	3.0058E-13	29	593.3107	0.6983756	2575.201	6194.112	3.999268E-08	29	547.1273	0.740749	3889.722	11399.7	3.655652E-25	37	414.1946	DHCR24	DHCR24_P652_R	56790943	NM_014762.2	DHCR24	1718	1	36.1	55126145	-652	N	AGTTCACTGAGGCAGATGGGAGGCCCGGAGGAGAAAGAATGAAGGA	KIAA0018, SELADIN1, Nbla03646, seladin-1	diminuto/dwarf1 homolog; selective AD indicator 1; 3 beta-hydroxysterol delta 24-reductase; putative protein product of Nbla03646; go_component: Golgi stack; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: oxidoreductase activity; go_process: electron transport; go_process: cholesterol biosynthesis	24-dehydrocholesterol reductase precursor
DIO3_E230_R	3145	0.5602535	2181.368	2906.549	0.0008515073	22	222.7663	0.8059348	3013.36	12929.5	1.10838E-25	29	1020.885	0.7993148	4382.877	17854.98	3.678E-38	28	1088.234	0.2501589	1148.387	416.4819	0.5386029	20	100.8424	0.7873128	3726.563	14164.94	2.436651E-35	30	910.4177	0.8070216	3543.847	15238.31	3.678E-38	23	1007.366	0.7519386	3796.043	11809.92	6.475987E-21	37	1186.654	0.8153976	4203.672	19009.53	4.733816E-33	30	970.7388	0.8101209	2445.285	10859.49	2.840984E-19	28	1229.467	0.7510613	4115.563	12718.58	8.94574E-31	25	1034.206	DIO3	DIO3_E230_R	55750010	NM_001362.2	DIO3	1735	14	36.1	101097671	230	Y	GGCCTGCAGCCACCATGCTCCGCTCCCTGCTGCTTCACTCCTTGAGGCTC	D3, 5DIII, TXDI3, DIOIII	type III iodothyronine deiodinase; type 3 iodothyronine selenodeiodinase; thyroxine deiodinase type III (selenoprotein); go_component: cellular component unknown; go_function: selenium binding; go_function: thyroxine 5'-deiodinase activity; go_process: hormone biosynthesis	deiodinase, iodothyronine, type III
DIO3_P674_F	636	0.1436537	6330.429	1078.716	9.482171E-08	34	332.7997	0.1161365	7176.913	956.1599	1.395816E-06	34	336.8402	0.09521449	8345.424	888.7485	4.909101E-09	31	331.1577	0.06524188	6513.284	461.5772	0.0002789931	47	236.0308	0.1190951	6413.91	880.6566	1.112756E-05	24	271.5263	0.1283992	6714.845	1003.924	3.740565E-07	21	303.8668	0.1431559	6190.993	1051.057	0.0001694643	32	250.3177	0.05212027	9315.401	517.7168	7.597268E-06	23	460.0392	0.1062783	5782.932	699.5776	0.0001675086	46	242.3319	0.08551496	4973.44	474.4256	0.002586529	29	191.969	DIO3	DIO3_P674_F	55750010	NM_001362.2	DIO3	1735	14	36.1	101096767	-674	Y	GGCCGCTGACCCAGGAACCGCGGCGCCCCGCTGGAACGAGATGG	D3, 5DIII, TXDI3, DIOIII	type III iodothyronine deiodinase; type 3 iodothyronine selenodeiodinase; thyroxine deiodinase type III (selenoprotein); go_component: cellular component unknown; go_function: selenium binding; go_function: thyroxine 5'-deiodinase activity; go_process: hormone biosynthesis	deiodinase, iodothyronine, type III
DIO3_P90_F	634	0.3558123	6042.752	3392.905	1.129503E-12	27	346.2966	0.2228268	7628.433	2215.854	1.424353E-09	21	429.3309	0.1753519	10830.47	2324.238	8.112102E-19	32	605.6592	0.550813	3611.181	4550.815	1.169739E-05	32	349.0778	0.1993735	7431.775	1875.576	3.706247E-09	29	482.5194	0.2280412	7802.409	2334.418	1.891931E-12	30	517.6436	0.1788442	9702.337	2134.907	8.536051E-12	26	500.4609	0.1552285	13063.27	2418.778	2.508165E-14	33	482.193	0.2036172	7180.03	1861.341	1.209703E-08	21	300.8117	0.2181586	6321.605	1791.832	6.901896E-07	32	266.6754	DIO3	DIO3_P90_F	55750010	NM_001362.2	DIO3	1735	14	36.1	101097351	-90	Y	GCGGCAGCGGCTGCCGGAGTCCCCCGCCCCCGAGAGCTGGCTGCGG	D3, 5DIII, TXDI3, DIOIII	type III iodothyronine deiodinase; type 3 iodothyronine selenodeiodinase; thyroxine deiodinase type III (selenoprotein); go_component: cellular component unknown; go_function: selenium binding; go_function: thyroxine 5'-deiodinase activity; go_process: hormone biosynthesis	deiodinase, iodothyronine, type III
DIRAS3_E55_R	1307	0.5104625	2506.678	2718.099	0.0005574286	34	167.3824	0.9007092	1350.845	13161.23	3.919233E-21	22	1046.897	0.9102023	1600.136	17232.83	3.678E-38	29	545.4141	0.8086102	538.7965	2698.876	0.158603	27	109.1093	0.9006145	1363.792	13264.64	3.327608E-23	34	507.3034	0.8980012	1535.75	14401.21	4.263598E-32	31	734.2968	0.8946555	1509.116	13665.68	9.980037E-20	36	776.7322	0.9039183	1727.718	17194.83	1.226028E-21	17	916.9568	0.8487032	1565.455	9342.413	1.017312E-12	26	787.6234	0.8907633	1815.241	15617.7	4.127687E-33	29	715.2296	DIRAS3	DIRAS3_E55_R	58530880	NM_004675.2	DIRAS3	9077	1	36.1	68288993	55	Y	GGGAGTGTGGGTAACAGGCATAGATTCCGCTTGCGCAATACGTGGTAAGAAACCAG	ARHI, NOEY2	ras homolog gene family, member I; go_component: membrane; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_process: imprinting; go_process: small GTPase mediated signal transduction; go_process: regulation of cyclin dependent protein kinase activity	DIRAS family, GTP-binding RAS-like 3
DIRAS3_P745_F	5576	0.3816952	2750.592	1759.742	0.00436895	34	229.9754	0.7488648	3239.586	9958.378	2.261023E-17	26	753.8208	0.821855	3211.598	15277.74	3.678E-38	19	920.2409	0.02697168	7465.76	209.7177	4.601222E-05	26	340.5909	0.7484226	3074.546	9444.018	8.718404E-17	27	557.4307	0.8189493	2963.794	13858.5	5.786196E-36	22	1968.66	0.792186	3155.507	12409.98	8.402581E-21	32	717.7894	0.7708605	3740.004	12918.36	1.212099E-16	29	722.3445	0.776583	2768.047	9969.143	1.38094E-17	23	952.8123	0.6068637	5426.114	8530.371	8.421893E-21	34	539.6761	DIRAS3	DIRAS3_P745_F	58530880	NM_004675.2	DIRAS3	9077	1	36.1	68289793	-745	Y	AGGGTCTGGCTCCAGTAGCCCCGGGTGCCTCTCACTCCTTGGGCGCAATGCT	ARHI, NOEY2	ras homolog gene family, member I; go_component: membrane; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_process: imprinting; go_process: small GTPase mediated signal transduction; go_process: regulation of cyclin dependent protein kinase activity	DIRAS family, GTP-binding RAS-like 3
DKC1_E101_F	1577	0.05634741	3289.249	202.3789	0.04336856	22	201.2224	0.1680193	6517.884	1336.488	3.710278E-06	34	550.4879	0.1661451	8496.543	1712.856	4.240874E-11	22	458.8502	0.2441397	2357.716	793.8317	0.1726539	20	72.32228	0.5039614	6214.786	6415.647	4.248181E-17	30	639.9136	0.4521495	6516.104	5460.372	1.292377E-17	22	1220.929	0.5275357	6090.094	6911.625	2.613391E-14	22	549.9895	0.4681811	8554.002	7618.459	1.156773E-15	36	612.8253	0.4890343	4043.385	3965.544	8.979085E-07	27	707.4608	0.4777541	7291.799	6762.069	4.185218E-21	30	710.1014	DKC1	DKC1_E101_F	15011921	NM_001363.2	DKC1	1736	X	36.1	153644445	101	Y	CGGTGCAGGGTAACATGGCGGATGCGGAAGGTAAGGGCTGCAGGCT	DKC, NAP57, NOLA4, XAP101, dyskerin	go_component: nucleolus; go_component: nucleoplasm; go_component: telomerase holoenzyme complex; go_function: RNA binding; go_function: isomerase activity; go_function: telomerase activity; go_function: pseudouridylate synthase activity; go_process: rRNA processing; go_process: cell proliferation; go_process: telomerase-dependent telomere maintenance; go_process: regulation of progression through cell cycle	dyskerin
DKC1_P276_F	5588	0.1066829	15806.15	1899.564	3.678E-38	30	998.205	0.02960806	6520.784	202.0096	0.0001303086	28	395.5669	0.03590669	6644.221	251.1818	4.50238E-05	22	393.1371	0.1208671	7910.388	1101.304	8.467655E-07	40	490.3539	0.7278305	3533.664	9717.072	6.916847E-19	25	386.5695	0.6876206	3959.153	8935.153	1.461234E-20	36	567.6312	0.7221761	3894.055	10382.16	2.262026E-17	27	881.9927	0.7358747	3911.477	11176.3	1.358082E-13	26	597.3361	0.7023653	2559.894	6276.879	2.985229E-08	28	455.0679	0.6429063	4892.001	8987.526	1.457919E-20	27	502.7079	DKC1	DKC1_P276_F	15011921	NM_001363.2	DKC1	1736	X	36.1	153644068	-276	Y	CGTTCAGCCGTGAGCCCAGGCGCAGGCGCGGAGCTAAACCCGGAGGTGAA	DKC, NAP57, NOLA4, XAP101, dyskerin	go_component: nucleolus; go_component: nucleoplasm; go_component: telomerase holoenzyme complex; go_function: RNA binding; go_function: isomerase activity; go_function: telomerase activity; go_function: pseudouridylate synthase activity; go_process: rRNA processing; go_process: cell proliferation; go_process: telomerase-dependent telomere maintenance; go_process: regulation of progression through cell cycle	dyskerin
DKFZP564O0823_E45_F	2882	0.2254634	5276.665	1565.118	1.282368E-06	29	255.856	0.1055478	8960.394	1069.151	6.164901E-10	28	458.0088	0.1078349	10598.7	1293.139	3.110806E-15	38	580.6301	0.06442806	6032.008	422.2801	0.000935896	26	295.9312	0.1032314	10331.54	1200.826	3.607741E-14	36	653.4196	0.1295435	10594.77	1591.623	2.878618E-18	30	930.7026	0.1207778	10223.19	1418.085	2.126833E-11	24	769.8947	0.1272301	13193.98	1937.961	1.126714E-13	25	826.6854	0.1256084	8605.857	1250.617	2.589799E-10	31	664.053	0.09407405	13427.94	1404.782	1.281224E-23	24	766.3239	DKFZP564O0823	DKFZP564O0823_E45_F	54400757	NM_015393.2	DKFZP564O0823	25849	4	36.1	76077367	45	Y	GGATGGAGCAGAAGAGCGCGGAGCACCGGAGGGCACGCAGCTGACGGA	.	.	DKFZP564O0823 protein
DKFZP564O0823_P386_F	2027	0.451772	428.1261	435.2069	0.7366661	26	36.16935	0.6285773	1279.157	2334.017	0.08512856	27	196.4409	0.6999932	1185.188	2998.674	0.03530705	29	217.3257	0.6064985	328.3032	660.1378	0.6825968	33	49.74034	0.7133379	932.9203	2570.348	0.09027551	27	189.9965	0.7161928	1054.788	2914.129	0.03204472	21	211.4342	0.6630524	1233.139	2623.379	0.1028298	29	197.5134	0.700267	1031.761	2644.135	0.203012	28	199.0338	0.6676753	1169.576	2550.713	0.07556994	58	167.8306	0.6527662	1340.618	2708.224	0.04185459	25	205.069	DKFZP564O0823	DKFZP564O0823_P386_F	54400757	NM_015393.2	DKFZP564O0823	25849	4	36.1	76076936	-386	N	GTGGATGAGGGTTTAATGATGTACACGCAGAAGTGTTTTGACAAATGAAGAAG	.	.	DKFZP564O0823 protein
DLC1_E276_F	4082	0.5210484	5411.416	5995.834	8.418808E-19	29	711.8147	0.4107423	8095.939	5712.982	4.520906E-19	29	737.6308	0.3671125	9674.265	5669.656	5.208579E-26	27	826.0007	0.6084455	3435.966	5494.618	1.102075E-06	26	643.5482	0.4573638	5583.327	4790.222	2.09541E-11	27	489.4385	0.5139388	6553.449	7035.053	5.918249E-23	18	1082.793	0.379302	7411.683	4590.31	3.908598E-12	31	611.2871	0.4295438	8061.596	6145.543	4.946495E-12	35	523.8113	0.4983549	4699.444	4767.966	1.703647E-09	28	626.8008	0.352669	8947.482	4929.111	1.488642E-20	34	625.404	DLC1	DLC1_E276_F	33188432	NM_182643.1	DLC1	10395	8	36.1	13416490	276	N	AGTCCATAGCGTCTTACCTAGACAACGAGGAGCTGAAACGCCAAGGCATGACACTGC	HP, ARHGAP7, STARD12, FLJ21120, p122-RhoGAP	isoform 1 is encoded by transcript variant 1; Rho-GTPase-activating protein 7; START domain containing protein 12; StAR-related lipid transfer protein 12; deleted in liver cancer 1 variant 2; go_component: cytoplasm; go_component: extracellular region; go_function: protein binding; go_function: Rho GTPase activator activity; go_process: signal transduction; go_process: regulation of cell adhesion; go_process: negative regulation of cell growth; go_process: cytoskeleton organization and biogenesis	deleted in liver cancer 1 isoform 1
DLC1_P695_F	2430	0.2255548	3061.113	920.6643	0.01576315	31	170.4496	0.7246591	3903.849	10537.57	6.390587E-21	36	852.257	0.7907993	3477.966	13525.06	2.72705E-32	25	1172.401	0.6534827	263.8841	686.234	0.6915002	30	33.84498	0.7804935	2769.051	10201.41	4.569765E-18	29	1063.719	0.7204185	3909.856	10332.5	2.451831E-25	23	1120.144	0.7023654	4328.824	10451.25	1.131807E-18	31	1134.685	0.872371	2648.48	18786.43	5.193371E-28	27	676.1554	0.7009497	3396.13	8194.646	1.958264E-14	34	911.1437	0.7679504	4267.869	14455.13	3.678E-38	29	754.1767	DLC1	DLC1_P695_F	33188432	NM_182643.1	DLC1	10395	8	36.1	13417461	-695	N	ACAACTGCTTCCATCTAGCATGGCAGCGTTCCTGAATCACATCTCTAAAGCCGCT	HP, ARHGAP7, STARD12, FLJ21120, p122-RhoGAP	isoform 1 is encoded by transcript variant 1; Rho-GTPase-activating protein 7; START domain containing protein 12; StAR-related lipid transfer protein 12; deleted in liver cancer 1 variant 2; go_component: cytoplasm; go_component: extracellular region; go_function: protein binding; go_function: Rho GTPase activator activity; go_process: signal transduction; go_process: regulation of cell adhesion; go_process: negative regulation of cell growth; go_process: cytoskeleton organization and biogenesis	deleted in liver cancer 1 isoform 1
DLC1_P88_R	2431	0.2730903	4221.24	1623.432	6.862704E-05	25	282.2114	0.4916753	4019.311	3984.389	2.208439E-06	27	240.7458	0.4966564	4377.141	4417.66	3.47721E-08	33	377.5052	0.329723	1501.925	788.0195	0.3524793	17	137.798	0.4646347	3922.954	3491.455	7.364846E-06	33	297.5646	0.4994244	4554.369	4643.666	3.416858E-10	30	507.0352	0.3654611	4465.208	2629.321	0.0002483082	26	397.7769	0.6308733	3324.894	5853.475	3.83884E-05	32	260.2396	0.4231746	3366.565	2543.165	0.0008430933	26	534.3859	0.4053096	4907.251	3412.679	3.094979E-07	24	342.6906	DLC1	DLC1_P88_R	33188432	NM_182643.1	DLC1	10395	8	36.1	13416854	-88	N	GGGAGGAGGGGAGAGCCCAGCCGCCTGGGCGTTTTAGGAGTTC	HP, ARHGAP7, STARD12, FLJ21120, p122-RhoGAP	isoform 1 is encoded by transcript variant 1; Rho-GTPase-activating protein 7; START domain containing protein 12; StAR-related lipid transfer protein 12; deleted in liver cancer 1 variant 2; go_component: cytoplasm; go_component: extracellular region; go_function: protein binding; go_function: Rho GTPase activator activity; go_process: signal transduction; go_process: regulation of cell adhesion; go_process: negative regulation of cell growth; go_process: cytoskeleton organization and biogenesis	deleted in liver cancer 1 isoform 1
DLG3_E340_F	1586	0.8427776	597.5224	3739.01	0.00681228	35	188.7811	0.3525547	3240.618	1819.073	0.007505594	34	251.2614	0.3675735	3497.1	2090.676	0.001869271	28	177.9291	0.548323	1301.13	1700.932	0.1988634	32	158.4106	0.6533213	2139.24	4219.882	0.000211717	33	457.1779	0.6331797	3135.799	5585.411	3.820779E-09	26	320.6002	0.660587	2303.885	4678.591	0.0003297799	41	424.415	0.6726702	2981.519	6332.592	2.773613E-05	31	491.4724	0.6361367	2027.304	3719.132	0.001291652	19	450.0437	0.5357612	2683.162	3211.947	0.0008534828	34	250.6288	DLG3	DLG3_E340_F	10863920	NM_021120.1	DLG3	1741	X	36.1	69581884	340	Y	GGGCTACGGCGACTGGCAAGTCCCCGACCCTTACGGGCCAGGTGGG	MRX, MRX90, NEDLG, NE-Dlg, SAP102, KIAA1232	discs, large (Drosophila) homolog 3 (neuroendocrine-dlg); discs large homolog 3; bA291O7.3 (discs, large Drosophila homolog 3 (neuroendocrine-dlg) ); go_component: cellular component unknown; go_function: protein binding; go_function: guanylate kinase activity; go_process: negative regulation of cell proliferation	synapse-associated protein 102
DLG3_P62_R	5599	0.09414595	6833.678	720.6213	4.67972E-08	24	280.2872	0.2324797	9131.682	2796.25	4.086158E-14	28	810.5856	0.1828075	10564.73	2385.72	3.286585E-18	32	646.399	0.06649952	4967.319	360.9792	0.008860867	29	345.4774	0.6902787	4597.408	10469.16	1.119018E-24	25	932.9737	0.6811071	5830.082	12665.76	3.678E-38	17	721.3552	0.7009344	5696.811	13586.27	1.440671E-32	35	1147.128	0.6533197	7110.998	13589.14	4.675906E-26	26	1354.774	0.7025661	3855.748	9343.841	5.920614E-19	32	1074.255	0.5841485	7614.265	10836.26	2.754224E-37	36	532.8505	DLG3	DLG3_P62_R	10863920	NM_021120.1	DLG3	1741	X	36.1	69581482	-62	Y	CCCATTCTCTGCTTGAGCTCCCGCTTCTTCTTTGCCGCTGGGCCTCGGC	MRX, MRX90, NEDLG, NE-Dlg, SAP102, KIAA1232	discs, large (Drosophila) homolog 3 (neuroendocrine-dlg); discs large homolog 3; bA291O7.3 (discs, large Drosophila homolog 3 (neuroendocrine-dlg) ); go_component: cellular component unknown; go_function: protein binding; go_function: guanylate kinase activity; go_process: negative regulation of cell proliferation	synapse-associated protein 102
DLK1_E227_R	3150	0.05264845	3662.391	209.0925	0.02008872	36	125.4008	0.2041779	8864.497	2299.952	2.460309E-12	36	609.6173	0.1518847	12848.55	2318.89	2.20135E-25	23	817.6321	0.05047719	6894.425	371.8278	0.0001350805	36	211.7749	0.1561817	9931.443	1856.712	7.978491E-15	27	495.4431	0.3335084	8255.534	4181.06	4.623824E-19	37	510.5661	0.1946459	11090.22	2704.562	3.545653E-16	35	688.4622	0.1597378	12473.95	2390.368	3.460977E-13	22	779.9272	0.1795994	7107.615	1577.867	5.730365E-08	29	483.5105	0.1424644	9615.594	1614.075	2.952224E-13	28	529.8492	DLK1	DLK1_E227_R	74136022	NM_003836.4	DLK1	8788	14	36.1	100263209	227	Y	CGCGTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGTGAGTTCCC	FA1, ZOG, pG2, PREF1, Pref-1	isoform 1 is encoded by transcript variant 1; delta-like homolog (Drosophila); secredeltin; go_component: integral to membrane; go_component: soluble fraction; go_component: extracellular space; go_component: integral to membrane; go_function: calcium ion binding; go_process: development	delta-like 1 homolog isoform 1
DLL1_P386_F	4325	0.0410074	4961.815	216.4478	0.0006447694	33	228.3893	0.0593274	8901.459	567.7142	7.347031E-09	20	640.6945	0.04219192	14080.06	624.6387	8.820437E-24	24	1268.798	0.03956834	3831.538	161.9734	0.06733431	34	161.6234	0.05590814	10462.63	625.5079	4.533699E-13	28	570.3033	0.06615064	11404.35	814.9284	2.269004E-18	20	571.9724	0.0497658	11219.38	592.8199	9.601987E-12	36	565.5903	0.04666331	11598.69	572.6199	7.893098E-09	29	507.4983	0.08108182	8284.774	739.8404	1.303796E-08	29	496.9205	0.07317638	10747.61	856.4614	3.496963E-14	30	615.0676	DLL1	DLL1_P386_F	10518496	NM_005618.2	DLL1	28514	6	36.1	170441784	-386	Y	TCCGGTGTCACAGCAAAGATCCGCGTCTTTCCGATGAATCCAGCCAAT	DELTA1	delta-like 1 protein; delta (Drosophila)-like 1; go_component: membrane; go_component: extracellular region; go_component: integral to plasma membrane; go_function: Notch binding; go_function: Notch binding; go_function: calcium ion binding; go_process: hemopoiesis; go_process: cell communication; go_process: organ morphogenesis; go_process: cell differentiation; go_process: Notch signaling pathway; go_process: cell fate determination; go_process: inner ear morphogenesis; go_process: nervous system development; go_process: regulation of cell adhesion; go_process: odontogenesis (sensu Vertebrata); go_process: auditory receptor cell fate commitment; go_process: embryonic development (sensu Mammalia)	delta-like 1
DLL1_P832_F	4317	0.1642275	1378.799	290.5809	0.4655894	32	40.36471	0.333979	3689.185	1900.103	0.002397794	21	242.3602	0.3869569	3480.855	2260.26	0.001269608	34	131.505	0.2323205	332.7427	130.9596	0.7936438	33	17.17803	0.4237097	2877.314	2189.031	0.005613998	24	304.2666	0.5426746	2779.235	3416.578	0.0001117832	29	234.463	0.4593863	2892.23	2542.646	0.009480998	29	170.9016	0.4567679	3493.258	3021.333	0.007297518	22	230.8559	0.5833228	2610.222	3794.146	0.0002111417	21	175.627	0.3600614	3345.077	1938.372	0.003784438	26	165.9957	DLL1	DLL1_P832_F	10518496	NM_005618.2	DLL1	28514	6	36.1	170442230	-832	Y	TTTACATTCCTGCAAAATGTTCACCGCAAGAATCCCCCTGCTTCTGGAGCT	DELTA1	delta-like 1 protein; delta (Drosophila)-like 1; go_component: membrane; go_component: extracellular region; go_component: integral to plasma membrane; go_function: Notch binding; go_function: Notch binding; go_function: calcium ion binding; go_process: hemopoiesis; go_process: cell communication; go_process: organ morphogenesis; go_process: cell differentiation; go_process: Notch signaling pathway; go_process: cell fate determination; go_process: inner ear morphogenesis; go_process: nervous system development; go_process: regulation of cell adhesion; go_process: odontogenesis (sensu Vertebrata); go_process: auditory receptor cell fate commitment; go_process: embryonic development (sensu Mammalia)	delta-like 1
DMP1_E194_F	3153	0.5592157	1447.607	1963.423	0.0504063	27	128.6658	0.9572671	670.7629	17266.01	8.236996E-33	35	1166.462	0.955548	684.5974	16865.87	1.606412E-34	31	790.3001	0.6904838	738.1083	1869.693	0.2785661	19	101.8614	0.9494129	569.7891	12570.53	1.463156E-18	31	857.5363	0.9480808	749.0016	15503.37	1.898549E-33	24	897.7271	0.9507779	703.8062	15526.41	1.05986E-22	26	815.9221	0.9584603	750.5678	19625.43	3.222771E-25	26	967.0983	0.942109	611.7475	11582.86	4.724299E-16	38	718.9083	0.9672679	570.0432	19800.5	3.678E-38	26	652.203	DMP1	DMP1_E194_F	4758171	NM_004407.1	DMP1	1758	4	36.1	88790677	194	N	ATACCATGTAGAGAGAGATGGGAGAGCTGCGCTTTGGGTAAAAACAGTTCCTATTT	.	go_component: extracellular matrix (sensu Metazoa); go_function: integrin binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: ossification; go_process: extracellular matrix organization and biogenesis	dentin matrix acidic phosphoprotein
DMP1_P134_F	651	0.3133039	17198.86	7892.577	3.678E-38	30	1510.876	0.8324012	2192.334	11385.17	2.036614E-18	27	656.0455	0.862093	2275.828	14851.92	8.600871E-33	22	996.2202	0.2979767	8841.727	3795.353	3.918402E-13	23	810.5764	0.847729	1967.54	11510.49	1.446898E-19	28	659.3658	0.8495663	1879.888	11181.31	4.003256E-21	24	472.7018	0.8310512	2140.662	11021.71	1.119617E-14	25	1271.907	0.8377798	3139.077	16728.08	6.236703E-24	37	695.2319	0.8392069	1642.636	9095.114	2.606509E-12	28	851.1981	0.8612422	2019.184	13153.36	9.188464E-25	22	768.6304	DMP1	DMP1_P134_F	4758171	NM_004407.1	DMP1	1758	4	36.1	88790349	-134	N	CTGGAGGAAGTGTGGGTGTACCGGGGTCCCGGTGACACCTTG	.	go_component: extracellular matrix (sensu Metazoa); go_function: integrin binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: ossification; go_process: extracellular matrix organization and biogenesis	dentin matrix acidic phosphoprotein
DNAJC15_E26_R	3155	0.03254885	6735.904	229.9866	7.409279E-07	24	221.7777	0.1249914	10381.44	1497.231	5.372528E-14	21	785.5066	0.1318168	14415.55	2203.905	8.943594E-31	42	697.7582	0.04414445	3305.229	157.2643	0.125553	12	176.4432	0.0871802	14163.9	1362.295	2.826707E-26	23	989.682	0.1920818	12667.93	3035.563	4.085273E-31	25	844.0082	0.1905211	11689.31	2774.764	7.507299E-18	33	554.2079	0.2015147	13211.16	3359.353	1.832665E-16	34	1110.722	0.1312292	9268.19	1415.08	3.510207E-12	28	628.6501	0.2037742	14685.22	3783.909	2.297536E-37	19	1140.283	DNAJC15	DNAJC15_E26_R	66472919	NM_013238.2	DNAJC15	29103	13	36.1	42495388	26	Y	CCTCAGGCACTACAGCTAGACTCCGAGCTTACTGGGCAGTCATCTGATTCGACCA	MCJ, HSD18, DNAJD1	methylation-controlled J protein; DnaJ (Hsp40) homolog, subfamily D, member 1; go_function: heat shock protein binding	DNAJ domain-containing
DNAJC15_P65_F	656	0.373279	1386.053	885.1027	0.2664795	27	81.64144	0.9143603	1023.2	11992.22	7.002795E-17	28	1058.343	0.9103326	1189.918	13095.67	2.234474E-22	24	677.0511	0.5572785	344.6796	559.7433	0.7019708	36	39.12811	0.8674713	1502.662	10490.28	2.319834E-15	18	577.3851	0.9266096	911.5652	12771.77	2.71883E-23	24	575.9075	0.9050188	1160.069	12006.44	1.095285E-14	29	735.4327	0.9108949	1242.838	13727.42	2.22558E-13	25	567.5649	0.8724934	1111.346	8288.922	2.336843E-09	29	780.5818	0.9269567	1164.756	16050.4	2.990032E-32	20	347.0093	DNAJC15	DNAJC15_P65_F	66472919	NM_013238.2	DNAJC15	29103	13	36.1	42495297	-65	Y	GTGGTAGAACTGTGGCATTAAACAGAAGTGCGAACAGAAGTTGAGAGTGGGAAG	MCJ, HSD18, DNAJD1	methylation-controlled J protein; DnaJ (Hsp40) homolog, subfamily D, member 1; go_function: heat shock protein binding	DNAJ domain-containing
DNASE1L1_E178_R	5524	0.2262589	447.3459	160.056	0.8055298	23	20.55095	0.1266615	3050.114	456.8655	0.09791805	25	174.1147	0.1524439	3899.736	719.4039	0.01592208	40	127.4003	0.1893841	367.9881	109.336	0.7910862	32	13.80275	0.5991225	3442.327	5294.104	4.535568E-08	26	553.2464	0.502656	4330.339	4477.659	2.489966E-09	23	508.6716	0.4325657	5645.297	4379.747	2.024678E-08	26	523.8745	0.6435393	4009.742	7419.557	8.397453E-08	27	476.7026	0.5361239	3940.439	4669.729	7.888356E-08	35	411.3521	0.5351084	3718.446	4395.18	6.896914E-07	26	384.317	DNASE1L1	DNASE1L1_E178_R	58430945	NM_001009934.1	DNASE1L1	1774	X	36.1	153293443	178	Y	CGCTCACCTGGACCCTGGCCAGCAGCGTCGTCATGGGCTTGGTGGGCAC	XIB, DNL1L, DNAS1L1	DNase I, lysosomal-like; DNase I-like, muscle-specific; DNase X; go_component: membrane; go_function: DNA binding; go_function: hydrolase activity; go_function: endonuclease activity; go_function: deoxyribonuclease activity; go_function: deoxyribonuclease activity; go_process: DNA catabolism	deoxyribonuclease I-like 1 precursor
DNASE1L1_P108_F	4823	0.258075	650.7946	261.1603	0.7223048	31	31.38023	0.09170644	7407.665	758.0162	1.241684E-06	30	332.5102	0.09106831	8924.023	904.1411	2.904984E-10	32	303.4937	0.05040471	3354.883	183.3859	0.1155821	26	133.0921	0.5570051	5058.761	6486.432	3.347888E-14	36	526.6464	0.3812065	6447.548	4033.604	2.427028E-13	30	650.5897	0.5647758	5154.63	6818.758	4.480323E-12	22	593.441	0.4188181	7471.301	5456.119	5.939669E-10	24	645.1213	0.5914057	4374.93	6477.084	1.388145E-12	29	435.6409	0.4681792	6020.872	5388.403	1.071639E-13	39	370.2639	DNASE1L1	DNASE1L1_P108_F	58430945	NM_001009934.1	DNASE1L1	1774	X	36.1	153293729	-108	Y	CCAATCACCAGTCCTGCATGGACGACCCTCATCTCTGGGGTACCCGGG	XIB, DNL1L, DNAS1L1	DNase I, lysosomal-like; DNase I-like, muscle-specific; DNase X; go_component: membrane; go_function: DNA binding; go_function: hydrolase activity; go_function: endonuclease activity; go_function: deoxyribonuclease activity; go_function: deoxyribonuclease activity; go_process: DNA catabolism	deoxyribonuclease I-like 1 precursor
DNASE1L1_P39_R	4334	0.4044575	4752.825	3295.755	3.739416E-09	24	327.3542	0.09805024	11040.02	1211.023	6.574535E-15	25	343.374	0.09350471	12338.81	1283.059	3.011326E-20	27	656.3617	0.5914398	1552.1	2391.612	0.07169526	32	170.0432	0.7009084	5090.101	12162.78	9.406502E-33	26	939.749	0.6535555	5375.175	10328.73	4.069027E-31	31	737.5829	0.720432	4749.074	12495.8	9.007479E-26	28	983.2191	0.7402158	6242.035	18070.67	2.182968E-36	17	1518.692	0.716195	3253.847	8463.59	9.128689E-15	17	650.2292	0.627233	7390.172	12603.27	3.678E-38	27	1038.877	DNASE1L1	DNASE1L1_P39_R	58430945	NM_001009934.1	DNASE1L1	1774	X	36.1	153293660	-39	Y	GACCGTGCACAACAGGGAGGTGCTGTACGAGCTCATCGAGAAGCGAGGCCC	XIB, DNL1L, DNAS1L1	DNase I, lysosomal-like; DNase I-like, muscle-specific; DNase X; go_component: membrane; go_function: DNA binding; go_function: hydrolase activity; go_function: endonuclease activity; go_function: deoxyribonuclease activity; go_function: deoxyribonuclease activity; go_process: DNA catabolism	deoxyribonuclease I-like 1 precursor
DNMT1_P100_R	671	0.06764171	5310.818	392.5498	0.0001134769	26	233.7595	0.2058903	9556.762	2503.727	1.944013E-14	37	630.1178	0.1955795	12126.5	2972.641	3.825945E-25	34	495.6107	0.05613109	4540.797	275.9843	0.02088035	39	259.0862	0.190001	8372.002	1987.272	2.255426E-11	26	810.6358	0.1936523	9127.395	2216.049	1.00052E-15	25	708.6366	0.2324756	9299.717	2847.082	1.947043E-12	24	554.0604	0.1935413	12106.88	2929.519	1.686315E-13	26	751.0854	0.2573569	7512.994	2638.222	5.855688E-11	29	550.7997	0.2254055	12718.42	3730.135	2.559895E-29	30	934.4556	DNMT1	DNMT1_P100_R	4503350	NM_001379.1	DNMT1	1786	19	36.1	10166911	-100	Y	TTCAGGTGTGATGGGGATAAAGCAGCGAGAAGCCCCCAAGGGTTTGTGA	DNMT, MCMT, CXXC9, MGC104992	DNA methyltransferase 1; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: transferase activity; go_function: methyltransferase activity; go_function: transcription factor binding; go_function: DNA (cytosine-5-)-methyltransferase activity; go_process: transcription; go_process: DNA methylation; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	DNA (cytosine-5-)-methyltransferase 1
DNMT2_P199_F	682	0.4529789	3465.714	2952.707	7.62298E-06	30	272.8255	0.8932682	1543.516	13755.05	1.417416E-23	24	906.5011	0.9073029	1829.787	18888.43	3.678E-38	20	1213.737	0.0949645	2642.46	287.7637	0.2122695	34	141.2571	0.914496	1480.349	16902.4	2.122769E-37	44	876.9338	0.8953084	1792.408	16183.62	3.678E-38	37	1104.798	0.9002019	1760.269	16780.05	5.399362E-30	40	825.9538	0.9120058	1832.647	20030.71	3.477263E-29	21	1379.559	0.8701168	1461.927	10463.71	2.549982E-15	20	1373.073	0.9203525	1556.299	19139.08	3.678E-38	34	989.5954	DNMT2	DNMT2_P199_F	28872766	NM_004412.3	DNMT2	1787	10	36.1	17283886	-199	Y	ATGGCAGCCACTCTGTAGCCTGATTTACGCTCCATTTCCTTCTTTGGTGTCAGGG	PuMet, M.HsaIIP	isoform a is encoded by transcript variant a; DNA methyltransferase-2; DNA methyltransferase homolog HsaIIP; DNA MTase homolog HsaIIP; go_component: nucleus; go_function: DNA binding; go_function: transferase activity; go_function: methyltransferase activity; go_function: DNA (cytosine-5-)-methyltransferase activity; go_process: DNA methylation	DNA methyltransferase 2 isoform a
DNMT3B_P352_R	692	0.1974778	1106.053	296.7751	0.560232	30	54.00312	0.3348188	5760.653	2949.958	1.619387E-07	19	581.8403	0.3559309	6119.236	3436.927	1.087962E-09	30	480.4612	0.4016334	1838.97	1301.468	0.1745224	23	143.6766	0.3132853	5245.4	2438.618	2.825713E-06	42	351.5167	0.2453987	6030.365	1993.614	9.939591E-08	37	310.7639	0.3035396	5638.722	2501.117	1.34525E-05	30	344.3735	0.3081253	7585.308	3422.64	2.978705E-07	38	373.9286	0.3694855	4011.454	2409.338	0.0002011725	29	347.9674	0.318742	5895.405	2805.087	6.629431E-08	31	310.6421	DNMT3B	DNMT3B_P352_R	28559060	NM_175848.1	DNMT3B	1789	20	36.1	30813500	-352	N	CTGCCCTCTCTGAGCCCCCGCCTCCAGGCCTGTGTGTGTGTCTCCGTTCG	ICF, M.HsaIIIB	isoform 2 is encoded by transcript variant 2; DNA methyltransferase HsaIIIB; DNA MTase HsaIIIB; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transferase activity; go_function: methyltransferase activity; go_function: DNA (cytosine-5-)-methyltransferase activity; go_function: site-specific DNA-methyltransferase (cytosine-specific) activity; go_function: site-specific DNA-methyltransferase (cytosine-specific) activity; go_process: development; go_process: DNA methylation; go_process: DNA methylation; go_process: DNA methylation; go_process: DNA replication and chromosome cycle	DNA cytosine-5 methyltransferase 3 beta isoform 2
DSC2_E90_F	2630	0.07036723	6507.874	500.1736	6.133146E-07	19	348.8743	0.5317982	5109.973	5917.65	4.963839E-12	31	710.868	0.3652512	7662.477	4466.734	7.091688E-16	31	664.6864	0.03889568	4708.935	194.6165	0.01818321	28	171.787	0.3909863	6296.078	4106.276	1.8056E-11	29	1029.849	0.57368	5916.263	8095.82	1.74954E-24	26	587.5417	0.3856186	6635.343	4227.461	6.716819E-10	28	695.6778	0.3824248	8045.539	5044.011	3.331981E-10	28	664.7333	0.6476394	3453.497	6531.333	1.364043E-10	32	620.2559	0.3821076	8218.804	5144.389	5.302951E-19	29	689.5806	DSC2	DSC2_E90_F	40806177	NM_024422.2	DSC2	1824	18	36.1	26936285	90	Y	CTGCGCAAGGTGTTTCTCACCAGCGGACGCCACCTATAAGGCCCATCTC	DG2, DSC3, CDHF2, DGII/III, DKFZp686I11137	isoform Dsc2a preproprotein is encoded by transcript variant Dsc2a; desmocollin-3; desmosomal glycoprotein II/III; go_component: membrane; go_component: cytoskeleton; go_component: integral to membrane; go_component: intercellular junction; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: homophilic cell adhesion	desmocollin 2 isoform Dsc2a preproprotein
DSC2_P407_R	2038	0.7104099	476.397	1413.992	0.3883468	31	81.19014	0.9479772	588.3884	12544.06	3.399306E-17	27	402.3018	0.9397734	672.8936	12060.2	1.417322E-17	19	1040.113	0.6567203	343.9874	849.3818	0.6332855	26	53.09391	0.9429075	542.3005	10607.86	3.205888E-13	21	783.4543	0.9401166	618.6607	11282.34	2.201584E-17	31	557.8724	0.9414135	587.2523	11043.3	2.234588E-11	33	573.3583	0.9428875	601.1422	11575.38	7.758389E-09	18	708.8364	0.9256361	586.279	8542.374	8.167E-09	33	416.9925	0.9529969	589.7278	13984.36	9.105098E-23	31	464.1445	DSC2	DSC2_P407_R	40806177	NM_024422.2	DSC2	1824	18	36.1	26936782	-407	N	GGAATCAAGGCGACTGCAAAATAATAAAATCGAGGGTGAGTTACTATAAGAAATGCATC	DG2, DSC3, CDHF2, DGII/III, DKFZp686I11137	isoform Dsc2a preproprotein is encoded by transcript variant Dsc2a; desmocollin-3; desmosomal glycoprotein II/III; go_component: membrane; go_component: cytoskeleton; go_component: integral to membrane; go_component: intercellular junction; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: homophilic cell adhesion	desmocollin 2 isoform Dsc2a preproprotein
DSG1_E292_F	2890	0.3750111	6439.446	3923.853	2.161473E-15	31	420.2266	0.8640252	2363.283	15652.45	4.116161E-33	22	1357.854	0.8549284	2745.9	16771.31	3.678E-38	31	670.4951	0.4226359	4399.846	3293.929	4.377904E-05	24	640.8214	0.8541703	2386.816	14566.06	1.422197E-31	40	933.5891	0.8563137	2593.243	16050.67	3.678E-38	31	1178.293	0.831768	2751.494	14098.28	1.49615E-24	33	1000.765	0.866397	2915.903	19557.71	6.679856E-31	32	703.7269	0.8423712	1916.766	10777.63	1.836284E-17	30	945.4265	0.871824	2489.08	17610.34	3.678E-38	31	948.7734	DSG1	DSG1_E292_F	4503400	NM_001942.1	DSG1	1828	18	36.1	27152342	292	N	GAGTGGATTCTGGTAAAAGTCCTTCATAATCGTGCCCATTGTAAACAAGTGAAAACTTT	DG1, DSG, CDHF4	desmosomal glycoprotein 1; go_component: membrane; go_component: cytoskeleton; go_component: desmosome; go_component: integral to membrane; go_function: toxin binding; go_function: protein binding; go_function: calcium ion binding; go_process: homophilic cell adhesion; go_process: intercellular junction assembly; go_process: calcium-dependent cell-cell adhesion	desmoglein 1 preproprotein
DSG1_P159_R	2054	0.442636	2806.165	2307.959	0.0007860006	28	142.8279	0.838398	1989.652	10841.21	2.157131E-16	27	955.1678	0.8657067	1919.491	13018.42	1.395281E-24	32	626.5615	0.7888284	327.6196	1597.367	0.4446171	23	96.24149	0.8381818	1755.934	9613.321	9.259314E-14	34	894.8088	0.8189403	2407.073	11339.59	1.611887E-23	36	680.3455	0.8892068	1494.005	12793.21	2.121483E-17	30	666.7665	0.8706914	1991.736	14084.58	1.791636E-15	28	780.6464	0.8236932	2139.108	10460.96	3.42857E-17	42	510.8633	0.8895138	1938.11	16408.62	7.547679E-37	26	660.9954	DSG1	DSG1_P159_R	4503400	NM_001942.1	DSG1	1828	18	36.1	27151891	-159	N	CCCATCACCTGTATAACCCTCGGTATTTCTGTTCACTTTAAGAGCCTGCCAC	DG1, DSG, CDHF4	desmosomal glycoprotein 1; go_component: membrane; go_component: cytoskeleton; go_component: desmosome; go_component: integral to membrane; go_function: toxin binding; go_function: protein binding; go_function: calcium ion binding; go_process: homophilic cell adhesion; go_process: intercellular junction assembly; go_process: calcium-dependent cell-cell adhesion	desmoglein 1 preproprotein
DSP_P36_F	3725	0.08079099	5870.603	524.7673	8.366911E-06	32	162.4917	0.07986785	10376.6	909.3734	1.30814E-12	34	454.247	0.06275662	14266.08	961.9343	1.345058E-25	16	948.2719	0.07214104	3069.614	246.4375	0.1464866	28	103.8679	0.08339053	11070.99	1016.305	1.302434E-15	33	518.3988	0.1133662	10199.35	1316.889	3.135114E-16	35	721.7484	0.1353148	10208.67	1613.206	9.175378E-12	40	450.3483	0.1092184	12229.53	1511.719	3.001132E-11	34	713.6105	0.1283918	8919.216	1328.571	3.55759E-11	30	549.3284	0.06230165	13854.35	927.1417	1.895151E-23	29	584.8603	DSP	DSP_P36_F	58530839	NM_004415.2	DSP	1832	6	36.1	7486833	-36	Y	AAGAAACCGGCCAGGTGTGGCCTAGGCGCCCAGTGCCAGCGGGGAGGA	DPI, DPII	isoform I is encoded by transcript variant 1; desmoplakin (DPI, DPII); desmoplakin I; desmoplakin II; 250/210 kDa paraneoplastic pemphigus antigen; go_component: cytoskeleton; go_component: intermediate filament; go_component: cell-cell adherens junction; go_function: structural constituent of cytoskeleton; go_process: epidermis development	desmoplakin isoform I
DSP_P440_R	3736	0.04601322	3421.139	169.8335	0.03580885	40	98.36563	0.07041688	8293.957	635.8508	6.832702E-08	18	370.1225	0.07003523	8164.57	622.401	3.596974E-08	22	335.6102	0.03725122	4094.513	162.2964	0.0475953	25	128.7782	0.08984552	7242.806	724.842	9.86906E-07	19	369.2376	0.1086508	8008.144	988.3401	9.657039E-10	24	362.8496	0.08779663	7903.008	770.2637	2.517017E-06	31	295.4123	0.06979243	9490.729	719.5817	2.813784E-06	25	273.1306	0.07216965	8018.182	631.4585	6.674519E-08	19	456.1973	0.06308702	8499.062	579.0176	1.325912E-08	28	261.8326	DSP	DSP_P440_R	58530839	NM_004415.2	DSP	1832	6	36.1	7486429	-440	Y	CCTCCTCACTGTGGTCCTAGTCAATGCGTGGTAGGTAGCGTTTCCAGTGATCAACAA	DPI, DPII	isoform I is encoded by transcript variant 1; desmoplakin (DPI, DPII); desmoplakin I; desmoplakin II; 250/210 kDa paraneoplastic pemphigus antigen; go_component: cytoskeleton; go_component: intermediate filament; go_component: cell-cell adherens junction; go_function: structural constituent of cytoskeleton; go_process: epidermis development	desmoplakin isoform I
DST_E31_F	5534	0.03353608	5294.63	187.1925	0.0002422091	27	144.9306	0.05151643	14190.96	776.2069	1.576703E-22	27	1038.544	0.05490256	17742.44	1036.502	3.678E-38	26	1184.515	0.1100748	8309.318	1040.149	2.744051E-07	28	333.429	0.08743407	15097.85	1456.125	4.854179E-30	19	956.8622	0.1083224	15191.26	1857.607	5.43987E-37	26	993.2344	0.1146268	14895.52	1941.428	1.637036E-24	25	1014.307	0.1061336	18273.01	2181.527	2.025034E-25	42	818.8613	0.1078054	10435.34	1273.003	9.645939E-15	19	1113.521	0.05055528	16677.47	893.3533	1.161761E-33	42	624.7348	DST	DST_E31_F	20357503	NM_020388.2	DST	667	6	36.1	56816391	31	Y	GCGCTGCCTTCACCGGGGATGCTGCGCGGCGCATCTGCGGCATTTCCTGGCC	BPA, BP240, BPAG1, MACF2, CATX-15, KIAA0465, KIAA1470	isoform 1eB precursor is encoded by transcript variant 1eB; bullous pemphigoid antigen 1, 230/240kDa; hemidesmosomal plaque protein; go_component: cytoplasm; go_component: cytoskeleton; go_component: cytoplasm; go_component: cytoplasm; go_component: hemidesmosome; go_component: hemidesmosome; go_component: extracellular space; go_component: basement membrane; go_component: intercellular junction; go_component: cytoplasmic membrane-bound vesicle; go_function: actin binding; go_function: protein binding; go_function: calcium ion binding; go_function: integrin binding; go_function: actin filament binding; go_function: protein C-terminus binding; go_function: structural constituent of cytoskeleton; go_function: structural constituent of cytoskeleton; go_process: cell adhesion; go_process: cell cycle arrest; go_process: integrin-mediated signaling pathway; go_process: cytoskeleton organization and biogenesis; go_process: actin cytoskeleton organization and biogenesis; go_process: intermediate filament cytoskeleton organization and biogenesis; go_process: intermediate filament cytoskeleton organization and biogenesis; go_process: intermediate filament cytoskeleton organization and biogenesis	dystonin isoform 1eB precursor
DST_P262_R	4843	0.139661	5540.236	915.5941	6.54816E-06	26	200.8336	0.06992536	10966.12	831.979	8.38267E-14	42	497.0981	0.06692296	12855.46	929.2025	9.26862E-21	27	667.8677	0.0521999	7620.605	425.2108	1.636657E-05	28	274.7725	0.05534534	11127.56	657.7993	8.112802E-15	26	434.1702	0.09116625	11943.39	1208.087	1.971797E-21	37	522.9642	0.09074115	11932.36	1200.791	1.307466E-14	25	629.4651	0.08201692	13808.79	1242.677	1.582714E-13	28	786.3686	0.1010152	9902.923	1123.987	5.212921E-13	24	648.7191	0.07269106	12459.36	984.5187	3.054975E-19	29	696.0211	DST	DST_P262_R	20357503	NM_020388.2	DST	667	6	36.1	56816684	-262	Y	GGACCGTGCGGCCAAGCACGCCCACCCCCGGACACTGGCTGCCCGGTCCC	BPA, BP240, BPAG1, MACF2, CATX-15, KIAA0465, KIAA1470	isoform 1eB precursor is encoded by transcript variant 1eB; bullous pemphigoid antigen 1, 230/240kDa; hemidesmosomal plaque protein; go_component: cytoplasm; go_component: cytoskeleton; go_component: cytoplasm; go_component: cytoplasm; go_component: hemidesmosome; go_component: hemidesmosome; go_component: extracellular space; go_component: basement membrane; go_component: intercellular junction; go_component: cytoplasmic membrane-bound vesicle; go_function: actin binding; go_function: protein binding; go_function: calcium ion binding; go_function: integrin binding; go_function: actin filament binding; go_function: protein C-terminus binding; go_function: structural constituent of cytoskeleton; go_function: structural constituent of cytoskeleton; go_process: cell adhesion; go_process: cell cycle arrest; go_process: integrin-mediated signaling pathway; go_process: cytoskeleton organization and biogenesis; go_process: actin cytoskeleton organization and biogenesis; go_process: intermediate filament cytoskeleton organization and biogenesis; go_process: intermediate filament cytoskeleton organization and biogenesis; go_process: intermediate filament cytoskeleton organization and biogenesis	dystonin isoform 1eB precursor
DUSP4_E61_F	2896	0.21608	1264.768	376.1852	0.4756843	30	71.32755	0.07011724	7407.423	566.0926	2.454903E-06	32	354.2468	0.07433531	8624.69	700.6344	3.224335E-09	25	392.7599	0.3904279	379.7119	307.2531	0.749431	27	23.55812	0.09014464	7662.526	769.0784	1.601095E-07	20	601.5328	0.08028406	9035.758	797.4807	1.083053E-11	25	607.0365	0.1387346	6556.472	1072.24	5.947414E-05	24	446.8195	0.1208069	8810.639	1224.38	4.488846E-06	22	390.0771	0.1336985	5516.543	866.8154	0.0002245666	34	296.9778	0.06862349	8190.062	610.8088	4.355825E-08	26	334.1753	DUSP4	DUSP4_E61_F	58331238	NM_001394.5	DUSP4	1846	8	36.1	29264043	61	Y	CCTCCCGTGTATTTTTGCCGGTCGCGCGGCTCCTGTCGCCACTGGCGCC	TYP, HVH2, MKP2, MKP-2	isoform 1 is encoded by transcript variant 1; serine/threonine specific protein phosphatase; MAP kinase phosphatase 2; VH1 homologous phosphatase 2; go_component: nucleus; go_function: hydrolase activity; go_function: MAP kinase phosphatase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine/threonine phosphatase activity; go_process: MAPKKK cascade; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: regulation of progression through cell cycle	dual specificity phosphatase 4 isoform 1
DUSP4_P925_R	1808	0.03014771	5114.441	162.0901	0.0004731838	25	186.6839	0.03824244	15986.18	639.636	5.088331E-28	33	910.0868	0.05024396	19126.24	1017.106	3.678E-38	24	1201.896	0.03526647	4087.308	153.0698	0.04867348	27	221.946	0.04935299	16221.2	847.3176	5.023302E-32	20	1574.097	0.05214295	14965.13	828.7538	1.710554E-31	34	985.8691	0.04904998	16168.87	839.148	4.897605E-25	31	1105.902	0.05257081	20327.86	1133.498	4.402602E-28	36	722.1409	0.05178212	9487.993	523.5997	1.191891E-10	25	678.7955	0.04845881	19321.42	989.068	3.678E-38	34	1006.404	DUSP4	DUSP4_P925_R	58331238	NM_001394.5	DUSP4	1846	8	36.1	29265029	-925	Y	GGCATTAATTGCCGGAATGGTGTTCCGAGGGAGGAGAGCAGGCTGC	TYP, HVH2, MKP2, MKP-2	isoform 1 is encoded by transcript variant 1; serine/threonine specific protein phosphatase; MAP kinase phosphatase 2; VH1 homologous phosphatase 2; go_component: nucleus; go_function: hydrolase activity; go_function: MAP kinase phosphatase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine/threonine phosphatase activity; go_process: MAPKKK cascade; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: regulation of progression through cell cycle	dual specificity phosphatase 4 isoform 1
E2F1_P772_R	3800	0.6827824	695.6727	1712.614	0.227865	29	81.78255	0.9291727	979.7411	14164.96	4.369322E-23	26	785.973	0.9385285	1083.922	18075.77	3.678E-38	28	844.3331	0.7133814	781.1697	2193.193	0.2039709	17	107.6817	0.9250571	1062.494	14349.23	7.146934E-26	25	691.4805	0.9352266	956.1495	15249.15	3.033464E-33	26	829.1177	0.9241636	1064.013	14184.99	6.2714E-20	19	739.7286	0.934383	1068.74	16642.82	7.050209E-19	31	808.1834	0.9210433	862.8185	11231.43	8.906611E-16	28	652.1151	0.9406612	850.6238	15069.64	2.20541E-27	29	837.7439	E2F1	E2F1_P772_R	12669910	NM_005225.1	E2F1	1869	20	36.1	31738626	-772	Y	CAGTAGACAGGGGAACAGAAAGGTAACAGACGTTTACAATACGATGAAGTGGCGTCTG	RBP3, E2F-1, RBBP3	pRB-binding protein; retinoblastoma-associated protein 1; go_component: nucleus; go_component: transcription factor complex; go_function: protein binding; go_function: protein binding; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription corepressor activity; go_process: cell cycle; go_process: apoptosis; go_process: transcription; go_process: cell proliferation; go_process: G1 phase of mitotic cell cycle; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: negative regulation of transcription from RNA polymerase II promoter	E2F transcription factor 1
E2F3_P840_R	3811	0.06963588	4589.577	351.0054	0.001322846	27	191.2871	0.130391	10222.96	1547.845	9.738774E-14	28	644.4773	0.1157139	13046.46	1720.29	5.417564E-24	24	754.11	0.06015562	6126.292	398.5197	0.0007994521	22	401.2084	0.122231	10030.82	1410.736	6.108811E-14	27	706.9622	0.1431608	10460.69	1764.481	2.174224E-18	31	920.5833	0.1290885	11180.15	1671.97	5.693107E-14	29	712.5394	0.1410723	13853.62	2291.775	1.308755E-15	37	589.6423	0.1450861	9403.214	1612.776	5.544626E-13	28	623.8129	0.1270692	12251.09	1797.901	4.334855E-21	28	698.6925	E2F3	E2F3_P840_R	12669913	NM_001949.2	E2F3	1871	6	36.1	20509537	-840	Y	CCTTTTGCACCTGCCAGACATCGTCCGCATGGTCCAACTTGCCTTTGGCA	E2F-3, KIAA0075, MGC104598, DKFZp686C18211	go_component: nucleus; go_component: transcription factor complex; go_function: protein binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: transcription initiation from RNA polymerase II promoter	E2F transcription factor 3
E2F5_P516_R	5602	0.04318895	4589.557	211.6792	0.001977131	23	122.4736	0.4824436	4594.746	4376.238	5.794029E-08	31	470.7881	0.4673489	5813.641	5188.638	5.885957E-13	33	502.7704	0.799419	292.7177	1565.184	0.4620484	27	62.04205	0.5011673	4481.81	4603.252	1.00465E-08	24	497.6425	0.5597216	4135.383	5384.401	6.151181E-11	31	448.7215	0.4316063	5283.667	4088.054	2.309745E-07	18	523.3901	0.5519258	5178.433	6501.831	3.847648E-08	32	538.0314	0.482274	4584.875	4364.072	1.824817E-08	20	501.739	0.5263594	4649.915	5278.606	2.630578E-10	26	478.6247	E2F5	E2F5_P516_R	12669916	NM_001951.2	E2F5	1875	8	36.1	86276358	-516	Y	TGAGCAGTCAACCAACTTCACCGCTCACAAACGTTTGGCCGCTAGGCATT	E2F-5	go_component: nucleus; go_component: transcription factor complex; go_function: protein binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle	E2F transcription factor 5
EDN1_E50_R	3160	0.2784084	2924.755	1167.027	0.01227043	25	151.7097	0.1964323	7634.833	1890.782	5.767002E-09	26	344.0967	0.2071833	7993.264	2114.978	7.125802E-11	29	318.4832	0.2911626	2980.156	1265.207	0.04834427	35	162.8342	0.1920777	7034.462	1696.166	4.648066E-08	15	581.7734	0.1930951	8927.102	2160.216	5.385389E-15	25	424.0468	0.1742406	7512.365	1606.258	5.630216E-07	24	437.369	0.2113955	8318.343	2256.644	1.032883E-06	22	473.519	0.1687207	7158.183	1473.157	7.212942E-08	25	519.4602	0.1718112	8488.997	1781.823	4.836742E-11	34	278.3564	EDN1	EDN1_E50_R	21359861	NM_001955.2	EDN1	1906	6	36.1	12398695	50	Y	TCGCTGCCTTCTCTCCTGGCAGGCGCTGCCTTTTCTCCCCGTTAAAAGG	ET1	go_component: soluble fraction; go_component: extracellular space; go_function: hormone activity; go_process: pathogenesis; go_process: cell-cell signaling; go_process: signal transduction; go_process: blood pressure regulation; go_process: regulation of vasoconstriction; go_process: positive regulation of cell proliferation	endothelin 1
EDN1_P39_R	696	0.03867697	6921.321	282.4893	2.504337E-07	31	443.2195	0.0248282	14452.31	370.5068	4.421308E-22	24	947.4911	0.02193952	16895.21	381.2308	2.146704E-33	28	629.155	0.05564729	5544.338	332.6004	0.003155128	34	297.4998	0.02261045	13769.87	320.8588	1.837096E-21	25	975.857	0.03018964	14839.08	465.045	1.790052E-29	28	962.467	0.0290394	14356.59	432.3663	1.072453E-18	19	1290.935	0.0229888	18248.93	431.7452	4.528049E-21	35	468.4838	0.03633869	10569.72	402.3443	7.101082E-13	30	1022.898	0.02725923	15524.68	437.8523	1.553172E-27	36	577.4662	EDN1	EDN1_P39_R	21359861	NM_001955.2	EDN1	1906	6	36.1	12398606	-39	Y	GCGCCTCTGCATCTGCGCCAGGCGAACGGGTCCTGCGCCTCCTGCAGTC	ET1	go_component: soluble fraction; go_component: extracellular space; go_function: hormone activity; go_process: pathogenesis; go_process: cell-cell signaling; go_process: signal transduction; go_process: blood pressure regulation; go_process: regulation of vasoconstriction; go_process: positive regulation of cell proliferation	endothelin 1
EDNRB_P148_R	700	0.6595441	962.2396	2057.81	0.09818824	30	129.3212	0.9576966	613.9315	16162.5	1.501097E-28	32	1178.91	0.9704518	581.4648	22381.32	3.678E-38	32	758.275	0.2072916	468.0552	148.5453	0.7638832	26	31.44377	0.9580113	621.8082	16468.73	4.116347E-32	23	1018.744	0.9626123	615.9319	18432.96	3.678E-38	31	1151.15	0.9635706	630.0573	19310.28	6.138132E-35	33	986.0809	0.9665362	680.759	22550.66	4.181104E-33	29	1017.283	0.9390997	722.3676	12681.15	1.417356E-19	30	1159.099	0.9696073	544.6531	20566.15	3.678E-38	19	1106.376	EDNRB	EDNRB_P148_R	4557546	NM_000115.1	EDNRB	1910	13	36.1	77447813	-148	N	ATACCGAATTAAAGAAAGAAGAGGTTTATTCGGCCAGAAGCATCGGCAAGACTCCTG	ETB, ETRB, HSCR, ABCDS, HSCR2	isoform 1 is encoded by transcript variant 1; Hirschsprung disease 2; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: endothelin receptor activity; go_function: rhodopsin-like receptor activity; go_process: sensory perception of sound; go_process: nervous system development; go_process: negative regulation of adenylate cyclase activity; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	endothelin receptor type B isoform 1
EDNRB_P709_R	715	0.4270953	1479.811	1177.735	0.1664271	29	98.75373	0.9411315	968.7094	17085.46	2.93278E-33	29	1578.414	0.9535322	865.3351	19808.92	3.678E-38	23	1315.074	0.7269605	627.4528	1936.824	0.2882309	30	106.258	0.9498923	774.6706	16581.15	3.659568E-33	33	903.6993	0.9281552	1211.781	16946.75	3.678E-38	26	1210.175	0.9523597	768.9501	17370.88	1.18541E-28	29	862.738	0.9531893	959.3914	21571.99	4.566837E-31	30	917.2542	0.9182016	895.3282	11172.73	1.049934E-15	18	581.0412	0.9626181	757.9766	22093.63	3.678E-38	36	814.8522	EDNRB	EDNRB_P709_R	4557546	NM_000115.1	EDNRB	1910	13	36.1	77448374	-709	N	GCAGACAGTGAACTGCTAAGATGGAATGTTCGTGCCTTATCCGAGAAATGTCCAAGTC	ETB, ETRB, HSCR, ABCDS, HSCR2	isoform 1 is encoded by transcript variant 1; Hirschsprung disease 2; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: endothelin receptor activity; go_function: rhodopsin-like receptor activity; go_process: sensory perception of sound; go_process: nervous system development; go_process: negative regulation of adenylate cyclase activity; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	endothelin receptor type B isoform 1
EFNA1_P591_R	1825	0.04017794	4347.061	186.153	0.004114052	26	152.5644	0.04517221	9202.447	440.0921	3.473721E-09	35	487.5778	0.04321571	10828.49	493.6144	9.433787E-14	36	524.887	0.3631498	1698.711	1025.675	0.2534826	34	105.9383	0.05423881	9560.585	554.0284	7.818293E-11	26	447.0928	0.06719274	9462.636	688.8237	1.736629E-12	23	487.2867	0.04756686	9888.537	498.8522	4.826692E-09	26	595.5352	0.04170001	10632.32	467.0123	2.274076E-07	28	461.1496	0.06961542	7827.675	593.1832	1.735768E-07	28	362.0703	0.04431993	11119.88	520.3252	2.834159E-14	35	493.5092	EFNA1	EFNA1_P591_R	33359679	NM_182685.1	EFNA1	1942	1	36.1	153366382	-591	Y	TTACACACTCGATCACACAAAGCGTTGCACTTTATTCCCGGCATCTAGGCG	B61, EFL1, ECKLG, EPLG1, LERK1, TNFAIP4	isoform b precursor is encoded by transcript variant 2; eph-related receptor tyrosine kinase ligand 1; tumor necrosis factor, alpha-induced protein 4; immediate early response protein B61; ligand of eph-related kinase 1; go_component: membrane; go_component: integral to plasma membrane; go_function: ephrin receptor binding; go_process: cell-cell signaling	ephrin A1 isoform b precursor
EFNA1_P7_F	2057	0.03065151	6113.073	196.4619	1.179248E-05	39	304.2191	0.05639256	9980.552	602.4413	4.537487E-11	31	681.3378	0.05145981	13347.35	729.5401	1.074282E-21	33	740.4022	0.2123144	5961.582	1633.852	5.71077E-05	24	370.9795	0.05748886	11616.13	714.6301	2.8678E-16	26	751.4608	0.06452353	11347.03	789.5475	4.122069E-18	32	632.5495	0.05523754	11502.45	678.3619	1.65073E-12	35	731.8465	0.0579036	15017.54	929.1616	3.216414E-15	27	783.2597	0.07497188	8509.262	697.7654	5.717377E-09	27	497.6057	0.0439645	16267.84	752.6958	1.71446E-31	31	529.298	EFNA1	EFNA1_P7_F	33359679	NM_182685.1	EFNA1	1942	1	36.1	153366966	-7	Y	CGGCCCAAAAGGCGGAGTCGCTAGGCGAAGGGGCCAGATCTGTGAGCC	B61, EFL1, ECKLG, EPLG1, LERK1, TNFAIP4	isoform b precursor is encoded by transcript variant 2; eph-related receptor tyrosine kinase ligand 1; tumor necrosis factor, alpha-induced protein 4; immediate early response protein B61; ligand of eph-related kinase 1; go_component: membrane; go_component: integral to plasma membrane; go_function: ephrin receptor binding; go_process: cell-cell signaling	ephrin A1 isoform b precursor
EFNB1_E69_F	51	0.2262636	12134.09	3577.614	8.445207E-37	33	766.7805	0.0464153	12500.55	613.326	3.81437E-17	25	863.5472	0.04317072	14652.92	665.6298	6.415274E-26	27	784.3651	0.1161261	6729.047	897.2219	5.256375E-05	30	493.1663	0.6800776	6719.732	14497.1	3.678E-38	33	1590.695	0.6030909	9706.159	14900.15	3.678E-38	37	1321.953	0.6442055	7957.755	14589.46	3.678E-38	30	1643.655	0.5789891	12242.93	16974.43	3.678E-38	26	803.944	0.6230401	4632.343	7821.625	8.923309E-17	26	704.9148	0.6209887	8167.438	13545.73	3.678E-38	30	913.3124	EFNB1	EFNB1_E69_F	31317225	NM_004429.3	EFNB1	1947	X	36.1	67965625	69	Y	ACAGCAGTGGGAGGTTTGTGAGGCTCGCACTGGCCGCAGACCCTCGGGC	CFND, CFNS, EFL3, EPLG2, Elk-L, LERK2, MGC8782	ligand of eph-related kinase 2; eph-related receptor tyrosine kinase ligand 2; go_component: synapse; go_component: membrane; go_component: soluble fraction; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein binding; go_function: ephrin receptor binding; go_process: cell adhesion; go_process: cell differentiation; go_process: cell-cell signaling; go_process: nervous system development	ephrin-B1 precursor
EFNB1_P136_R	718	0.05678078	5706.275	349.5315	3.147186E-05	29	200.3225	0.08486842	9492.682	889.616	1.190664E-10	28	445.9904	0.07506108	11783.91	964.4082	1.280659E-17	31	565.661	0.07763184	3488.533	302.0317	0.08646687	33	154.2551	0.5312667	6977.801	8022.048	1.889303E-24	29	846.5643	0.4743737	8647.026	7894.124	1.03635E-34	24	848.314	0.5766553	7596.646	10483.92	1.860449E-28	35	805.0231	0.4744715	9322.937	8507.465	3.857821E-19	29	467.0963	0.5118073	5546.811	5919.954	4.096171E-14	40	707.8995	0.4398018	7542.538	6000.022	1.54831E-19	30	672.1655	EFNB1	EFNB1_P136_R	31317225	NM_004429.3	EFNB1	1947	X	36.1	67965420	-136	Y	CACACTCAGATTGGTGCCATCGGGCGCGCGGCGTCCTTAAGAGCTCCCTGAA	CFND, CFNS, EFL3, EPLG2, Elk-L, LERK2, MGC8782	ligand of eph-related kinase 2; eph-related receptor tyrosine kinase ligand 2; go_component: synapse; go_component: membrane; go_component: soluble fraction; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein binding; go_function: ephrin receptor binding; go_process: cell adhesion; go_process: cell differentiation; go_process: cell-cell signaling; go_process: nervous system development	ephrin-B1 precursor
EFNB1_P17_F	987	0.4554299	4632.563	3957.894	1.884286E-10	24	295.5475	0.3867472	8931.593	5695.763	1.75484E-21	27	936.6117	0.403644	10047.35	6868.241	6.089935E-32	35	554.0282	0.1564271	6538.823	1231.063	3.554275E-05	29	410.2715	0.8441111	3036.566	16983.96	3.678E-38	31	1183.921	0.8032022	4022.272	16824.47	3.678E-38	23	908.1987	0.7881953	4404.771	16763.74	3.678E-38	36	947.0671	0.7731087	5226.994	18151.19	1.532231E-33	36	756.0134	0.7972853	3104.216	12602.32	2.440033E-27	28	1356.874	0.7721308	4279.29	14839.15	3.678E-38	35	768.2812	EFNB1	EFNB1_P17_F	31317225	NM_004429.3	EFNB1	1947	X	36.1	67965539	-17	Y	GGCTAAGAGAGCAGGGTTGGCCTTGCGTTCGCCTGAGCAAGGGAGTAGACAG	CFND, CFNS, EFL3, EPLG2, Elk-L, LERK2, MGC8782	ligand of eph-related kinase 2; eph-related receptor tyrosine kinase ligand 2; go_component: synapse; go_component: membrane; go_component: soluble fraction; go_component: integral to plasma membrane; go_function: protein binding; go_function: protein binding; go_function: ephrin receptor binding; go_process: cell adhesion; go_process: cell differentiation; go_process: cell-cell signaling; go_process: nervous system development	ephrin-B1 precursor
EFNB3_E17_R	2898	0.8290105	2229.601	11294.63	7.369047E-27	20	1006.773	0.6252586	4044.078	6914.421	7.049975E-12	19	557.8617	0.6648764	4254.796	8639.802	4.797583E-18	17	886.2922	0.9327012	581.607	9446.469	2.471181E-08	25	667.0409	0.671134	3634.268	7620.717	1.775764E-13	24	680.3037	0.6467627	4343.97	8136.723	3.335212E-19	17	580.7879	0.7192689	3549.424	9350.287	4.449089E-14	27	608.2412	0.6912202	4446.245	10177.02	9.327881E-13	25	712.9448	0.6712838	2858.971	6042.627	2.248222E-08	20	706.8057	0.6796457	3796.795	8267.224	2.279962E-15	21	731.2283	EFNB3	EFNB3_E17_R	38201712	NM_001406.3	EFNB3	1949	17	36.1	7549262	17	Y	GACTGGTTTCCTCCCTTAGCCCGCTGCCCTCAATCCCAGCGAGGC	EFL6, EPLG8, LERK8	Ephrin B3; eph-related receptor tyrosine kinase ligand 8; go_component: membrane; go_component: integral to plasma membrane; go_function: transmembrane-ephrin receptor activity; go_process: cell differentiation; go_process: cell-cell signaling; go_process: nervous system development	ephrin-B3 precursor
EFNB3_P442_R	1828	0.4462743	5011.875	4119.907	7.580928E-12	31	345.2936	0.1304225	11035.86	1670.199	4.568902E-16	33	592.4484	0.1006779	13042.95	1471.336	3.880343E-23	25	949.1836	0.1486237	5710.417	1014.317	0.0005059091	34	289.6037	0.1427125	10344.29	1738.658	1.337704E-15	32	553.9437	0.169503	10044.05	2070.384	4.832925E-18	25	632.4012	0.1610598	11466.44	2220.525	6.471322E-16	18	679.1775	0.113382	14804.08	1905.956	9.493754E-17	27	719.5073	0.1460861	7932.044	1374.108	3.623037E-09	34	642.5245	0.08374185	14275.14	1313.823	3.322828E-26	25	655.6488	EFNB3	EFNB3_P442_R	38201712	NM_001406.3	EFNB3	1949	17	36.1	7548803	-442	Y	ACAGGTAGTCGTGACGATCAGCTCCGCCGCACTTTGTAAAGCGCCAAGCCTTC	EFL6, EPLG8, LERK8	Ephrin B3; eph-related receptor tyrosine kinase ligand 8; go_component: membrane; go_component: integral to plasma membrane; go_function: transmembrane-ephrin receptor activity; go_process: cell differentiation; go_process: cell-cell signaling; go_process: nervous system development	ephrin-B3 precursor
EGF_E339_F	233	0.7974224	1313.173	5562.787	1.10387E-06	36	251.2623	0.9736962	479.9332	21467.55	3.678E-38	29	1681.814	0.9689568	500.7672	18751.86	3.678E-38	23	1091.707	0.3708308	2898.005	1767.017	0.02641159	26	219.3232	0.971152	412.221	17243.64	2.255437E-34	25	1999.313	0.9725221	484.9788	20704.06	3.678E-38	32	1345.235	0.9705152	498.9698	19715.57	5.932778E-36	30	1755.447	0.9782814	538.4588	28758.37	3.678E-38	28	1272.814	0.9521032	510.1619	12128.93	2.64983E-17	20	941.7327	0.9785253	470.3604	25989.25	3.678E-38	28	859.5612	EGF	EGF_E339_F	6031163	NM_001963.2	EGF	1950	4	36.1	111053838	339	N	AAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTC	URG	urogastrone; go_component: nucleus; go_component: plasma membrane; go_component: integral to membrane; go_component: extracellular region; go_function: calcium ion binding; go_function: protein binding; go_function: growth factor activity; go_function: epidermal growth factor receptor activating ligand activity; go_process: DNA replication; go_process: activation of MAPK activity; go_process: positive regulation of cell proliferation; go_process: epidermal growth factor receptor signaling pathway; go_process: chromosome organization and biogenesis (sensu Eukaryota)	epidermal growth factor (beta-urogastrone)
EGF_P242_R	3497	0.04334117	20871.36	950.1017	3.678E-38	27	619.2302	0.8815839	2158.164	16811.57	7.246691E-37	25	956.3837	0.8983085	2058.128	19064.17	3.678E-38	22	1159.155	0.03206428	14026.43	467.9587	2.608479E-17	21	1709.922	0.8775358	2109.742	15834.25	1.477804E-35	31	761.5217	0.8814992	1865.891	14623.8	1.747233E-34	33	1424.275	0.8655424	2320.744	15583.02	7.070182E-28	27	1091.667	0.8833051	2421.637	19087.16	3.271709E-28	23	1000.193	0.8472322	1691.477	9935.323	1.57769E-14	39	784.5669	0.9086185	1833.597	19226.03	3.678E-38	39	651.4741	EGF	EGF_P242_R	6031163	NM_001963.2	EGF	1950	4	36.1	111053257	-242	N	CATAGCCAATATTTAGCAGTTCCCGCCATTCACCATGAGCACCTCCAC	URG	urogastrone; go_component: nucleus; go_component: plasma membrane; go_component: integral to membrane; go_component: extracellular region; go_function: calcium ion binding; go_function: protein binding; go_function: growth factor activity; go_function: epidermal growth factor receptor activating ligand activity; go_process: DNA replication; go_process: activation of MAPK activity; go_process: positive regulation of cell proliferation; go_process: epidermal growth factor receptor signaling pathway; go_process: chromosome organization and biogenesis (sensu Eukaryota)	epidermal growth factor (beta-urogastrone)
EGF_P413_F	3814	0.6000571	1076.378	1764.986	0.1287221	24	108.7869	0.8085407	2282.301	10060.56	3.872783E-15	31	876.9094	0.8591484	2637.108	16695.46	3.678E-38	25	793.3976	0.721086	462.5896	1454.483	0.4466686	23	94.98875	0.8259242	2464.707	12168.57	3.206852E-23	32	590.8918	0.7592185	3687.358	11942.08	8.301276E-31	30	934.5547	0.852545	2146.993	12991.51	1.251472E-19	27	890.0018	0.8517618	2603.873	15536.19	7.850169E-20	23	918.4854	0.7825063	2539.012	9494.726	1.301696E-15	35	695.8402	0.8806432	2090.683	16163.39	1.846691E-36	21	881.7193	EGF	EGF_P413_F	6031163	NM_001963.2	EGF	1950	4	36.1	111053086	-413	N	CCTGGAATGTGCACTGGTATTGACATTTCGTTCAAATAATGGGCTGAAGGTG	URG	urogastrone; go_component: nucleus; go_component: plasma membrane; go_component: integral to membrane; go_component: extracellular region; go_function: calcium ion binding; go_function: protein binding; go_function: growth factor activity; go_function: epidermal growth factor receptor activating ligand activity; go_process: DNA replication; go_process: activation of MAPK activity; go_process: positive regulation of cell proliferation; go_process: epidermal growth factor receptor signaling pathway; go_process: chromosome organization and biogenesis (sensu Eukaryota)	epidermal growth factor (beta-urogastrone)
EGFR_E295_R	4086	0.506474	2296.172	2459.037	0.002250682	34	183.9106	0.05230685	8347.394	466.2443	1.08283E-07	25	545.6718	0.04472612	11284.15	533.0082	4.919057E-15	24	576.0596	0.1129875	4396.171	572.7217	0.0163535	32	148.8874	0.03767646	9382.622	371.2594	4.591609E-10	29	517.6017	0.06548241	10321.05	730.2115	6.801136E-15	30	568.1547	0.03852091	9838.521	398.1791	8.826153E-09	20	609.2615	0.04703016	11769.09	585.7535	4.282463E-09	29	523.3764	0.0585951	6847.568	432.4319	1.290596E-05	30	390.5025	0.03670011	10145.05	390.3194	1.248227E-11	35	316.3368	EGFR	EGFR_E295_R	41327737	NM_005228.3	EGFR	1956	7	36.1	55054514	295	Y	GGGCAGCGCTCCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGA	ERBB, mENA, ERBB1	isoform a is encoded by transcript variant 1; epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog); truncated epidermal growth factor receptor; cell growth inhibiting protein 40; go_component: nucleus; go_component: endosome; go_component: plasma membrane; go_component: integral to membrane; go_component: extracellular space; go_component: AP-2 adaptor complex; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: actin filament binding; go_function: double-stranded DNA binding; go_function: MAP/ERK kinase kinase activity; go_function: transmembrane receptor activity; go_function: nitric-oxide synthase regulator activity; go_function: epidermal growth factor receptor activity; go_function: epidermal growth factor receptor activity; go_function: epidermal growth factor receptor activity; go_process: cell cycle; go_process: ossification; go_process: cell proliferation; go_process: cell-cell adhesion; go_process: response to stress; go_process: phospholipase C activation; go_process: protein amino acid phosphorylation; go_process: protein insertion into membrane; go_process: positive regulation of cell migration; go_process: positive regulation of phosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of nitric-oxide synthase activity; go_process: calcium-dependent phospholipase A2 activation; go_process: regulation of peptidyl-tyrosine phosphorylation; go_process: cell surface receptor linked signal transduction; go_process: positive regulation of nitric oxide biosynthesis; go_process: negative regulation of progression through cell cycle; go_process: epidermal growth factor receptor signaling pathway	epidermal growth factor receptor isoform a
EGFR_P260_R	2434	0.146951	2732.465	487.9363	0.07067613	31	117.2933	0.07305926	7605.464	607.3264	1.047547E-06	22	520.7731	0.06943903	8497.628	641.5602	7.567971E-09	37	323.6401	0.05145045	3470.531	193.6698	0.1002796	28	167.6824	0.07610514	7506.145	626.5504	5.240256E-07	45	398.0789	0.09951275	7861.012	879.7706	3.470605E-09	24	566.3736	0.05558845	8321.479	495.6917	1.566748E-06	19	600.5807	0.08246937	8696.984	790.6895	1.815448E-05	41	318.5634	0.07433587	5773.332	471.6605	0.0003349076	36	386.94	0.1021939	7776.415	896.5429	7.431571E-08	25	409.3741	EGFR	EGFR_P260_R	41327737	NM_005228.3	EGFR	1956	7	36.1	55053959	-260	Y	CAGTGCTGGGAACGCCCCTCTCGGAAATTAACTCCTCAGGGCACCCG	ERBB, mENA, ERBB1	isoform a is encoded by transcript variant 1; epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog); truncated epidermal growth factor receptor; cell growth inhibiting protein 40; go_component: nucleus; go_component: endosome; go_component: plasma membrane; go_component: integral to membrane; go_component: extracellular space; go_component: AP-2 adaptor complex; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: actin filament binding; go_function: double-stranded DNA binding; go_function: MAP/ERK kinase kinase activity; go_function: transmembrane receptor activity; go_function: nitric-oxide synthase regulator activity; go_function: epidermal growth factor receptor activity; go_function: epidermal growth factor receptor activity; go_function: epidermal growth factor receptor activity; go_process: cell cycle; go_process: ossification; go_process: cell proliferation; go_process: cell-cell adhesion; go_process: response to stress; go_process: phospholipase C activation; go_process: protein amino acid phosphorylation; go_process: protein insertion into membrane; go_process: positive regulation of cell migration; go_process: positive regulation of phosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of nitric-oxide synthase activity; go_process: calcium-dependent phospholipase A2 activation; go_process: regulation of peptidyl-tyrosine phosphorylation; go_process: cell surface receptor linked signal transduction; go_process: positive regulation of nitric oxide biosynthesis; go_process: negative regulation of progression through cell cycle; go_process: epidermal growth factor receptor signaling pathway	epidermal growth factor receptor isoform a
EGR4_E70_F	3191	0.1703674	6122.906	1277.891	9.870294E-08	16	483.7533	0.1877591	7911.568	1851.968	2.040324E-09	29	707.7751	0.1387323	10354.55	1684.01	1.252267E-15	19	1239.424	0.04819219	5578.079	287.494	0.003227226	34	227.1983	0.1995904	8431.299	2127.368	7.983834E-12	30	620.0933	0.2592782	9550.976	3378.174	1.11686E-20	22	1110.131	0.2363913	8674.854	2716.442	6.643062E-11	14	1355.349	0.3045198	11653.34	5146.262	6.203889E-17	28	519.8769	0.3165409	6388.006	3004.889	2.418972E-09	31	614.6956	0.1365867	10677.06	1704.865	3.218421E-16	33	440.3533	EGR4	EGR4_E70_F	4503494	NM_001965.1	EGR4	1961	2	36.1	73374048	70	Y	GCGGTAGGGGTTCCCCGCAGCGCACAGACCTAGGCGCCCGGGCTCC	NGFIC, NGFI-C, PAT133	go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: positive regulation of cell proliferation	early growth response 4
EGR4_P479_F	720	0.1177048	5415.364	735.7913	2.188822E-05	25	242.4586	0.09874469	9441.543	1045.405	7.218848E-11	27	707.9842	0.1053762	11664.77	1385.751	1.661193E-18	32	565.3796	0.04661968	6172.728	306.7323	0.0008849124	30	186.4019	0.1063553	9936.217	1194.44	3.575832E-13	27	632.3058	0.1000045	10896.83	1221.93	4.685304E-18	32	623.5375	0.1122642	9641.739	1231.953	6.412459E-10	31	813.7667	0.116495	11317.06	1505.401	8.597649E-10	33	489.2731	0.1467593	8228.254	1432.478	6.756624E-10	26	671.1342	0.1224316	11918.61	1676.744	1.073923E-19	27	438.2646	EGR4	EGR4_P479_F	4503494	NM_001965.1	EGR4	1961	2	36.1	73374597	-479	Y	TGACACTCAGTCCCCCTTAACGTCAGTTTCTCACCTGTGCATTTCCTGTGGA	NGFIC, NGFI-C, PAT133	go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: positive regulation of cell proliferation	early growth response 4
EIF2AK2_E103_R	1319	0.05929802	5266.285	338.2687	0.0001598666	22	194.5803	0.05118268	10131.37	551.9174	2.779704E-11	28	550.767	0.04717771	11661.59	582.3596	3.428734E-16	33	769.8121	0.06669284	5751.569	418.1451	0.001732142	21	220.288	0.06065438	9855.26	642.82	1.097247E-11	26	513.313	0.07707946	10343.43	872.203	2.330168E-15	28	595.1035	0.05138687	11114.07	607.472	1.466444E-11	29	602.4655	0.050226	11912.3	635.2349	2.228291E-09	21	757.3771	0.05697526	8413.899	514.389	1.999072E-08	31	480.0193	0.04807385	13378.93	680.7083	4.014746E-21	27	563.4053	EIF2AK2	EIF2AK2_E103_R	4506102	NM_002759.1	EIF2AK2	5610	2	36.1	37237469	103	Y	GGGACGCAGGATTGGCGAGTCCCGCCCCGGCTGGGCCTGCAGCC	PKR, PRKR, EIF2AK1, MGC126524	protein kinase, interferon-inducible double stranded RNA dependent; interferon-inducible elF2alpha kinase; double stranded RNA activated protein kinase; go_component: intracellular; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: double-stranded RNA binding; go_function: double-stranded RNA binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: protein phosphatase type 2A regulator activity; go_function: eukaryotic translation initiation factor 2alpha kinase activity; go_process: apoptosis; go_process: cell cycle; go_process: immune response; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation	eukaryotic translation initiation factor 2-alpha kinase 2
EIF2AK2_P313_F	5618	0.1093052	1850.856	239.4071	0.3220285	29	58.81246	0.08067349	6748.855	601.0063	1.966662E-05	26	363.108	0.08424915	8199.292	763.5355	1.666852E-08	28	314.3663	0.1629181	6080.265	1202.842	0.0001293945	35	227.6326	0.09721648	6983.892	762.8307	2.248143E-06	28	325.7111	0.1072051	6464.773	788.2855	2.510945E-06	25	217.388	0.1073329	6997.399	853.3801	3.162982E-05	29	241.693	0.09380539	7190.047	754.6345	0.0005689121	35	203.551	0.1642946	6291.263	1256.483	5.025876E-06	32	272.376	0.1258732	8221.463	1198.281	2.883496E-09	27	351.2515	EIF2AK2	EIF2AK2_P313_F	4506102	NM_002759.1	EIF2AK2	5610	2	36.1	37237885	-313	Y	CTAGGGTTCTCCGCTGGCCTAGTCCGCTGGCCGCACTAGGTTCTCGAATCAAG	PKR, PRKR, EIF2AK1, MGC126524	protein kinase, interferon-inducible double stranded RNA dependent; interferon-inducible elF2alpha kinase; double stranded RNA activated protein kinase; go_component: intracellular; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: double-stranded RNA binding; go_function: double-stranded RNA binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: protein phosphatase type 2A regulator activity; go_function: eukaryotic translation initiation factor 2alpha kinase activity; go_process: apoptosis; go_process: cell cycle; go_process: immune response; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation	eukaryotic translation initiation factor 2-alpha kinase 2
ELK1_E156_F	3207	0.1475636	2133.592	386.6527	0.1988243	23	95.16093	0.1045736	5034.248	599.6099	0.00216451	39	221.9993	0.1125371	5449.005	703.6564	0.0004210576	29	284.3948	0.07472191	2460.027	206.738	0.26573	30	154.8601	0.642674	3382.441	6263.397	7.690482E-10	30	458.937	0.5912257	3836.778	5693.912	5.796896E-11	38	416.9764	0.628354	4362.461	7544.829	6.133158E-12	28	563.992	0.5781969	4830.218	6758.219	5.131064E-08	28	319.5405	0.6349179	2818.671	5075.889	1.392356E-06	30	744.4305	0.6578627	3131.211	6212.983	4.063518E-09	23	355.1246	ELK1	ELK1_E156_F	11496880	NM_005229.2	ELK1	2002	X	36.1	47394808	156	Y	CGGTGGCGTTGGCAATGTTGGCAGCTCCGGGGGGCGGGGGCTCCATACGCGGCC	.	go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	ELK1 protein
ELK1_E53_F	269	0.2192897	4616.106	1324.683	4.83262E-05	32	212.9176	0.2762664	9494.104	3662.298	2.929302E-17	20	543.7419	0.2420891	10122.99	3265.391	1.587547E-19	30	461.5925	0.376292	1313.535	852.8058	0.3830164	42	118.3423	0.776329	4486.758	15919.96	3.678E-38	20	749.3304	0.7714846	5055.495	17405.32	3.678E-38	29	823.8489	0.8022271	3533.385	14738.11	4.328961E-29	20	1183.491	0.7508373	6016.173	18430.73	8.324151E-37	23	532.4384	0.7792909	3644.56	13221.49	9.0036E-32	23	1379.78	0.7659127	4508.105	15077.31	3.678E-38	34	994.2248	ELK1	ELK1_E53_F	11496880	NM_005229.2	ELK1	2002	X	36.1	47394911	53	Y	GCGGCGGCAGCACCTAGAAGCCGCCCCTGCGTTTCCCTACAGCTCAC	.	go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	ELK1 protein
ELK1_P195_R	3870	0.1113068	5929.277	755.153	2.527476E-06	28	226.1606	0.1563528	10801.15	2020.306	2.28321E-16	16	562.6887	0.1379527	11795.94	1903.697	1.718466E-20	24	671.9584	0.02401098	9350.979	232.5101	1.22254E-07	32	479.6954	0.5431014	6433.658	7766.36	8.240705E-22	28	827.5652	0.5595839	7083.253	9126.897	2.89075E-33	32	568.4712	0.5878259	7060.012	10211.32	7.443541E-26	32	1335.338	0.4985031	8828.444	8875.143	7.33993E-19	27	833.6312	0.5631087	5706.094	7483.47	6.347648E-19	28	486.901	0.5798494	6154.314	8631.574	1.832687E-23	36	625.9387	ELK1	ELK1_P195_R	11496880	NM_005229.2	ELK1	2002	X	36.1	47395159	-195	Y	TCCACGCCGATTGGCTCAAGGACTGACGGACTGTGAGCAACTGAAAAGGC	.	go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	ELK1 protein
ELK1_P569_R	724	0.3069368	10483.15	4686.958	3.475303E-34	27	1037.067	0.124443	7874.343	1133.394	4.997326E-08	30	330.4675	0.1110739	8617.879	1089.324	5.254238E-10	31	451.3569	0.2014972	6498.279	1665.035	1.165255E-05	24	440.4661	0.6586041	4418.638	8717.132	1.508844E-18	39	597.2035	0.6994296	4950.932	11753.56	1.951228E-35	29	712.264	0.7639135	4060.519	13462.34	1.194337E-26	28	1116.096	0.6196674	6956.011	11496.2	1.529092E-20	32	548.0123	0.6806791	3795.049	8302.863	8.703993E-16	27	917.036	0.7067205	5524.158	13552.62	3.678E-38	19	672.2819	ELK1	ELK1_P569_R	11496880	NM_005229.2	ELK1	2002	X	36.1	47395533	-569	Y	GAGGGCAGGATGGCTGTCAGGCACACGAAAGAGCATTGAGTGGCAGAAACG	.	go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	ELK1 protein
ELK1_P6_R	3498	0.1103223	4029.829	512.1091	0.004020422	34	162.4616	0.06291507	6868.095	467.8319	2.055551E-05	38	305.2234	0.04678877	7912.408	393.2924	2.690734E-07	29	474.4612	0.03694438	4363.485	171.2265	0.03209217	31	203.9206	0.7976199	2445.1	10030.74	1.145098E-16	31	791.4152	0.836716	2454.032	13087.62	1.914786E-30	38	1101.558	0.8118554	2880.675	12861.8	2.675769E-21	35	1050.942	0.8125426	3392.202	15137.1	1.015998E-20	26	897.4648	0.8093695	2375.12	10508.74	5.15617E-18	47	856.8854	0.8273345	3024.972	14973.44	2.124782E-35	32	750.1421	ELK1	ELK1_P6_R	11496880	NM_005229.2	ELK1	2002	X	36.1	47394970	-6	Y	GAGGAGGAGGAGCCCAATGTCCCGCCGCTCGCTGATTGGCCAAAGCGCTAT	.	go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	ELK1 protein
ELK3_P514_F	3501	0.4215643	1071.207	853.5759	0.3766356	25	59.04764	0.2361334	3183.996	1015.179	0.03584409	41	170.6251	0.2887931	3604.227	1504.14	0.005756813	27	244.4431	0.2978717	1191.665	547.9775	0.4929339	27	75.53644	0.2148178	3567.45	1003.377	0.01553292	32	124.8345	0.1955369	3645.971	910.5146	0.009723305	31	239.5322	0.2653742	3211.822	1196.354	0.05015983	34	189.8168	0.2785407	3903.63	1545.72	0.03306074	22	180.672	0.2262543	2925.619	884.7339	0.06607775	27	228.5186	0.2538686	2882.336	1014.729	0.05327936	31	127.6768	ELK3	ELK3_P514_F	44955920	NM_005230.2	ELK3	2004	12	36.1	95111824	-514	Y	GGCCGAGGGCTGGCTTTTAAAACACCGAAAACCCAGACAGGAACGGTGTCC	ERP, NET, SAP2	ETS-domain protein; SRF accessory protein 2; go_component: nucleus; go_function: transcription factor activity; go_function: transcription cofactor activity; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription from RNA polymerase II promoter	ELK3 protein
ELL_P693_F	3515	0.1224581	1200.612	181.4962	0.5675153	27	56.40756	0.3820905	5272.309	3322.021	2.533663E-07	25	521.8327	0.4148727	6636.511	4776.386	5.548263E-14	31	477.5771	0.161032	3464.582	684.188	0.05504695	23	233.7228	0.5058134	3860.127	4053.297	1.210987E-06	38	370.5704	0.4795783	4985.657	4686.527	2.665492E-11	32	247.365	0.594169	3433.088	5172.723	3.133376E-06	35	344.7111	0.4202176	6197.072	4564.023	6.095688E-07	17	547.4504	0.455618	3538.82	3045.493	0.0001232478	30	274.9095	0.5423586	4359.122	5284.581	1.02336E-09	24	477.9296	ELL	ELL_P693_F	47078265	NM_006532.2	ELL	8178	19	36.1	18494611	-693	Y	ATCCCCACAGTCCCTGAGCGATGGTGCAGTCCAGCTTCATTTTCCTATT	Men, ELL1, C19orf17, ELL_HUMAN, DKFZp434I1916	ELL gene (11-19 lysine-rich leukemia gene); ELL PROTEIN; eleven-nineteen lysine-rich leukemia gene; go_component: nucleus; go_function: positive transcription elongation factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: RNA elongation from RNA polymerase II promoter	elongation factor RNA polymerase II
EMR3_E61_F	3222	0.1173952	4838.512	656.8709	0.0002314712	29	222.5273	0.5294334	6798.804	7761.828	2.796317E-21	29	1279.481	0.5028762	8713.86	8915.85	7.526588E-35	29	1305.081	0.8304937	352.3934	2216.495	0.2871995	26	78.19161	0.5073233	7451.156	7775.643	3.147357E-25	31	919.1655	0.5950989	6220.316	9289.214	2.596393E-30	28	982.728	0.4185148	8172.579	5954.058	5.380391E-17	33	950.3179	0.4608422	11243.77	9696.027	1.098043E-26	34	974.1202	0.5546556	5735.952	7268.404	2.273319E-18	21	534.6923	0.5885975	9876.804	14273.91	3.678E-38	32	1099.777	EMR3	EMR3_E61_F	23397638	NM_152939.1	EMR3	84658	19	36.1	14646749	61	N	AGCAAACTGCTTCCCCTCTTTCGCCATCAGACTCATGGTTCTGCTTTTCGTTT	.	isoform b is encoded by transcript variant 2; egf-like module-containing mucin-like receptor 3; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: calcium ion binding; go_function: G-protein coupled receptor activity; go_function: G-protein coupled receptor activity; go_process: signal transduction; go_process: neuropeptide signaling pathway	egf-like module-containing mucin-like receptor 3 isoform b
EMR3_P1297_R	740	0.5989309	471.2354	853.0464	0.5877132	39	53.18011	0.9313511	1064.178	15794.25	7.68373E-29	25	1341.507	0.9317142	1493.786	21746.13	3.678E-38	22	822.7023	0.8455602	341.1007	2415.033	0.2468638	26	135.4558	0.8980268	1525.698	14316.7	2.095437E-27	34	1241.511	0.9062401	1650.288	16917.47	3.678E-38	38	957.3995	0.9275871	1514.786	20684.9	3.678E-38	33	1026.9	0.941709	1320.215	22944	3.088216E-36	16	1057.358	0.8933782	1130.455	10309.92	4.787085E-14	20	1167.131	0.9431243	1415.445	25129.41	3.678E-38	29	723.5161	EMR3	EMR3_P1297_R	23397638	NM_152939.1	EMR3	84658	19	36.1	14648107	-1297	Y	TGATTTACACAGGAACCGAGAGATTGGTCGGACTGGGTGTGCTGTTTG	.	isoform b is encoded by transcript variant 2; egf-like module-containing mucin-like receptor 3; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: calcium ion binding; go_function: G-protein coupled receptor activity; go_function: G-protein coupled receptor activity; go_process: signal transduction; go_process: neuropeptide signaling pathway	egf-like module-containing mucin-like receptor 3 isoform b
EMR3_P39_R	732	0.1838381	6459.64	1477.54	6.719087E-09	37	264.6492	0.4671207	4286.467	3845.166	1.403024E-06	24	221.3117	0.4172092	4780.26	3493.688	3.058164E-07	36	241.3355	0.2647423	4410.76	1624.177	0.002292498	34	244.9544	0.4395315	4289.243	3442.139	2.377977E-06	32	295.6129	0.4477709	4165.586	3458.719	5.567654E-07	19	519.3265	0.3819545	4991.039	3146.282	1.355528E-05	26	280.0348	0.4299317	4647.879	3580.735	0.0003186938	29	410.4662	0.4977126	3773.029	3837.753	4.000847E-06	26	406.8987	0.5930465	3972.397	5934.636	2.919166E-10	28	292.2182	EMR3	EMR3_P39_R	23397638	NM_152939.1	EMR3	84658	19	36.1	14646849	-39	N	GGGATGATTGAGTTGGTAAACCCTAACGAGGAAATGCCCTGAAAGTTACATCAC	.	isoform b is encoded by transcript variant 2; egf-like module-containing mucin-like receptor 3; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: calcium ion binding; go_function: G-protein coupled receptor activity; go_function: G-protein coupled receptor activity; go_process: signal transduction; go_process: neuropeptide signaling pathway	egf-like module-containing mucin-like receptor 3 isoform b
ENC1_P484_R	3517	0.07985426	8171.903	717.8718	3.279663E-11	19	586.189	0.07844435	8869.027	763.4586	3.629498E-09	31	543.3126	0.07630973	11612.87	967.6465	3.888087E-17	32	491.2097	0.0586219	5299.376	336.2323	0.005042046	24	299.5732	0.08007581	11133.19	977.8053	1.125728E-15	26	436.9691	0.07223307	10015.63	787.5715	3.309231E-14	24	419.9437	0.0864357	10364.53	990.0877	7.832481E-11	32	627.1901	0.0909503	10545.6	1065.091	4.786456E-08	29	549.7247	0.1165498	6871.699	919.7467	2.054354E-06	22	783.8162	0.07382986	11476.86	922.8521	2.879543E-16	16	626.8578	ENC1	ENC1_P484_R	4505460	NM_003633.1	ENC1	8507	5	36.1	73972757	-484	Y	ATGCTCTAAAAAGGGCTGCAAGGGGCGAGCTGGGTATCCGCAGGACAGG	NRPB, CCL28, ENC-1, PIG10, TP53I10	nuclear restricted protein, BTB domain-like (brain); tumor protein p53 inducible protein 10; go_component: nucleus; go_component: cytoskeleton; go_function: actin binding; go_function: protein binding; go_process: development; go_process: nervous system development	ectodermal-neural cortex (with BTB-like domain)
EPHA1_E46_R	265	0.06545005	4285.914	307.162	0.003508951	26	213.6006	0.07584722	7410.638	616.4143	2.034219E-06	25	440.3574	0.05518395	10530.42	620.8921	2.526804E-13	21	289.773	0.1093146	3800.248	478.6807	0.0461742	29	179.4047	0.07377014	8255.363	665.468	2.06124E-08	29	420.7974	0.06356408	8569.922	588.5034	4.199795E-10	21	450.9624	0.04367264	8369.833	386.7922	1.914785E-06	26	567.0645	0.05322012	9584.696	544.3934	3.497774E-06	31	353.9286	0.07887032	6719.663	583.9232	1.189698E-05	39	428.413	0.04606698	8685.538	424.2679	1.153967E-08	26	282.9949	EPHA1	EPHA1_E46_R	56119206	NM_005232.3	EPHA1	2041	7	36.1	142816061	46	Y	GGGACAGTGGCCCGGATGGCAGCGCCAGGTTGCAAGGGACTAGGAGA	EPH, EPHT, EPHT1	oncogene EPH; eph tyrosine kinase 1; erythropoietin-producing hepatoma amplified sequence; ephrin type-A receptor 1; tyrosine-protein kinase receptor EPH; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA1
EPHA1_P119_R	3871	0.2552184	6483.679	2256.065	7.947333E-11	31	421.1	0.05315633	10625.52	602.1364	1.773111E-12	22	593.665	0.04359615	14288.1	655.8588	1.329535E-24	19	440.6403	0.104017	7488.914	881.017	6.324049E-06	20	379.4429	0.05053924	11833.83	635.2309	1.195611E-16	28	738.973	0.06296638	11627.76	788.077	5.389871E-19	32	626.4135	0.06999571	12586.46	954.8317	1.446534E-15	31	727.9078	0.04880774	15521.96	801.5969	5.781976E-16	22	731.0917	0.08017994	10954.46	963.6081	2.672116E-15	29	572.1115	0.05402546	12154.83	699.8844	1.572592E-17	21	911.9233	EPHA1	EPHA1_P119_R	56119206	NM_005232.3	EPHA1	2041	7	36.1	142816226	-119	Y	AGACTGGTAATCAAATTCAAGAACCGGAGGCGTCTTGACCCGAATGAGACTGCG	EPH, EPHT, EPHT1	oncogene EPH; eph tyrosine kinase 1; erythropoietin-producing hepatoma amplified sequence; ephrin type-A receptor 1; tyrosine-protein kinase receptor EPH; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA1
EPHA2_P203_F	2062	0.351294	4152.744	2302.99	6.550745E-06	33	247.2692	0.7752244	3100.551	11038.32	5.03314E-20	27	635.0211	0.7457221	4187.289	12573.35	2.500512E-31	30	669.7664	0.7052267	1318.945	3394.737	0.02451802	31	202.4993	0.7622506	3257.446	10764.34	3.035503E-21	29	711.2549	0.7900751	2863.798	11154.58	1.658885E-24	33	756.0574	0.7062557	3948.594	9734.123	6.625732E-16	33	429.8509	0.7435176	4585.603	13583.11	6.764485E-20	25	898.7198	0.8125337	2485.866	11207.9	1.774469E-20	28	622.2245	0.7122069	3727.462	9471.892	1.606504E-18	24	700.0831	EPHA2	EPHA2_P203_F	32967310	NM_004431.2	EPHA2	1969	1	36.1	16355354	-203	Y	TCCAAAGTTTGAGCGTCTCAAAGCGCCAGCGCCCCTACGGATTAGCCC	ECK	epithelial cell receptor protein tyrosine kinase; receptor protein tyrosine kinase regulated by p53 and E2F-1; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein serine/threonine kinase activity; go_process: development; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA2
EPHA2_P340_R	2081	0.2107354	817.9741	245.1011	0.6753787	34	35.98825	0.5979147	3722.598	5684.334	9.577244E-09	47	479.7731	0.5540243	4895.808	6206.165	3.348072E-13	40	462.6854	0.06381613	2274.982	161.8936	0.3173926	28	121.0614	0.5385544	4017.768	4805.859	3.131266E-08	26	404.9071	0.6070195	3446.295	5477.803	1.393261E-09	34	358.5849	0.4406697	5777.817	4630.853	4.428633E-09	15	513.4054	0.5515208	4804.403	6031.229	4.920241E-07	29	336.7476	0.608275	2740.967	4411.485	1.993205E-05	34	547.0201	0.5326298	4691.487	5460.53	8.772001E-11	32	405.2224	EPHA2	EPHA2_P340_R	32967310	NM_004431.2	EPHA2	1969	1	36.1	16355491	-340	N	GAGACTGAGCTCAATGCGACTGAGCTCAACGCTGGCCTGAAGGTCTGAGCT	ECK	epithelial cell receptor protein tyrosine kinase; receptor protein tyrosine kinase regulated by p53 and E2F-1; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein serine/threonine kinase activity; go_process: development; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA2
EPHA3_E156_R	3239	0.03933441	5296.069	220.9418	0.0002152589	33	234.3579	0.2172648	7414.61	2085.84	6.425792E-09	26	401.894	0.2397727	8366.241	2670.219	4.853953E-13	25	667.8882	0.2382382	3135.819	1011.99	0.05511712	33	208.2792	0.1798192	7889.557	1751.657	7.860933E-10	40	374.9943	0.26137	8158.21	2922.232	5.630898E-15	23	643.2952	0.19181	8107.372	1947.879	1.800678E-08	28	450.089	0.168425	9222.741	1888.204	2.197008E-07	26	434.7605	0.2304026	6294.858	1914.497	4.08648E-07	30	343.8816	0.1837674	9372.848	2132.726	6.177152E-14	24	675.0278	EPHA3	EPHA3_E156_R	32967312	NM_005233.3	EPHA3	2042	3	36.1	89239520	156	Y	GGTAACTTCTCCAGCAATCAGAGCGCTCCCCCTCACATCAGTGGCATG	ETK, HEK, ETK1, HEK4, TYRO4	isoform a precursor is encoded by transcript variant 1; TYRO4 protein tyrosine kinase; eph-like tyrosine kinase 1; human embryo kinase 1; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA3 isoform a precursor
EPHA3_P106_R	744	0.1346952	5812.143	920.2972	2.058977E-06	36	220.8075	0.1665739	8122.751	1643.452	2.016365E-09	29	455.8209	0.08585647	10332.44	979.8164	9.989707E-14	29	507.7308	0.0513845	5015.27	277.0833	0.009442166	18	282.7489	0.1202567	8766.215	1211.969	1.540628E-10	33	506.6996	0.2463549	9621.102	3177.677	3.040207E-20	28	729.3881	0.116623	8108.053	1083.623	4.366437E-07	20	838.4789	0.1284705	9527.267	1419.137	3.567253E-07	23	378.5925	0.1386902	5963.132	976.3003	4.033574E-05	33	318.9355	0.1060319	11230.51	1343.891	9.563973E-17	34	477.4684	EPHA3	EPHA3_P106_R	32967312	NM_005233.3	EPHA3	2042	3	36.1	89239258	-106	Y	GGAGCATTTTTCTCAGCACCGCGGCCTCATCACATCTTCTGTGTTTCCTGTC	ETK, HEK, ETK1, HEK4, TYRO4	isoform a precursor is encoded by transcript variant 1; TYRO4 protein tyrosine kinase; eph-like tyrosine kinase 1; human embryo kinase 1; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA3 isoform a precursor
EPHA5_E158_R	2693	0.5760202	5832.555	8059.987	2.035648E-28	31	677.2236	0.05719083	17061.16	1040.996	1.918961E-33	28	1660.989	0.04718814	20134.2	1002.102	3.678E-38	40	905.6331	0.4634379	4094.071	3622.49	4.114116E-05	27	384.5186	0.0381114	17450.13	695.3614	2.134937E-36	27	1540.87	0.07780663	19038.31	1614.723	3.678E-38	28	1416.173	0.04211056	20721.49	915.3506	3.678E-38	25	1637.458	0.04883237	21447.03	1106.212	3.953538E-31	37	1023.973	0.08440904	12400.97	1152.474	4.876106E-20	24	1161.953	0.03215008	23467.67	782.8719	3.678E-38	27	1209.406	EPHA5	EPHA5_E158_R	32967318	NM_182472.1	EPHA5	2044	4	36.1	66217946	158	Y	GAGAAGGCACGTCCAGAGGGGAGCCCGTCGAGGTGCAGAGTAGCAGCCGGCC	CEK7, EHK1, HEK7, TYRO4	isoform b is encoded by transcript variant 2; ephrin type-A receptor 5; Eph homology kinase-1; receptor protein-tyrosine kinase HEK7; tyrosine-protein kinase receptor EHK-1; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane-ephrin receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA5 isoform b
EPHA5_P66_F	2095	0.1665664	4201.885	859.7562	0.0009221929	27	194.3217	0.6716296	3572.181	7510.863	3.73994E-12	34	452.7565	0.5952514	5181.05	7766.678	3.347957E-18	27	580.4745	0.1854265	3327.948	780.3253	0.05806685	34	122.4606	0.6189524	3878.982	6463.235	2.462364E-11	30	501.1813	0.7337612	3542.755	10039.53	6.226617E-23	38	703.9388	0.6282393	4071.903	7050.111	2.194217E-10	36	549.8053	0.5769985	6079.765	8429.557	1.480908E-12	30	555.4973	0.6474606	3249.609	6151.767	2.324739E-09	31	518.0513	0.5793228	5131.817	7204.835	4.268404E-16	19	650.1694	EPHA5	EPHA5_P66_F	32967318	NM_182472.1	EPHA5	2044	4	36.1	66218170	-66	Y	TGTCCCCCCTTGGGGTCCTACGCCTTCTGGCACGCGGCTCCTCCAA	CEK7, EHK1, HEK7, TYRO4	isoform b is encoded by transcript variant 2; ephrin type-A receptor 5; Eph homology kinase-1; receptor protein-tyrosine kinase HEK7; tyrosine-protein kinase receptor EHK-1; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane-ephrin receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA5 isoform b
EPHA7_E6_F	2901	0.1016652	8379.515	959.6332	2.08392E-12	28	521.0096	0.07996381	10437.15	915.8231	9.203907E-13	26	913.066	0.07155963	14957.26	1160.539	7.5195E-29	28	738.2825	0.1369514	5802.043	936.5555	0.0004898158	23	425.4324	0.05950944	12430.94	792.894	8.307407E-19	24	578.5174	0.136651	13155.07	2098.015	2.879258E-29	39	748.0019	0.06608508	11856.78	846.0779	1.225431E-13	29	824.2189	0.0660545	14958.75	1065.05	2.272381E-15	31	660.4155	0.09654332	8535.406	922.7789	1.779528E-09	37	787.4962	0.05586693	15927.4	948.3847	6.195585E-31	41	755.2952	EPHA7	EPHA7_E6_F	32967320	NM_004440.2	EPHA7	2045	6	36.1	94185987	6	Y	ACCGTGTTTGCTGCCTGCAAGTCTCCGACTGCAGACCGGCCGCTTGCTCCAC	EHK3, HEK11	ephrin type-A receptor 7; tyrosine-protein kinase receptor EHK-3; Eph homology kinase-3; receptor protein-tyrosine kinase HEK11; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA7
EPHA7_P205_R	1850	0.2658389	8979.614	3287.718	6.864127E-22	27	906.7065	0.129477	11501.12	1725.49	1.890455E-17	29	1174.289	0.0868591	16608.17	1589.302	2.949194E-37	31	817.5358	0.1949271	7693.742	1887.048	1.234152E-07	23	589.594	0.1086952	13846.78	1700.819	2.374517E-26	19	1454.096	0.1188114	16976.69	2302.463	3.678E-38	23	1063.937	0.121092	13485.42	1871.739	3.171715E-20	24	1399.908	0.1363482	18278.55	2901.497	2.522491E-27	38	788.1926	0.1509307	11155.14	2000.714	8.019189E-19	26	1115.556	0.08702568	17638.99	1690.899	3.678E-38	26	875.8947	EPHA7	EPHA7_P205_R	32967320	NM_004440.2	EPHA7	2045	6	36.1	94186198	-205	Y	GTCCGAGGCAGGAGCCAATCGGTGCCGAGCGGAGTCAGGTTGCTGGT	EHK3, HEK11	ephrin type-A receptor 7; tyrosine-protein kinase receptor EHK-3; Eph homology kinase-3; receptor protein-tyrosine kinase HEK11; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphA7
EPHA8_P256_F	1851	0.06486809	2219.729	160.9146	0.2353863	38	64.16116	0.1014372	6844.557	783.9595	7.956142E-06	34	309.1622	0.123364	8304.855	1182.768	1.507054E-09	30	421.6146	0.0336155	5834.755	206.4394	0.00226322	32	435.8603	0.1535853	5513.355	1018.566	0.0001274494	31	425.4558	0.1391828	6672.27	1094.986	3.042852E-07	28	322.3568	0.163181	6845.941	1354.469	1.119287E-05	25	517.7847	0.1416781	9835.255	1639.953	7.290894E-08	21	434.5221	0.1790345	6266.84	1388.468	3.400754E-06	28	295.7034	0.1127018	7200.812	927.326	6.524012E-07	24	320.3895	EPHA8	EPHA8_P256_F	55774976	NM_020526.3	EPHA8	2046	1	36.1	22762335	-256	Y	GGACGTCCCGATGGTGGCTTCGCGCACTGGGGCCCTGAGCCCTG	EEK, HEK3, KIAA1459	isoform 1 precursor is encoded by transcript variant 1; ephrin type-A receptor 8 precursor; eph- and elk-related tyrosine kinase; tyrosylprotein kinase; tyrosine-protein kinase receptor eek; protein-tyrosine kinase; hydroxyaryl-protein kinase; go_component: membrane; go_component: plasma membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	EPH receptor A8 isoform 1 precursor
EPHA8_P456_R	1856	0.310485	1226.969	597.5273	0.4110613	23	70.24522	0.8361715	1809.992	9748.493	3.084476E-13	34	559.3765	0.8622217	1691.318	11210.13	4.580534E-18	28	672.4104	0.626133	343.4999	742.7505	0.6593989	28	60.35761	0.8447129	1447.315	8416.907	2.692903E-10	31	575.4742	0.8304641	1860.882	9605.29	4.397147E-16	27	441.5971	0.7934906	1995.124	8050.296	1.870805E-08	36	430.0615	0.7848619	2853.839	10776.13	4.570018E-11	36	380.054	0.7984678	1828.731	7641.604	1.680241E-09	38	441.8743	0.764675	2430.119	8221.477	6.7982E-12	22	426.0766	EPHA8	EPHA8_P456_R	55774976	NM_020526.3	EPHA8	2046	1	36.1	22762135	-456	Y	TCACCTAAAAGTGCCTCTGAGTTTGCCGCTGAGCCCATCTCTGAGCCTCTGCCC	EEK, HEK3, KIAA1459	isoform 1 precursor is encoded by transcript variant 1; ephrin type-A receptor 8 precursor; eph- and elk-related tyrosine kinase; tyrosylprotein kinase; tyrosine-protein kinase receptor eek; protein-tyrosine kinase; hydroxyaryl-protein kinase; go_component: membrane; go_component: plasma membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	EPH receptor A8 isoform 1 precursor
EPHB1_E202_R	2903	0.145924	7032.823	1218.685	1.254428E-09	30	275.1831	0.6365756	6568.317	11680.25	5.220009E-34	28	1293.913	0.5707577	8128.999	10941.99	3.678E-38	33	1567.471	0.1513993	5059.412	920.4935	0.002565131	36	329.1273	0.583976	7389.548	10513.14	2.190714E-35	32	1023.599	0.6632915	6890.094	13769.98	3.678E-38	39	1079.455	0.7119161	6200.897	15570.85	3.678E-38	25	1295.147	0.7133731	8051.74	20288.51	3.678E-38	25	953.2173	0.6557315	4837.116	9403.773	3.079133E-22	23	667.6396	0.4367114	10292.16	8056.928	7.37744E-37	21	1210.055	EPHB1	EPHB1_E202_R	55770893	NM_004441.3	EPHB1	2047	3	36.1	135997152	202	Y	GGCTTGGTCTCGGCCTGCGGGCCGTCGGCCGGCGATGGCCCTGGATTATCTAC	ELK, NET, Hek6, EPHT2	eph tyrosine kinase 2; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: ephrin receptor activity; go_process: signal transduction; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB1 precursor
EPHB1_P503_F	1861	0.2274976	1870.536	580.3117	0.2165536	28	95.14877	0.1450653	7968.884	1369.128	1.281429E-08	25	471.9514	0.1661784	9440.569	1901.41	8.402425E-14	28	622.58	0.5289285	290.8407	438.8437	0.7404333	25	37.47746	0.1651278	7473.575	1497.963	1.653766E-08	29	450.6008	0.1912134	7613.416	1823.606	9.624296E-11	31	503.6537	0.1820376	7751.433	1747.337	1.460716E-07	25	491.8288	0.1916898	8546.663	2050.546	9.703969E-07	31	577.4568	0.2804241	5631.891	2233.76	1.553749E-06	28	589.4012	0.1283074	12335.36	1830.403	1.861416E-21	13	514.6862	EPHB1	EPHB1_P503_F	55770893	NM_004441.3	EPHB1	2047	3	36.1	135996447	-503	Y	TCTTGTCACAGAGAAGATGAACGAAGGCTCGTTTGATCATTTAAAGCGGATCCAGTCC	ELK, NET, Hek6, EPHT2	eph tyrosine kinase 2; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: ephrin receptor activity; go_process: signal transduction; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB1 precursor
EPHB2_E297_F	2927	0.1014597	3045.332	355.1587	0.05139046	30	143.44	0.06378391	9974.702	686.3842	3.099567E-11	29	486.3459	0.04803959	13258.16	674.1042	3.141E-21	29	652.3806	0.07381756	2675.788	221.2328	0.2186398	27	171.5257	0.05449992	11242.51	653.7978	4.167851E-15	22	782.5412	0.04974435	11545.64	609.6304	3.603291E-18	36	683.7728	0.06000265	10879.17	700.8307	2.819266E-11	36	748.0108	0.04526782	17362.25	827.9577	6.048624E-20	26	716.2709	0.06874887	8704.781	650.0059	2.890306E-09	30	785.5963	0.07148904	9554.606	743.3392	4.217272E-11	24	529.6872	EPHB2	EPHB2_E297_F	55774977	NM_004442.5	EPHB2	2048	1	36.1	22910342	297	Y	GCTGATTGACTGTGCCAGGAGGAGGCGAAGGGACCATCTTGCCGAGGC	DRT, ERK, Hek5, EPHT3, Tyro5, MGC87492	isoform 2 precursor is encoded by transcript variant 2; elk-related tyrosine kinase; developmentally-regulated eph-related tyrosine kinase; eph tyrosine kinase 3; go_component: synapse; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane-ephrin receptor activity; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB2 isoform 2 precursor
EPHB2_P165_R	2127	0.2411678	1403.871	477.9519	0.3912802	21	76.03214	0.06110959	4394.724	292.5482	0.01542448	25	160.1579	0.04710136	4505.648	227.6552	0.0127048	19	130.2718	0.1990447	665.4573	190.2231	0.7129576	21	34.19949	0.05891605	3509.143	225.9485	0.06469516	28	145.3943	0.06406591	3068.569	216.8927	0.09903684	23	110.4922	0.08267107	3346.834	310.6339	0.129385	31	135.3435	0.08736888	4398.702	430.6741	0.06868256	19	204.7296	0.08533721	3843.596	367.934	0.03452571	34	167.8575	0.09805049	2040.2	232.6601	0.3535734	25	77.1125	EPHB2	EPHB2_P165_R	55774977	NM_004442.5	EPHB2	2048	1	36.1	22909880	-165	Y	AGGTGGGCCGTGCCCAGCGCTGGCGGAGCCCGGGTCCCCGTTCTGC	DRT, ERK, Hek5, EPHT3, Tyro5, MGC87492	isoform 2 precursor is encoded by transcript variant 2; elk-related tyrosine kinase; developmentally-regulated eph-related tyrosine kinase; eph tyrosine kinase 3; go_component: synapse; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane-ephrin receptor activity; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB2 isoform 2 precursor
EPHB3_E0_F	2708	0.04527399	4009.414	194.8722	0.009412647	23	147.8385	0.03877689	9980.681	406.6667	1.162413E-10	35	577.6053	0.02221171	12247.3	280.4847	5.4926E-17	22	687.7544	0.06793185	2046.627	156.4525	0.3738536	26	109.2025	0.05218133	9352.472	520.3976	2.581859E-10	22	403.1371	0.07144707	10973.5	852.0456	3.735473E-17	30	553.5042	0.04676267	10153.62	503.0089	1.599931E-09	27	404.1244	0.03360052	12903.4	452.1121	1.267894E-10	31	604.4431	0.04878323	7146.376	371.631	5.592385E-06	25	429.0164	0.1284544	11196.42	1664.944	1.505873E-17	18	541.6086	EPHB3	EPHB3_E0_F	33598961	NM_004443.3	EPHB3	2049	3	36.1	185762281	0	Y	AGCGCTGGGGACAGCAGAAGTGAGTACGTGAGCGGCGCAGCAAGATCCCAGCTC	ETK2, HEK2, TYRO6	EPH-like tyrosine kinase-2; human embryo kinase 2; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB3 precursor
EPHB3_P569_R	2160	0.07991962	6474.717	571.0902	5.171889E-07	36	226.5958	0.2022402	11307.15	2891.828	3.353246E-20	28	985.1797	0.2231267	16560.61	4785.113	3.678E-38	24	1225.962	0.09647104	7100.539	768.8115	2.697187E-05	26	321.8173	0.2076346	14713.29	3881.732	3.678E-38	27	724.092	0.2273892	11964.45	3550.72	2.46146E-30	27	999.7766	0.3447885	8966.024	4770.767	4.9037E-16	24	883.3723	0.2004192	14831.16	3742.576	8.020382E-21	27	941.5046	0.2520202	7619.119	2600.837	4.109341E-11	28	901.7177	0.2429524	13266.64	4289.633	1.328795E-33	34	734.8425	EPHB3	EPHB3_P569_R	33598961	NM_004443.3	EPHB3	2049	3	36.1	185761712	-569	Y	ACACAAGCCTCTGTCTTGTCCATTGCGGTAGCACCCGCAGGTACTACAGTCTGACA	ETK2, HEK2, TYRO6	EPH-like tyrosine kinase-2; human embryo kinase 2; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB3 precursor
EPHB4_E476_R	1590	0.02098433	9115.907	197.5347	2.450176E-12	27	335.0344	0.0669779	9760.067	707.8146	7.91129E-11	27	438.4897	0.05117424	13544.67	735.9157	2.320796E-22	32	635.7546	0.03765941	8140.937	322.4937	4.768392E-06	23	235.8613	0.08173741	10317.57	927.3004	1.880443E-13	19	590.9678	0.1094298	10955.89	1358.505	1.135451E-18	35	438.6288	0.1027268	10381.02	1199.949	2.806761E-11	30	547.0195	0.09733485	13837.91	1502.932	4.618831E-14	23	651.1906	0.1391289	8572.757	1401.64	1.437532E-10	29	439.7758	0.06770829	11301.42	828.0352	1.530992E-15	22	514.0385	EPHB4	EPHB4_E476_R	55774978	NM_004444.4	EPHB4	2050	7	36.1	100262603	476	Y	CCGGAGCTCCATGGCGCCGCCTCACTCGGGTAGGATCCGAACTGAGTTT	HTK, MYK1, TYRO11	hepatoma transmembrane kinase; ephrin receptor EphB4; go_component: membrane; go_component: cell surface; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_process: cell proliferation; go_process: organ morphogenesis; go_process: regulation of angiogenesis; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB4 precursor
EPHB4_P313_R	5550	0.273279	470.2741	214.4481	0.7859729	18	24.60282	0.3089339	4469.912	2042.931	0.0002346854	24	324.4037	0.3175441	5319.596	2521.717	1.649814E-06	33	289.9731	0.9399521	429.3675	8286.391	2.185876E-06	33	382.3315	0.3365689	4193.041	2177.926	0.0002045854	36	245.9775	0.352081	4464.863	2480.559	8.169053E-06	31	238.0829	0.3107865	5073.773	2333.006	0.0001093621	25	163.7771	0.2821884	5814.308	2325.051	0.0003833797	31	288.29	0.320589	4952.937	2384.294	1.058674E-05	24	280.3953	0.3499731	4855.136	2667.835	5.994579E-06	34	213.0858	EPHB4	EPHB4_P313_R	55774978	NM_004444.4	EPHB4	2050	7	36.1	100263392	-313	Y	GGACCCCCGGGACAGGCCCGAACCCGGCTGGCACCAGGGAGCAGAGAA	HTK, MYK1, TYRO11	hepatoma transmembrane kinase; ephrin receptor EphB4; go_component: membrane; go_component: cell surface; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_process: cell proliferation; go_process: organ morphogenesis; go_process: regulation of angiogenesis; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB4 precursor
EPHB6_E342_F	2715	0.3883873	3843.895	2504.458	1.010428E-05	26	260.5403	0.07185498	11277.02	880.7844	1.120168E-14	25	697.9163	0.05755202	13938.4	857.2765	4.312854E-24	23	691.2993	0.396268	2913.333	1977.843	0.01854874	27	244.2535	0.05665024	10959.81	664.1661	2.110677E-14	35	519.9856	0.07896457	12077.61	1044.042	2.493077E-21	17	925.2006	0.07485155	11592.57	946.018	2.815403E-13	22	946.1854	0.06003557	14702.15	945.4142	1.216226E-14	38	581.5097	0.1203841	6373.685	885.9874	1.384041E-05	31	304.7185	0.04974845	13672.93	721.0533	3.487188E-22	28	657.9694	EPHB6	EPHB6_E342_F	56119211	NM_004445.2	EPHB6	2051	7	36.1	142263256	342	Y	GGGGGCGCAGACCTGCAGAGACTGCGGCCAACGGGAAGGTGAGCC	HEP	go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: receptor activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB6 precursor
EPHB6_P827_R	1874	0.04359767	8909.496	410.6985	2.348268E-12	26	510.6712	0.1266537	11165.8	1633.779	2.605615E-16	24	944.3239	0.1958994	12732.16	3126.241	7.009198E-28	27	892.0402	0.2085196	410.6898	134.5439	0.7780597	30	14.59049	0.1469445	13697.73	2376.751	2.991278E-28	18	1054.705	0.155219	15008.34	2775.986	3.678E-38	25	1668.485	0.1185398	13901.91	1882.992	2.029441E-21	24	1255.418	0.1321544	20276.1	3102.844	1.524275E-33	34	540.4721	0.1586441	11726.71	2230.017	2.585857E-21	20	1642.551	0.1490935	13464.79	2376.787	4.224378E-27	32	542.061	EPHB6	EPHB6_P827_R	56119211	NM_004445.2	EPHB6	2051	7	36.1	142262087	-827	Y	CTCAACCCTGCCTCCAGGCGCCAGCTGAGAGCACCTTGCACCGCC	HEP	go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: receptor activity; go_function: ephrin receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	ephrin receptor EphB6 precursor
EPHX1_E152_F	2939	0.5942451	1773.651	2744.04	0.004285498	31	119.804	0.7710646	3094.58	10759.49	3.359438E-19	33	700.6974	0.8241497	3102.276	15007.97	6.997494E-37	31	1105.342	0.2940159	4222.787	1800.279	0.002348985	21	187.1705	0.8314998	2005.366	10389.37	1.915923E-16	24	1258.365	0.6700103	4922.575	10197.83	9.825055E-29	24	1236.943	0.8072093	3375.508	14551.85	5.921041E-28	30	897.4406	0.8109834	3610.517	15920.13	4.228604E-23	30	899.045	0.7209165	3241.436	8631.453	3.531141E-15	27	617.5146	0.8519728	2773.138	16536.38	3.678E-38	29	681.6196	EPHX1	EPHX1_E152_F	4557560	NM_000120.2	EPHX1	2052	1	36.1	224079751	152	N	TCCCAAGGAGTAATCAGAGGGTGAGAACGTGGAGCCTGGTGGACAGGT	MEH, EPHX, EPOX	Epoxide hydroxylase 1, microsomal (xenobiotic); go_component: membrane; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: hydrolase activity; go_function: epoxide hydrolase activity; go_function: epoxide hydrolase activity; go_process: response to toxin; go_process: xenobiotic metabolism; go_process: aromatic compound catabolism	epoxide hydrolase 1, microsomal (xenobiotic)
EPHX1_P1358_R	1882	0.3038664	4344.761	1940.164	1.299828E-05	32	288.6982	0.7780711	3781.991	13610.06	9.011278E-31	27	1245.333	0.8266385	4081.289	19937.61	3.678E-38	20	829.5068	0.425774	2447.217	1888.696	0.04266971	34	195.8109	0.8013166	3259.394	13548.88	5.168577E-31	30	1148.63	0.6889603	4847.143	10958.04	1.533565E-31	21	1121.053	0.8130347	3611.999	16141.95	2.945408E-34	36	1480.494	0.7912503	4989.261	19290.47	2.763939E-36	21	805.8037	0.7296623	3218.306	8956.364	5.361056E-16	24	699.5716	0.8599653	2955.78	18765.81	3.678E-38	20	942.0589	EPHX1	EPHX1_P1358_R	4557560	NM_000120.2	EPHX1	2052	1	36.1	224078241	-1358	N	CAGAGTGGTGCCCTCTTGACTGAGCCTCGAGCCTTTGCTTTCCCCTTACTCCA	MEH, EPHX, EPOX	Epoxide hydroxylase 1, microsomal (xenobiotic); go_component: membrane; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: hydrolase activity; go_function: epoxide hydrolase activity; go_function: epoxide hydrolase activity; go_process: response to toxin; go_process: xenobiotic metabolism; go_process: aromatic compound catabolism	epoxide hydrolase 1, microsomal (xenobiotic)
EPHX1_P22_F	2166	0.3704619	3685.892	2227.869	5.337269E-05	22	232.1653	0.9297206	942.7829	13794.91	8.079436E-22	24	1194.75	0.9441782	872.3523	16446.49	1.441562E-33	26	956.829	0.6353001	1722.266	3174.352	0.01838723	28	201.3464	0.9401325	649.4708	11769.35	1.64502E-16	34	574.3546	0.9067297	1211.97	12754.35	2.574441E-24	28	955.9683	0.9410235	744.032	13467.3	3.298238E-17	41	775.1938	0.9332057	1155.143	17536.01	4.280458E-21	23	735.3109	0.9035641	994.2303	10252.48	1.483544E-13	28	505.0174	0.9484838	681.6285	14390.84	2.010251E-24	35	1071.797	EPHX1	EPHX1_P22_F	4557560	NM_000120.2	EPHX1	2052	1	36.1	224079577	-22	N	GCTGTGCAGAGTCCAGGGGAGATAACCACGCTGTGCACACATGAGATTGGCTGACT	MEH, EPHX, EPOX	Epoxide hydroxylase 1, microsomal (xenobiotic); go_component: membrane; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: hydrolase activity; go_function: epoxide hydrolase activity; go_function: epoxide hydrolase activity; go_process: response to toxin; go_process: xenobiotic metabolism; go_process: aromatic compound catabolism	epoxide hydrolase 1, microsomal (xenobiotic)
EPM2A_P113_F	747	0.1143744	1141.979	160.3957	0.5953079	30	53.71317	0.2628522	3534.807	1296.1	0.01177653	37	239.1214	0.2051529	4713.515	1242.386	0.0007222567	30	223.8022	0.2434232	257.8189	115.1257	0.8102057	34	9.292049	0.2642212	3845.96	1417.011	0.003615364	21	201.3428	0.2758213	4188.898	1633.532	0.0003592539	29	208.2556	0.2180825	4243.829	1211.526	0.009130122	21	317.5786	0.2375559	5439.921	1726.082	0.00246145	20	225.9068	0.2545776	3449.273	1212.152	0.01506225	24	214.2573	0.2839171	4618.712	1870.905	0.000165243	34	230.3645	EPM2A	EPM2A_P113_F	66346727	NM_001018041.1	EPM2A	7957	6	36.1	146098797	-113	Y	GAAGATCTTGGACCTGGTCTCTGGAGCGCTCCCTATCTTAACCAAGTCACTTACTC	EPM2, MELF	isoform b is encoded by transcript variant 2; epilepsy, progressive myoclonus type 2, Lafora disease (laforin); go_component: nucleus; go_component: polysome; go_component: endoplasmic reticulum; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine/serine/threonine phosphatase activity; go_process: carbohydrate metabolism; go_process: glycogen metabolism; go_process: regulation of translation; go_process: protein amino acid dephosphorylation	laforin isoform b
EPM2A_P64_R	751	0.03821849	5134.69	208.0119	0.0003826327	28	180.0365	0.05797772	7815.702	487.1799	7.543577E-07	34	340.4377	0.06372125	8371.427	576.5483	1.779975E-08	27	189.0802	0.03821848	5555.503	224.7337	0.003817634	28	268.9071	0.06322516	6705.479	459.3179	1.724016E-05	28	327.6418	0.07103597	7804.933	604.474	1.707379E-08	23	364.9363	0.07057912	7102.47	546.947	5.612591E-05	33	386.2225	0.06326446	7496.87	513.071	0.0004990427	33	354.2604	0.07072959	5881.998	455.308	0.0002568297	24	358.9338	0.0805873	7764.02	689.288	1.820336E-07	26	441.4624	EPM2A	EPM2A_P64_R	66346727	NM_001018041.1	EPM2A	7957	6	36.1	146098748	-64	Y	TCATAAGGAAGGGAATGACCTCTAGACAGCCGCCTTCTAATTGTGAAACGGGG	EPM2, MELF	isoform b is encoded by transcript variant 2; epilepsy, progressive myoclonus type 2, Lafora disease (laforin); go_component: nucleus; go_component: polysome; go_component: endoplasmic reticulum; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine/serine/threonine phosphatase activity; go_process: carbohydrate metabolism; go_process: glycogen metabolism; go_process: regulation of translation; go_process: protein amino acid dephosphorylation	laforin isoform b
EPO_E244_R	4087	0.07460788	1850.932	157.2899	0.3487101	29	76.71604	0.09438083	4758.668	506.3554	0.004901852	36	190.2778	0.06479163	5386.803	380.1281	0.001188013	32	210.511	0.2067322	387.2608	126.9842	0.7840607	29	22.09796	0.06790775	5201.052	386.2091	0.001671787	26	440.0025	0.09895014	5345.649	598.0222	0.0002483333	34	301.1146	0.06735177	5531.271	406.6656	0.003564985	35	205.2146	0.08106218	6082.987	545.4193	0.006090098	25	207.3507	0.08802645	4395.71	433.9396	0.01073946	32	257.8895	0.06941877	4928.311	375.0979	0.003616355	27	275.1156	EPO	EPO_E244_R	62240996	NM_000799.2	EPO	2056	7	36.1	100156603	244	Y	CGCCCGGGTCCCTGTTTGAGCGGGGATTTAGCGCCCCGGCTATTGGCC	EP	epoetin; go_component: extracellular space; go_function: hormone activity; go_function: erythropoietin receptor binding; go_process: development; go_process: circulation; go_process: cell-cell signaling; go_process: erythrocyte maturation; go_process: response to stress; go_process: signal transduction	erythropoietin precursor
EPO_P162_R	2436	0.376383	12774.83	7770.585	3.678E-38	36	887.239	0.1676771	7708.041	1572.983	1.627212E-08	18	350.7357	0.2823017	7591.329	3025.332	4.937212E-12	27	296.6416	0.122256	9179.472	1292.485	4.611977E-09	32	803.7394	0.1688021	7548.905	1553.362	9.309581E-09	29	332.363	0.2243984	7307.648	2143.193	8.934004E-11	22	479.0223	0.2780078	6966.009	2720.813	7.314426E-08	31	398.1075	0.2206695	9090.359	2602.274	3.700559E-08	18	499.0695	0.224014	6309.5	1850.315	4.975122E-07	29	320.0998	0.2161073	7046.451	1970.167	1.732475E-08	25	236.7076	EPO	EPO_P162_R	62240996	NM_000799.2	EPO	2056	7	36.1	100156197	-162	Y	CCTGCCCCTGCTCTGACCCCGGGTGGCCCCTACCCCTGGCGACC	EP	epoetin; go_component: extracellular space; go_function: hormone activity; go_function: erythropoietin receptor binding; go_process: development; go_process: circulation; go_process: cell-cell signaling; go_process: erythrocyte maturation; go_process: response to stress; go_process: signal transduction	erythropoietin precursor
EPS8_E231_F	296	0.3039001	1693.329	782.9232	0.2099597	38	79.87485	0.128556	6593.727	987.4628	9.30417E-06	33	521.7281	0.08747674	8402.633	815.0834	5.293393E-09	32	352.5486	0.2331855	1134.958	375.5462	0.5527336	29	82.92801	0.1093976	6628.468	826.495	6.393194E-06	31	436.8521	0.1201078	8305.642	1147.394	8.828943E-11	28	372.2575	0.1633092	7745.496	1531.32	3.236981E-07	19	540.2776	0.1541624	8050.394	1485.491	1.611176E-05	32	468.9226	0.1467449	5596.19	979.6448	0.0001264664	22	519.3854	0.08074034	9034.995	802.3442	4.084142E-10	37	356.4835	EPS8	EPS8_E231_F	56682952	NM_004447.4	EPS8	2059	12	36.1	15833370	231	Y	CAAGGGGCTCTTACCTCGGATCCGCCCTCGGGGCCACGGCTTTCC	.	go_function: protein binding; go_function: protein binding; go_function: SH3/SH2 adaptor activity; go_process: cell proliferation; go_process: signal transduction; go_process: epidermal growth factor receptor signaling pathway	epidermal growth factor receptor pathway substrate 8
EPS8_P437_F	3878	0.1798487	7524.199	1671.889	5.097539E-12	35	511.2329	0.2798715	7227.74	2847.86	4.992287E-10	20	658.1074	0.2371635	10085.89	3166.763	4.110709E-19	30	723.4847	0.1187498	4952.366	680.814	0.005065296	24	318.1023	0.2501018	7620.039	2574.743	5.222123E-11	24	395.077	0.3850003	6682.386	4245.89	1.497967E-14	33	703.3682	0.2289308	10015.85	3003.4	2.383933E-14	19	688.1696	0.3111856	9199.143	4201.073	1.075471E-10	31	734.4896	0.3217611	6712.693	3231.987	1.668701E-10	30	453.6566	0.2419791	9302.143	3001.398	5.24357E-16	27	288.297	EPS8	EPS8_P437_F	56682952	NM_004447.4	EPS8	2059	12	36.1	15834038	-437	Y	CACCCAGTCTGGCTGCACAGCTCGTAACCCCTGCCCTTTGGCGGCAA	.	go_function: protein binding; go_function: protein binding; go_function: SH3/SH2 adaptor activity; go_process: cell proliferation; go_process: signal transduction; go_process: epidermal growth factor receptor signaling pathway	epidermal growth factor receptor pathway substrate 8
ER_seq_a1_S60_F	6020	0.02786932	6160.88	179.4887	1.04315E-05	21	273.8948	0.1030415	8511.155	989.2394	6.427316E-09	34	531.9751	0.1032667	9472.458	1102.352	6.18619E-12	25	523.6014	0.3295854	4249.961	2138.503	0.001082229	16	140.3657	0.08379411	9006.67	832.8753	3.036071E-10	35	420.3731	0.1068417	9774.911	1181.26	1.253461E-14	27	371.8874	0.111056	9977.52	1258.987	1.325603E-10	40	471.9605	0.0982236	11796.44	1295.788	3.300142E-10	38	547.393	0.1240465	7172.791	1029.922	4.19607E-07	24	445.1154	0.1145739	10189.5	1331.458	5.654114E-14	31	533.3256	ER	ER_seq_a1_S60_F	62821793	NM_000125.2	ESR1	2099	6	36.1	152170860	481	Y	CCCCCTGGAGCGGCCCCTGGGCGAGGTGTACCTGGACAGCAGCAAGCCCG	ER, ESR, Era, ESRA, NR3A1, major ORF, DKFZp686N23123	oestrogen receptor; estrogen receptor 1 (alpha); dJ443C4.1.1 (estrogen receptor 1); steroid hormone receptor; go_component: nucleus; go_component: nucleus; go_component: membrane; go_component: chromatin remodeling complex; go_function: DNA binding; go_function: lipid binding; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: receptor activity; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: estrogen receptor activity; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: nitric-oxide synthase regulator activity; go_process: cell growth; go_process: signal transduction; go_process: signal transduction; go_process: negative regulation of mitosis; go_process: estrogen receptor signaling pathway; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	estrogen receptor 1
ERBB2_P59_R	2442	0.04406733	4074.102	192.421	0.008096782	23	168.0267	0.02658287	11806.85	325.162	1.297047E-14	30	605.545	0.02752374	13988.46	398.7421	1.030452E-22	33	1278.854	0.02420263	6214.602	156.6206	0.001123883	27	267.8539	0.03255167	11845.65	401.9346	4.827667E-16	20	794.0536	0.03082587	12007.36	385.0907	6.403833E-19	33	688.0319	0.02991774	11118.38	345.9796	4.776181E-11	22	704.9109	0.02842695	14717.98	433.5547	1.036918E-13	22	656.3602	0.03970743	9478.876	396.0798	2.362851E-10	21	599.5591	0.03110247	14062.61	454.6322	1.393928E-22	20	1159.981	ERBB2	ERBB2_P59_R	54792097	NM_001005862.1	ERBB2	2064	17	36.1	35097860	-59	Y	AGCTTCCACTTCCGGAGTAACCGGAAGTTCCTGTGTTCTTTATTCTACTCTCC	NEU, NGL, HER2, TKR1, HER-2, c-erb B2, HER-2/neu	isoform b is encoded by transcript variant 2; v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog); tyrosine kinase-type cell surface receptor; herstatin; neuroblastoma/glioblastoma derived oncogene homolog; c-erb B2/neu protein; go_component: membrane; go_component: plasma membrane; go_component: extracellular region; go_component: integral to membrane; go_function: ATP binding; go_function: iron ion binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: electron transporter activity; go_function: protein-tyrosine kinase activity; go_function: ErbB-3 class receptor binding; go_function: protein heterodimerization activity; go_function: epidermal growth factor receptor activity; go_function: epidermal growth factor receptor activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: electron transport; go_process: heart development; go_process: cell proliferation; go_process: mammary gland development; go_process: nervous system development; go_process: regulation of angiogenesis; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: phosphoinositide-mediated signaling; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	erbB-2 isoform b
ERBB3_E331_F	4091	0.07460247	7402.605	604.835	4.648139E-09	39	285.5784	0.1070325	12916.36	1560.161	5.014233E-21	30	1065.238	0.1137451	14205.41	1836.007	1.457066E-28	26	1097.228	0.3038933	3350.525	1506.366	0.01959417	25	324.5918	0.09874433	12991.75	1434.372	1.534906E-22	23	850.1401	0.1472294	10728.26	1869.48	1.392534E-19	26	881.4025	0.1427771	15016.55	2517.78	1.097913E-26	36	870.4002	0.1363627	16856.67	2677.348	4.148864E-23	37	622.4581	0.1694231	9777.492	2014.836	5.787178E-15	19	756.144	0.1031867	14329.3	1660.226	1.240904E-27	15	1131.64	ERBB3	ERBB3_E331_F	54792099	NM_001982.2	ERBB3	2065	12	36.1	54760490	331	Y	GCACCTGGGAGCCGGAACCCAGTGCGCGCAGCCTCGGAGGGTATGGGCA	HER3, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, MGC88033, c-erbB-3, p180-ErbB3, p45-sErbB3, p85-sErbB3	isoform 1 precursor is encoded by transcript variant 1; v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: epidermal growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	erbB-3 isoform 1 precursor
ERBB3_P870_R	2458	0.105043	5261.911	629.3391	5.795138E-05	28	178.6767	0.1964925	9090.42	2247.457	9.964579E-13	31	465.1953	0.1790414	9767.278	2151.937	2.627589E-15	25	557.4108	0.1703491	2000.018	431.1888	0.3187189	31	68.55714	0.1733923	7334.556	1559.5	2.314096E-08	28	417.1889	0.3009231	6990.481	3052.153	3.272426E-12	26	429.1955	0.180472	7920.979	1766.336	7.301013E-08	39	488.1971	0.1674307	9560.019	1942.642	6.698061E-08	27	634.4766	0.1629278	7178.089	1416.608	8.420145E-08	26	433.0718	0.1745539	8863.521	1895.481	3.850714E-12	37	461.8196	ERBB3	ERBB3_P870_R	54792099	NM_001982.2	ERBB3	2065	12	36.1	54759289	-870	Y	GGACGCAGTCTCTAGTGTCCTCTCCGCGTCCCACTTCACTGCCCCAT	HER3, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, MGC88033, c-erbB-3, p180-ErbB3, p45-sErbB3, p85-sErbB3	isoform 1 precursor is encoded by transcript variant 1; v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: epidermal growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	erbB-3 isoform 1 precursor
ERBB4_P255_F	5632	0.04995515	3025.793	164.3601	0.07440107	35	128.6578	0.04837073	9021.713	463.651	6.855189E-09	28	660.6597	0.03488843	9867.499	360.3214	3.855931E-11	28	717.0735	0.2475591	264.1838	119.8194	0.8082325	23	10.69904	0.029457	10090.35	309.2878	1.831188E-11	31	486.8294	0.06118019	9885.735	650.7416	1.732057E-13	27	770.8917	0.04176996	9845.649	433.5383	7.45282E-09	28	980.4462	0.05530243	11982	707.2784	1.367774E-09	22	485.3297	0.0392261	7001.024	289.9178	1.242817E-05	26	490.0258	0.0240603	11135.4	276.9916	1.052785E-13	26	858.6134	ERBB4	ERBB4_P255_F	4885214	NM_005235.1	ERBB4	2066	2	36.1	213111787	-255	Y	CGGACTGTGCAGCTATTTCCCCGCGTGAGCCTTCGCTTGCTCGCTCCCTC	HER4, MGC138404	v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4; avian erythroblastic leukemia viral (v-erb-b2) oncogene homolog 4; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: epidermal growth factor receptor activity; go_process: development; go_process: cell proliferation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	v-erb-a erythroblastic leukemia viral oncogene homolog 4
ERBB4_P541_F	5633	0.1598372	4563.482	887.2064	0.0002686467	26	226.4581	0.08164373	10366.94	930.5325	1.231733E-12	30	611.2672	0.09171674	11335.27	1154.712	7.02948E-17	27	1111.13	0.7861215	426.8997	1936.648	0.3347228	39	84.87473	0.05795277	10183.05	632.5916	2.024562E-12	30	677.4427	0.1377425	12128.29	1953.425	9.693567E-25	23	737.4089	0.05889151	12134.98	765.6252	4.428489E-14	26	871.6519	0.08186413	13894.99	1247.841	1.075933E-13	27	606.3721	0.09343034	8777.304	914.8878	5.800428E-10	29	432.7722	0.0625542	14350.33	964.2462	2.994845E-25	30	1040.396	ERBB4	ERBB4_P541_F	4885214	NM_005235.1	ERBB4	2066	2	36.1	213112073	-541	Y	CCTCACACTTGTCCGGCGGCTGCGGTAATTAAAGCTCCGAGCGTCATTTCC	HER4, MGC138404	v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4; avian erythroblastic leukemia viral (v-erb-b2) oncogene homolog 4; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: epidermal growth factor receptor activity; go_process: development; go_process: cell proliferation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	v-erb-a erythroblastic leukemia viral oncogene homolog 4
ERCC1_P354_F	3893	0.04314074	5176.4	237.8906	0.000302955	36	156.534	0.07224809	9434.875	742.5223	3.119303E-10	20	488.0627	0.06151157	9371.08	620.7653	1.28503E-10	32	820.6511	0.04202567	4275.033	191.9297	0.035423	26	263.5456	0.05901837	8393.093	532.6868	2.017539E-08	30	393.1732	0.07301319	10108.97	804.0996	1.650394E-14	22	518.5466	0.06900035	9096.772	681.6119	5.192754E-08	26	516.9664	0.07489949	10637.57	869.3523	6.610369E-08	32	363.5441	0.1018259	7145.353	821.4052	1.056494E-06	24	469.776	0.09343159	10304	1072.244	1.292981E-13	23	412.6315	ERCC1	ERCC1_P354_F	42544170	NM_001983.2	ERCC1	2067	19	36.1	50619371	-354	Y	TCCTCTCTTCCCGGTCCTGTGCGAGTCCGTGCTGGTGACACAGCAGTGACCA	UV20	isofrom 2 is encoded by transcript variant 2; excision repair protein; go_component: nucleus; go_component: nucleotide-excision repair complex; go_function: hydrolase activity; go_function: damaged DNA binding; go_function: endonuclease activity; go_process: DNA repair; go_process: nucleotide-excision repair	excision repair cross-complementing 1 isofrom 2
ERCC1_P440_R	3881	0.2499855	1742.483	614.1135	0.2420391	31	77.03098	0.3569768	6868.118	3868.377	2.138713E-11	23	674.1754	0.407737	7557.797	5271.926	7.426971E-18	22	605.3206	0.04436123	4095.211	194.7438	0.04547864	25	199.6593	0.3437469	5918.402	3152.453	1.069742E-08	29	402.4373	0.3234718	5473.563	2664.915	5.950525E-08	25	399.8823	0.4052604	6291.4	4355.151	1.66846E-09	39	486.6799	0.4051459	6305.978	4363.012	7.924157E-07	23	429.5251	0.4333339	4319.908	3379.937	2.887214E-06	29	596.3298	0.48059	5899.735	5551.322	8.443431E-14	29	395.1602	ERCC1	ERCC1_P440_R	42544170	NM_001983.2	ERCC1	2067	19	36.1	50619457	-440	Y	GAGCTTACGGTTCAGTAAGGGACACAGACACGTTCCCAGTGCTGACCCAGAATGGG	UV20	isofrom 2 is encoded by transcript variant 2; excision repair protein; go_component: nucleus; go_component: nucleotide-excision repair complex; go_function: hydrolase activity; go_function: damaged DNA binding; go_function: endonuclease activity; go_process: DNA repair; go_process: nucleotide-excision repair	excision repair cross-complementing 1 isofrom 2
ERCC3_P1210_R	3901	0.3348383	2352.673	1234.661	0.03606539	32	116.0476	0.8752118	1990.299	14660.47	4.160062E-28	23	930.7495	0.8958904	1975.661	17861.61	3.678E-38	24	1210.447	0.476037	885.3549	895.226	0.4822278	32	85.27403	0.8683231	1868.973	12984.1	5.926276E-24	31	816.0278	0.8984588	1689.064	15830.05	3.678E-38	34	1198.058	0.8858397	2035.774	16572.78	3.166251E-30	29	771.3295	0.8898772	2145.654	18146.61	5.277676E-25	24	900.1066	0.8766464	1269.596	9733.406	5.966144E-13	28	668.9257	0.8941361	1947.241	17291.18	3.678E-38	34	853.268	ERCC3	ERCC3_P1210_R	4557562	NM_000122.1	ERCC3	2071	2	36.1	127769432	-1210	N	GGGCATTAAAGGTGATTCTGGTGACGGCTCAGATGGAAAGGAGAAATA	XPB, BTF2, GTF2H, RAD25, TFIIH	xeroderma pigmentosum, complementation group B; go_component: nucleus; go_component: nucleus; go_component: transcription factor TFIIH complex; go_function: ATP binding; go_function: DNA binding; go_function: helicase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: protein binding; go_function: damaged DNA binding; go_function: 3' to 5' DNA helicase activity; go_function: ATP-dependent DNA helicase activity; go_process: transcription; go_process: DNA topological change; go_process: induction of apoptosis; go_process: nucleotide-excision repair; go_process: sensory perception of sound; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter; go_process: transcription-coupled nucleotide-excision repair	excision repair cross-complementing rodent repair deficiency, complementation group 3
ERCC6_P698_R	3906	0.05066646	7161.22	387.5354	4.809081E-08	12	343.4881	0.1853889	8841.617	2034.93	1.065162E-11	33	422.6653	0.1867065	9687.599	2246.923	2.390471E-15	30	484.4775	0.1411233	2329.049	399.1206	0.2526891	35	165.2699	0.208312	7921.511	2110.651	1.179502E-10	26	603.434	0.2356838	9032.498	2816.089	3.179913E-17	34	492.2137	0.2077849	8264.276	2193.811	3.623432E-09	30	456.4496	0.2273842	9482.969	2820.31	5.09063E-09	36	433.9554	0.2089336	6150.647	1650.898	1.978098E-06	36	397.8716	0.1898555	9694.687	2295.363	3.565894E-15	31	426.4383	ERCC6	ERCC6_P698_R	4557564	NM_000124.1	ERCC6	2074	10	36.1	50417776	-698	Y	AGAACAATGGGAGGAAGTTGAGCTTCGCCTGGGGAAAGAAGCAGCCCACG	CSB, CKN2, COFS, RAD26	Cockayne syndrome group B protein; Rad26 (yeast) homolog; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: helicase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: DNA helicase activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: DNA repair; go_process: sensory perception of sound; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	excision repair cross-complementing rodent repair deficiency, complementation group 6
ERG_E28_F	312	0.1123654	3781.494	491.357	0.007972511	25	170.076	0.1614958	9465.478	1842.31	1.166959E-12	30	805.7972	0.1450198	12674.72	2166.82	3.001226E-24	28	828.1027	0.1826055	2694.096	624.1998	0.146149	28	157.101	0.1718175	9339.844	1958.421	1.388854E-13	38	939.2756	0.1950358	11423.74	2792.102	3.079864E-25	38	850.7732	0.1495143	11192.05	1985.129	1.034851E-14	25	956.3521	0.1621861	13120.36	2559.23	1.056248E-14	23	883.8422	0.2366766	5859.905	1847.933	2.80328E-06	21	411.547	0.154773	14277.33	2632.692	4.576844E-31	25	665.9034	ERG	ERG_E28_F	46255021	NM_004449.3	ERG	2078	21	36.1	38955460	28	Y	AAAATCCAGCTTACCTGAGCGCCGCTCCTCTTCTCTCATGTCCCTCGG	p55, erg-3	isoform 2 is encoded by transcript variant 2; v-ets avian erythroblastosis virus E26 oncogene related; transcriptional regulator ERG (transforming protein ERG); go_component: nucleus; go_component: nucleus; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: signal transducer activity; go_process: transcription; go_process: development; go_process: cell proliferation; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent	v-ets erythroblastosis virus E26 oncogene like isoform 2
ERG_P46_F	3914	0.08452296	6849.863	641.6578	6.363972E-08	27	307.0499	0.1473391	6496.565	1139.881	7.749336E-06	30	398.6253	0.140547	6773.735	1124.067	1.332136E-06	27	544.0062	0.09451123	2263.038	246.6442	0.3005729	33	103.2874	0.1503524	6307.534	1133.868	6.70363E-06	21	618.5034	0.2417053	7858.39	2536.725	4.084571E-13	31	650.3253	0.1118793	5412.966	694.485	0.002502019	26	175.7515	0.1684125	9763.545	1997.558	2.979843E-08	27	291.4808	0.1752114	5425.881	1173.873	0.0001175822	25	362.8104	0.1296932	10398.89	1564.545	4.185357E-15	35	506.658	ERG	ERG_P46_F	46255021	NM_004449.3	ERG	2078	21	36.1	38955534	-46	Y	TCTCTAGGAACCTGTCCCGCAGCGATCTCTTGCACACTCTCCCCATTC	p55, erg-3	isoform 2 is encoded by transcript variant 2; v-ets avian erythroblastosis virus E26 oncogene related; transcriptional regulator ERG (transforming protein ERG); go_component: nucleus; go_component: nucleus; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: signal transducer activity; go_process: transcription; go_process: development; go_process: cell proliferation; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent	v-ets erythroblastosis virus E26 oncogene like isoform 2
ERN1_P809_R	753	0.1536428	7268.994	1337.725	1.716614E-10	39	265.9753	0.4976919	8710.461	8729.493	6.00103E-31	30	1059.423	0.5422909	10094.76	12078.69	3.678E-38	29	701.0071	0.0379732	6242.566	250.3542	0.0008587111	35	247.8628	0.4419163	9452.813	7564.355	7.981611E-32	27	780.1749	0.4856336	9449.703	9016.253	3.678E-38	24	1060.35	0.5915653	7495.035	11000.43	7.659424E-30	31	827.473	0.5560789	9289.587	11761.89	5.555043E-27	32	793.4075	0.4526378	7504.408	6288.418	8.631493E-21	31	897.671	0.5669717	9301.521	12309.58	3.678E-38	30	738.3268	ERN1	ERN1_P809_R	50346000	NM_001433.2	ERN1	2081	17	36.1	59562017	-809	Y	GGATGTGAAGTTTGAGATGGTCTGCGTCACAACTCGTTGGAGGGAGTG	IRE1, IRE1P, FLJ30999	isoform 1 is encoded by transcript variant 1; ER to nucleus signalling 1; inositol-requiring 1; protein kinase/endoribonuclease; go_component: integral to membrane; go_component: endoplasmic reticulum; go_component: endoplasmic reticulum membrane; go_component: integral to endoplasmic reticulum membrane; go_function: ATP binding; go_function: ATP binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: magnesium ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_function: endoribonuclease activity, producing 5'-phosphomonoesters; go_process: apoptosis; go_process: transcription; go_process: mRNA processing; go_process: cell cycle arrest; go_process: electron transport; go_process: induction of apoptosis; go_process: response to unfolded protein; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent; go_process: unfolded protein response, activation of signaling protein activity	endoplasmic reticulum to nucleus signalling 1 isoform 1
ESR1_E298_R	4092	0.1347013	3531.45	565.3087	0.01212971	35	147.9679	0.1497268	7906.751	1409.93	1.401575E-08	29	423.5676	0.1410613	9473.159	1572.175	4.616495E-13	29	606.1696	0.2331616	3279.94	1027.69	0.0443812	23	176.9442	0.169335	8290.72	1710.488	1.375013E-10	22	682.1502	0.1311615	9390.088	1432.641	2.926034E-14	37	359.1299	0.1464566	8590.996	1491.259	1.620929E-08	27	461.7329	0.1746858	9258.798	1980.88	1.494806E-07	21	298.3413	0.1673802	6958.387	1418.936	2.074744E-07	29	532.3282	0.12983	10023.89	1510.491	5.233318E-14	21	565.032	ESR1	ESR1_E298_R	62821793	NM_000125.2	ESR1	2099	6	36.1	152170677	298	Y	GGCTGTGCTCTTTTTCCAGGTGGCCCGCCGGTTTCTGAGCCTTCTGCCCTGCGG	ER, ESR, Era, ESRA, NR3A1, major ORF, DKFZp686N23123	oestrogen receptor; estrogen receptor 1 (alpha); dJ443C4.1.1 (estrogen receptor 1); steroid hormone receptor; go_component: nucleus; go_component: nucleus; go_component: membrane; go_component: chromatin remodeling complex; go_function: DNA binding; go_function: lipid binding; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: receptor activity; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: estrogen receptor activity; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: nitric-oxide synthase regulator activity; go_process: cell growth; go_process: signal transduction; go_process: signal transduction; go_process: negative regulation of mitosis; go_process: estrogen receptor signaling pathway; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	estrogen receptor 1
ESR1_P151_R	2461	0.03875239	5775.575	236.8719	3.703835E-05	32	205.3466	0.3155639	8402.172	3919.983	4.365317E-15	22	899.2689	0.2841986	9717.501	3897.897	3.154643E-20	36	526.2732	0.0382824	4741.675	192.729	0.01729861	21	178.8323	0.3590248	7139.28	4054.885	2.503668E-13	27	569.9366	0.3585924	7728.557	4376.719	5.16111E-18	24	1369.034	0.2044888	9455.348	2456.234	6.009754E-12	24	853.7783	0.2093343	11016.79	2943.249	1.298017E-11	23	548.8087	0.2752822	6384.243	2463.023	2.851805E-08	24	626.7786	0.2281567	10920.56	3257.676	1.699904E-21	26	547.4847	ESR1	ESR1_P151_R	62821793	NM_000125.2	ESR1	2099	6	36.1	152170228	-151	Y	GGCCCCTGGATCCGTCTTTCGCGTTTATTTTAAGCCCAGTCTTCCCT	ER, ESR, Era, ESRA, NR3A1, major ORF, DKFZp686N23123	oestrogen receptor; estrogen receptor 1 (alpha); dJ443C4.1.1 (estrogen receptor 1); steroid hormone receptor; go_component: nucleus; go_component: nucleus; go_component: membrane; go_component: chromatin remodeling complex; go_function: DNA binding; go_function: lipid binding; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: receptor activity; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: estrogen receptor activity; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: nitric-oxide synthase regulator activity; go_process: cell growth; go_process: signal transduction; go_process: signal transduction; go_process: negative regulation of mitosis; go_process: estrogen receptor signaling pathway; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	estrogen receptor 1
ESR2_E66_F	3262	0.03223662	7321.127	247.201	4.367213E-08	25	321.139	0.05034111	11282.59	603.3872	5.159303E-14	31	575.4269	0.03504465	14875.22	543.861	2.803219E-26	30	661.6912	0.03174796	4919.823	164.5947	0.01350303	30	266.228	0.03899089	12580.09	514.4676	1.991879E-18	32	589.0742	0.06880499	11510.93	857.9193	7.6179E-19	36	633.1825	0.0602222	12894.63	832.7131	5.168917E-16	36	487.2515	0.05816502	14374.06	893.8761	6.315178E-14	34	624.1631	0.06893199	7905.687	592.7042	1.259856E-07	28	505.9334	0.03789826	13696.98	543.4786	1.079465E-21	27	499.8324	ESR2	ESR2_E66_F	10835012	NM_001437.1	ESR2	2100	14	36.1	63830765	66	Y	GGCAGTTATTTCTCGCAGCCTCCGCGCTTGCAACTGCCTCCTGGCGGGGGA	Erb, ESRB, 5p152, NR3A2, ER-BETA, ESR-BETA	estrogen receptor beta; go_component: nucleus; go_function: lipid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: steroid binding; go_function: sequence-specific DNA binding; go_function: estrogen receptor activity; go_function: receptor antagonist activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: negative regulation of cell growth; go_process: estrogen receptor signaling pathway; go_process: regulation of transcription, DNA-dependent	estrogen receptor 2
ESR2_P162_F	756	0.09059668	4458.16	454.0935	0.001437126	29	173.3102	0.03909719	6306.107	260.6516	0.0002022074	28	258.7336	0.03903349	6802.89	280.3885	2.432728E-05	35	211.7452	0.03529646	4271.11	159.9297	0.03730107	31	206.77	0.05006953	5536.751	297.1054	0.0008951026	20	402.5811	0.05259674	6150.238	346.9929	4.079089E-05	27	224.6449	0.07287359	6380.978	509.4151	0.0004146631	32	191.6502	0.04494791	7011.279	334.6803	0.001783103	24	233.3277	0.05577493	5492.522	330.3476	0.001059839	21	236.7835	0.04182293	7587.094	335.5296	1.417765E-06	26	220.1339	ESR2	ESR2_P162_F	10835012	NM_001437.1	ESR2	2100	14	36.1	63830993	-162	Y	AAGTGGGAGCACCCTCGAACCGACTCCTGGTCCACCCACAAGGATA	Erb, ESRB, 5p152, NR3A2, ER-BETA, ESR-BETA	estrogen receptor beta; go_component: nucleus; go_function: lipid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: steroid binding; go_function: sequence-specific DNA binding; go_function: estrogen receptor activity; go_function: receptor antagonist activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: negative regulation of cell growth; go_process: estrogen receptor signaling pathway; go_process: regulation of transcription, DNA-dependent	estrogen receptor 2
ETS1_E253_R	341	0.843706	3435.028	19082.79	3.678E-38	34	1184.887	0.1326859	10378.48	1603.048	3.029493E-14	27	530.1027	0.1296489	13479.4	2022.809	1.407355E-26	22	730.7169	0.8772138	1793.063	13524.5	2.302277E-19	15	1587.524	0.1623077	10407.97	2035.979	1.402603E-16	24	637.3037	0.2102561	10851.94	2915.77	1.354025E-23	30	1077.363	0.1547315	13691.36	2524.591	1.166668E-22	27	1185.096	0.1691639	14205.34	2912.666	1.339057E-17	29	757.7941	0.1838531	8675.154	1976.775	4.162495E-12	28	433.2285	0.1381889	12893.38	2083.45	4.225259E-24	26	674.2673	ETS1	ETS1_E253_R	41393580	NM_005238.2	ETS1	2113	11	36.1	127897118	253	Y	CATGGTGCCAGGAGTGGGGGACGTACGGGATGGTAGCAAGTTTGCAGT	ETS-1, EWSR2, FLJ10768	Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E26 oncogene homolog 1; v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); v-ets avian erythroblastosis virus E2 oncogene homolog 1; ets protein; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: immune response; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: transcription from RNA polymerase II promoter	v-ets erythroblastosis virus E26 oncogene homolog 1
ETS1_P559_R	3923	0.05112779	6570.391	359.4186	8.700926E-07	23	492.108	0.04906185	14220.93	738.861	1.662543E-22	27	1068.515	0.03633668	19187.79	727.2812	3.678E-38	30	954.4624	0.05862061	4445.106	283.0282	0.02397808	28	255.0944	0.04088258	17307.66	742.0052	5.373325E-36	29	731.4009	0.04747434	19313.98	967.6021	3.678E-38	34	966.4443	0.04463188	17432.15	819.0485	5.058886E-29	25	1170.536	0.05106984	19021.1	1029.066	2.169251E-24	23	900.2277	0.06293491	9972.976	676.5184	4.217891E-12	22	832.7836	0.03801879	19701.13	782.5674	3.678E-38	26	846.6378	ETS1	ETS1_P559_R	41393580	NM_005238.2	ETS1	2113	11	36.1	127897930	-559	Y	GGATGAAGGCGAGCGTGCAGGCAGGCGCAGGGGATTCGTGAGCCCGT	ETS-1, EWSR2, FLJ10768	Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E26 oncogene homolog 1; v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); v-ets avian erythroblastosis virus E2 oncogene homolog 1; ets protein; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: immune response; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: transcription from RNA polymerase II promoter	v-ets erythroblastosis virus E26 oncogene homolog 1
ETS2_P684_F	3927	0.07358914	4625.871	375.3979	0.001105485	41	190.2027	0.0491567	10712.51	558.985	1.410998E-12	22	790.5165	0.04313451	14140.91	641.9655	4.771153E-24	29	639.1049	0.6437505	2208.004	4170.614	0.001105841	34	252.2325	0.04354665	10163.64	467.2964	5.448699E-12	30	1139.444	0.04768174	13260.36	668.9414	3.515109E-24	29	980.2962	0.04019127	12790.38	539.7751	4.561229E-15	28	824.5142	0.04581773	13321.21	644.457	1.270094E-11	29	761.8311	0.06290884	8737.038	593.2484	3.23932E-09	39	644.5911	0.04314154	13646.09	619.7653	8.962483E-22	28	458.692	ETS2	ETS2_P684_F	56119171	NM_005239.4	ETS2	2114	21	36.1	39099035	-684	Y	GCTTCCCGGGAGCAGCGCGATCAGCACCACGACTCGGGGACACAGCCAGGGCC	.	v-ets avian erythroblastosis virus E26 oncogene homolog 2; oncogene ETS-2; v-ets avian erythroblastosis virus E2 oncogene homolog 2; go_component: nucleus; go_function: transcription factor activity; go_process: skeletal development; go_process: regulation of transcription, DNA-dependent	v-ets erythroblastosis virus E26 oncogene homolog 2
ETS2_P835_F	3931	0.02287591	14204.06	334.879	2.88766E-31	40	583.8616	0.09925426	16208.58	1797.062	4.498589E-33	33	1536.953	0.09013171	18065.21	1799.448	3.678E-38	24	1412.489	0.0251315	7875.439	205.6018	1.47906E-05	33	425.752	0.1013461	13576.5	1542.373	7.408474E-25	26	1272.693	0.0876087	19766.24	1907.575	3.678E-38	37	1167.412	0.09337883	19913.93	2061.365	3.678E-38	22	1249.364	0.08682362	20306.39	1940.213	2.946636E-30	23	1073.309	0.1011285	11532.62	1308.741	6.868597E-18	35	911.8173	0.1141048	20085.77	2599.962	3.678E-38	30	1008.766	ETS2	ETS2_P835_F	56119171	NM_005239.4	ETS2	2114	21	36.1	39098884	-835	Y	TGTGTAAAGTGGGAGCCGCAAGTCCTCCGAGAGTGACGATGATGTGCGTG	.	v-ets avian erythroblastosis virus E26 oncogene homolog 2; oncogene ETS-2; v-ets avian erythroblastosis virus E2 oncogene homolog 2; go_component: nucleus; go_function: transcription factor activity; go_process: skeletal development; go_process: regulation of transcription, DNA-dependent	v-ets erythroblastosis virus E26 oncogene homolog 2
ETV1_P235_F	3670	0.4163	1128.379	876.0906	0.3499497	27	70.66607	0.1959337	4394.285	1095.161	0.003004942	31	195.9446	0.193503	4411.085	1082.345	0.002356126	39	211.7862	0.4149516	1653.522	1243.704	0.2186001	27	90.185	0.1906751	4282.7	1032.554	0.003204903	30	226.2305	0.2484845	4536.009	1532.871	0.0001679244	29	158.8842	0.1763668	4742.15	1036.863	0.004912878	27	244.5654	0.1879058	4663.821	1102.273	0.021827	26	208.6328	0.2028682	3975.076	1037.097	0.007311134	31	207.4959	0.1249374	5266.933	766.2662	0.0005929624	17	223.4239	ETV1	ETV1_P235_F	64368770	NM_004956.3	ETV1	2115	7	36.1	13995524	-235	N	TTTATTTACACTCTCGATGTTTCCCTGCGCGGTCGGTGTACCCCGGGCAGCTCTGA	ER81, MGC104699, MGC120533, MGC120534, DKFZp781L0674	go_component: nucleus; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	ets variant gene 1
ETV1_P515_F	3941	0.2751665	7781.745	2992.125	1.091941E-16	28	529.6467	0.2841996	10855.09	4349.583	2.821591E-23	27	823.6993	0.256778	13142.51	4575.194	3.229123E-35	22	799.3068	0.7351645	846.9776	2628.742	0.1237706	31	353.9316	0.2165041	10931.94	3048.466	4.097757E-21	26	701.9777	0.278209	10755.37	4184.12	5.13835E-28	24	1162.665	0.2861474	10328.94	4180.435	5.740067E-18	22	785.3066	0.2788608	13366.28	5207.342	8.025298E-21	19	765.5236	0.2536266	9061.786	3113.284	5.347497E-16	28	626.8123	0.2430988	12463.39	4035.066	1.666496E-29	29	458.2263	ETV1	ETV1_P515_F	64368770	NM_004956.3	ETV1	2115	7	36.1	13995804	-515	Y	CACTTCCCCCTTGGAAGCCGAAAGCGCCTCTGACAGAGCTCAATTCG	ER81, MGC104699, MGC120533, MGC120534, DKFZp781L0674	go_component: nucleus; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	ets variant gene 1
ETV6_E430_F	442	0.2904905	1025.326	460.736	0.5307934	33	67.53115	0.254539	3416.867	1200.841	0.01751529	26	186.3771	0.2913862	3328.43	1409.791	0.01257988	31	154.8127	0.2243362	775.5401	253.2223	0.6731137	37	57.66789	0.1483075	9025.438	1589.037	5.945655E-12	22	496.6953	0.2401968	3791.466	1230.21	0.00325352	20	345.9724	0.2551455	3617.678	1273.469	0.02419131	28	188.5292	0.2388087	4478.357	1436.369	0.01778683	36	160.6588	0.2283452	3195.234	975.1131	0.03704878	38	190.2815	0.3154449	2828.066	1349.261	0.03381192	21	141.1449	ETV6	ETV6_E430_F	41872473	NM_001987.3	ETV6	2120	12	36.1	11694485	430	Y	TCTGTTCGCAGGAAATTATTTGGGGCGAGAGGGAAAGAGATGCAGCTCG	TEL	TEL1 oncogene; go_component: nucleus; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	ets variant gene 6
EVI1_E47_R	2960	0.03913665	5805.768	240.5461	3.261825E-05	27	155.2126	0.1199909	8432.775	1163.46	4.249631E-09	23	433.5867	0.09019252	9678.384	969.3667	4.172832E-12	28	485.2557	0.03689229	4472.552	175.1538	0.02711428	37	209.1848	0.1027634	8108.638	940.162	1.178972E-08	25	408.2912	0.1657334	8161.559	1641.221	1.285865E-11	26	422.7583	0.1105055	7723.985	972.0056	2.336952E-06	18	407.2613	0.1033766	8219.43	959.192	3.836535E-05	13	554.9354	0.1068401	6953.556	843.7493	2.009775E-06	30	566.998	0.08803705	9208.192	898.5736	1.098152E-10	28	461.9394	EVI1	EVI1_E47_R	29789001	NM_005241.1	EVI1	2122	3	36.1	170346740	47	Y	GCCAAAGGGTCCGAATGTGACTTTCTCGCGAAGCAGCACACGATGTTGGACAGCA	EVI-1, PRDM3, MDS1-EVI1, AML1-EVI-1	oncogene EVI1; AML1-EVI-1 fusion protein; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_process: development	ecotropic viral integration site 1
EVI1_P30_R	2179	0.2059395	3915.731	1041.48	0.001259699	25	159.2942	0.05189497	9109.888	504.1075	3.933934E-09	24	427.4247	0.06349235	10347.6	708.3152	4.348219E-13	22	267.0518	0.2255097	3904.5	1165.997	0.01382205	31	117.8677	0.06413171	8045.502	558.1821	7.906744E-08	24	394.3755	0.06364793	9593.849	658.933	9.559201E-13	35	348.5748	0.04961064	8330.438	440.0717	1.828958E-06	25	400.4043	0.05822524	9626.973	601.3703	2.680344E-06	30	306.47	0.07667314	7964.984	669.717	7.111009E-08	31	284.6458	0.0370981	10185.55	396.2754	9.799873E-12	30	379.0429	EVI1	EVI1_P30_R	29789001	NM_005241.1	EVI1	2122	3	36.1	170346817	-30	Y	AACTCGGCCGAGAGCGGCTCCAAAGTCGCGTGGCCAGTGCCAGGAATTCAGA	EVI-1, PRDM3, MDS1-EVI1, AML1-EVI-1	oncogene EVI1; AML1-EVI-1 fusion protein; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_process: development	ecotropic viral integration site 1
EVI2A_E420_F	398	0.2159457	3568.218	1010.307	0.003648182	20	87.12404	0.4426229	6288.269	5073.036	8.808575E-13	29	647.6691	0.3944326	6929.709	4578.757	3.156458E-14	30	609.2112	0.03294886	5285.875	183.5047	0.00687151	24	238.4118	0.4711483	6048.075	5477.255	3.758687E-14	15	458.124	0.4799684	5925.996	5561.754	3.801379E-16	40	626.4176	0.4936905	5395.55	5358.581	1.063894E-09	20	920.0762	0.6341406	5543.858	9782.442	4.916883E-14	33	558.0525	0.359769	6007.983	3432.297	1.936314E-09	28	438.6487	0.3807434	8288.752	5157.737	3.000716E-19	28	733.3023	EVI2A	EVI2A_E420_F	51511748	NM_001003927.1	EVI2A	2123	17	36.1	26672423	420	N	AGGAAACCAAACTTAGATCCTTCGTAATCCTAATTTAAAACTCCATGGCGATGG	EVDA, EVI2	isoform 1 is encoded by transcript variant 1; go_component: integral to membrane; go_function: transmembrane receptor activity	ecotropic viral integration site 2A isoform 1
EVI2A_P94_R	3965	0.0455285	4175.5	203.9423	0.00611716	31	208.4524	0.1448638	9705.719	1661.132	8.554787E-13	35	527.339	0.1306619	9273.402	1408.827	3.460409E-12	33	382.5972	0.04399886	5057.536	237.3697	0.009399807	37	192.6338	0.1691051	7385.35	1523.431	2.17154E-08	22	597.923	0.1705672	8226.5	1712.288	5.946168E-12	33	467.9727	0.1802212	8858.63	1969.476	7.783825E-10	22	587.376	0.2226156	8797.532	2547.941	1.085072E-07	37	384.0276	0.1656602	7852.418	1578.972	2.019087E-09	24	305.9213	0.1565519	9309.87	1746.561	7.710265E-13	27	519.0655	EVI2A	EVI2A_P94_R	51511748	NM_001003927.1	EVI2A	2123	17	36.1	26672937	-94	N	CATGACAGGAGGCTTTGTAGAACCAATCCCCGCCTCCAGAGCAGGGAGGGTTTT	EVDA, EVI2	isoform 1 is encoded by transcript variant 1; go_component: integral to membrane; go_function: transmembrane receptor activity	ecotropic viral integration site 2A isoform 1
EXT1_E197_F	1324	0.1087126	9847.042	1213.267	1.257774E-17	31	360.6234	0.1258066	8428.443	1227.342	3.278373E-09	26	579.2588	0.1294296	9947.719	1493.816	4.688154E-14	35	508.3724	0.09846801	6240.227	692.4985	0.0003089621	27	228.0523	0.1558451	9361.272	1746.709	4.058845E-13	18	489.7389	0.1761163	9109.878	1968.737	5.697969E-15	39	484.2457	0.1965882	9467.582	2341.107	9.761192E-12	27	523.3093	0.2214166	10323.45	2964.261	1.625454E-10	23	701.852	0.1809527	8650.114	1933.169	6.033874E-12	21	483.5154	0.1880012	9579.423	2241.067	9.824153E-15	27	499.2542	EXT1	EXT1_E197_F	46370065	NM_000127.2	EXT1	2131	8	36.1	119193042	197	Y	ATCTCTCTTTATTCCCTTCTGCAGCGGCTCCAAGACTCCGGCGGTGTTTACTC	EXT	go_component: membrane; go_component: Golgi stack; go_component: integral to membrane; go_component: endoplasmic reticulum membrane; go_component: integral to endoplasmic reticulum membrane; go_function: transferase activity, transferring glycosyl groups; go_function: N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity; go_function: glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity; go_process: cell cycle; go_process: signal transduction; go_process: skeletal development; go_process: glycosaminoglycan biosynthesis; go_process: heparan sulfate proteoglycan biosynthesis; go_process: negative regulation of progression through cell cycle	exostosin 1
EYA4_E277_F	3279	0.1471873	1753.221	319.8483	0.3275503	35	47.77094	0.2257068	6095.103	1805.876	3.159505E-06	28	303.5841	0.2468179	6361.504	2117.436	1.324553E-07	27	177.5036	0.656626	516.355	1178.641	0.5046152	39	60.71501	0.2798501	5636.543	2229.219	1.447618E-06	31	205.7906	0.4067025	5331.725	3723.42	7.156971E-10	21	437.4968	0.2723071	6119.487	2327.37	5.207559E-06	35	325.0084	0.2572666	6386.8	2246.886	0.000133645	23	270.1327	0.3378489	5128.131	2667.546	2.022073E-06	25	365.1331	0.2613201	6350.616	2282.011	8.77813E-08	26	290.1288	EYA4	EYA4_E277_F	26667248	NM_004100.2	EYA4	2070	6	36.1	133604483	277	Y	GAGGCACAGCGCGAAGGGGAAACTTCGACACTGGAAGGAACGAGAATAAA	CMD1J, DFNA10	isoform a is encoded by transcript variant 1; deafness, autosomal dominant 10; dJ78N10.1 (eyes absent (Drosophila) homolog 4); go_component: nucleus; go_function: hydrolase activity; go_function: magnesium ion binding; go_function: protein tyrosine phosphatase activity; go_process: metabolism; go_process: transcription; go_process: morphogenesis; go_process: visual perception; go_process: sensory perception of sound; go_process: regulation of transcription, DNA-dependent	eyes absent 4 isoform a
EYA4_P508_F	758	0.5762604	3709.102	5180.149	3.289897E-11	21	360.2787	0.1086792	9888.751	1217.934	3.312855E-12	19	439.3443	0.09027267	11671.82	1168.123	6.934184E-18	26	526.894	0.2902605	4608.164	1925.487	0.0007837083	30	321.3107	0.1482079	10000.92	1757.515	9.525578E-15	29	432.1326	0.1323742	10738.74	1653.672	6.405873E-19	35	547.9505	0.1046247	11219.93	1322.734	2.758292E-13	23	686.0098	0.12062	11268.9	1559.413	8.423037E-10	30	459.8593	0.1554501	9070.369	1687.923	2.328718E-12	26	622.4589	0.09919009	11652.13	1294.052	8.640951E-18	27	618.3437	EYA4	EYA4_P508_F	26667248	NM_004100.2	EYA4	2070	6	36.1	133603698	-508	Y	AAAGGAGTCCGGCAGGGGGCCCGCAGTGGCCTGCACAGGGGAACT	CMD1J, DFNA10	isoform a is encoded by transcript variant 1; deafness, autosomal dominant 10; dJ78N10.1 (eyes absent (Drosophila) homolog 4); go_component: nucleus; go_function: hydrolase activity; go_function: magnesium ion binding; go_function: protein tyrosine phosphatase activity; go_process: metabolism; go_process: transcription; go_process: morphogenesis; go_process: visual perception; go_process: sensory perception of sound; go_process: regulation of transcription, DNA-dependent	eyes absent 4 isoform a
EYA4_P794_F	759	0.05072199	6238.369	338.6728	3.972512E-06	31	304.295	0.1769385	9824.613	2133.554	3.452083E-14	32	780.5783	0.1316158	12314.54	1881.598	4.393745E-22	48	598.9522	0.03597534	4278.854	163.4095	0.03670573	37	156.3801	0.1539071	11094.6	2036.335	1.558885E-18	36	532.6258	0.2976831	10415.78	4457.205	9.386091E-28	32	745.1658	0.1261874	12762.75	1857.511	2.963858E-18	36	848.3739	0.1663147	13171.04	2647.484	5.706923E-15	31	688.5767	0.1411199	8408.985	1398.085	3.306042E-10	34	584.2127	0.1183158	13124.01	1774.57	7.728447E-24	28	838.8685	EYA4	EYA4_P794_F	26667248	NM_004100.2	EYA4	2070	6	36.1	133603412	-794	Y	TCAGCAATGTGCCTAGAGAAGCTCTGACGCCGCCTTGGAAGTAAGTCGTTGCTG	CMD1J, DFNA10	isoform a is encoded by transcript variant 1; deafness, autosomal dominant 10; dJ78N10.1 (eyes absent (Drosophila) homolog 4); go_component: nucleus; go_function: hydrolase activity; go_function: magnesium ion binding; go_function: protein tyrosine phosphatase activity; go_process: metabolism; go_process: transcription; go_process: morphogenesis; go_process: visual perception; go_process: sensory perception of sound; go_process: regulation of transcription, DNA-dependent	eyes absent 4 isoform a
F2R_P839_F	764	0.3771796	5439.104	3354.477	5.796472E-11	22	625.0938	0.4098286	9237.605	6484.249	6.00046E-25	21	957.5441	0.3333285	10941.73	5520.746	3.63773E-30	27	665.6868	0.1278366	6572.626	978.0349	6.436896E-05	30	279.193	0.2890042	9567.618	3929.674	1.265489E-19	37	471.3385	0.3527864	9911.229	5456.971	9.831679E-30	37	536.0422	0.2874904	10337.88	4211.579	4.523091E-18	26	1143.392	0.3850238	10811.44	6831.422	9.96961E-19	32	686.3153	0.3758468	7272.346	4439.411	9.448471E-15	28	785.5823	0.3135838	12025.41	5539.399	1.228045E-33	20	1076.263	F2R	F2R_P839_F	6031164	NM_001992.2	F2R	2149	5	36.1	76046703	-839	Y	CCAGGTAATCCGGAGGCTGGGGCGAAAGGGTGGCCTGAGCCAGG	TR, HTR, CF2R, PAR1	thrombin receptor; protease-activated receptor 1; go_component: Golgi apparatus; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: receptor binding; go_function: thrombin receptor activity; go_function: rhodopsin-like receptor activity; go_process: apoptosis; go_process: cell motility; go_process: morphogenesis; go_process: blood coagulation; go_process: caspase activation; go_process: signal transduction; go_process: response to wounding; go_process: STAT protein nuclear translocation; go_process: tyrosine phosphorylation of STAT protein; go_process: regulation of progression through cell cycle; go_process: G-protein coupled receptor protein signaling pathway; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	coagulation factor II receptor precursor
F2R_P88_F	775	0.08252138	2963.662	275.5569	0.0684321	22	125.9808	0.2171257	6164.469	1737.415	3.149626E-06	36	347.1129	0.2119392	6519.233	1780.161	2.760136E-07	29	395.4716	0.05033821	5457.919	294.6056	0.004029213	34	196.9575	0.2229842	6211.306	1811.188	8.01049E-07	44	283.6563	0.2201964	6983.688	2000.251	1.029303E-09	20	224.0248	0.2479745	6248.327	2093.311	7.243718E-06	24	408.0754	0.2409353	7163.236	2305.429	1.90256E-05	25	278.8688	0.1920621	6272.908	1514.961	2.082027E-06	35	511.0409	0.24031	7049.841	2261.683	4.708605E-09	35	271.2815	F2R	F2R_P88_F	6031164	NM_001992.2	F2R	2149	5	36.1	76047454	-88	Y	TGTGAGTCACTGACAGCTTCGCGAATCAACGGTGCCCAGAGGAAAAAACTTCT	TR, HTR, CF2R, PAR1	thrombin receptor; protease-activated receptor 1; go_component: Golgi apparatus; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: receptor binding; go_function: thrombin receptor activity; go_function: rhodopsin-like receptor activity; go_process: apoptosis; go_process: cell motility; go_process: morphogenesis; go_process: blood coagulation; go_process: caspase activation; go_process: signal transduction; go_process: response to wounding; go_process: STAT protein nuclear translocation; go_process: tyrosine phosphorylation of STAT protein; go_process: regulation of progression through cell cycle; go_process: G-protein coupled receptor protein signaling pathway; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	coagulation factor II receptor precursor
FABP3_E113_F	3283	0.08156804	1802.833	168.9949	0.3608002	25	93.81584	0.2551182	5387.074	1879.295	2.55928E-05	35	384.0939	0.2445295	6457.97	2122.673	8.665977E-08	26	442.2456	0.07179599	1652.009	135.5168	0.4804127	22	169.36	0.209099	5481.372	1475.607	3.408156E-05	31	365.3044	0.3177678	5515.145	2615.403	6.167485E-08	32	421.4052	0.2809126	5895.627	2342.201	9.982755E-06	20	252.246	0.2549177	6812.323	2364.938	3.848948E-05	26	396.8763	0.2687801	3912.422	1474.876	0.003131043	32	388.6582	0.2214202	7056.701	2035.293	1.247643E-08	31	409.782	FABP3	FABP3_E113_F	62865867	NM_004102.3	FABP3	2170	1	36.1	31618397	113	Y	CTCACCGAGTGACTTCATGTAGTCATCGAAATTCTTGCTGTCCACTAGCTTCCAGGT	MDGI, FABP11, H-FABP, O-FABP	mammary-derived growth inhibitor; Fatty acid-binding protein 3, muscle; fatty acid binding protein 11; go_component: cytoplasm; go_component: soluble fraction; go_function: fatty acid binding; go_function: lipid transporter activity; go_process: transport; go_process: negative regulation of cell proliferation	fatty acid binding protein 3
FABP3_P598_F	778	0.4094259	3765.43	2679.777	6.837719E-06	29	201.0122	0.2423579	9767.907	3156.59	1.221685E-16	27	826.6375	0.2394032	11970.57	3799.298	1.487823E-27	24	919.317	0.1838997	4374.253	1008.226	0.008043925	31	289.3887	0.2637041	9329.19	3377.061	2.598994E-17	31	760.47	0.3037338	9267.119	4086.24	3.966639E-22	29	892.6081	0.2600368	9917.061	3520.181	2.554095E-15	29	618.9166	0.2519898	12375.86	4202.869	1.763342E-16	38	553.8444	0.2709574	7012.485	2643.439	6.915675E-10	23	920.8152	0.2063459	12665.59	3318.988	1.293073E-27	33	645.3481	FABP3	FABP3_P598_F	62865867	NM_004102.3	FABP3	2170	1	36.1	31619108	-598	Y	CCCTTCACTCTCACTGCCTGGTGGCGGAGACAGTCACCAGCGGCTCGGTCT	MDGI, FABP11, H-FABP, O-FABP	mammary-derived growth inhibitor; Fatty acid-binding protein 3, muscle; fatty acid binding protein 11; go_component: cytoplasm; go_component: soluble fraction; go_function: fatty acid binding; go_function: lipid transporter activity; go_process: transport; go_process: negative regulation of cell proliferation	fatty acid binding protein 3
FANCA_P1006_R	3977	0.3735006	1015.313	664.917	0.4617419	22	100.711	0.8186775	1121.523	5515.219	0.0001662933	33	481.204	0.8378856	1387.461	7687.915	1.00919E-08	28	452.0014	0.5882701	602.4163	1003.596	0.5278755	18	120.4605	0.7864786	1252.821	4982.94	0.0003011104	30	507.2	0.7579166	1677.742	5565.769	2.607002E-06	29	262.9294	0.8288261	1411.007	7316.312	2.108788E-06	27	229.898	0.8279189	1698.301	8652.011	1.924501E-06	41	320.5677	0.7871757	1309.569	5213.589	0.0001482992	32	420.2117	0.8107784	1329.91	6126.89	7.545694E-06	26	309.5367	FANCA	FANCA_P1006_R	66879665	NM_001018112.1	FANCA	2175	16	36.1	88411572	-1006	Y	CCTCTGGCAGTGGCCTTGGAACCACCGAAGGGATTCAGCCGAAGGGC	FA, FA1, FAA, FAH, FA-H, FACA, FANCH, MGC75158	isoform b is encoded by transcript variant 2; Fanconi anemia, complementation group H; Fanconi anemia, type 1; go_component: nucleus; go_component: cytoplasm; go_function: protein binding; go_process: DNA repair; go_process: protein complex assembly	Fanconi anemia, complementation group A isoform b
FANCE_P356_R	4848	0.1014514	8335.038	952.3651	2.88533E-12	20	449.2922	0.1425398	11713.46	1963.81	1.068105E-18	28	613.5481	0.09566853	15924.65	1695.236	8.269747E-35	31	917.9624	0.02852107	7811.768	232.2769	1.644989E-05	20	214.1489	0.1213092	12711.27	1768.682	1.024306E-22	23	865.3347	0.127641	12108.24	1786.273	4.706316E-24	30	852.6697	0.1163916	13812.2	1832.557	5.041922E-21	24	886.8386	0.1339975	15632.06	2434.238	1.150249E-19	32	879.1848	0.1492653	10016.43	1774.975	5.819877E-15	22	790.5869	0.1379269	14811.25	2385.717	3.523604E-32	18	459.218	FANCE	FANCE_P356_R	66879667	NM_021922.2	FANCE	2178	6	36.1	35527760	-356	Y	CATGACAAGCAACATGCCGTCAGCGTAAATACAGCGCGGGTCCTCTAGCACA	FAE, FACE	go_component: nucleus; go_function: protein binding; go_process: DNA repair	Fanconi anemia, complementation group E
FANCF_P13_F	791	0.04365872	7300.414	337.8423	3.08748E-08	33	263.3329	0.07102937	12129.2	935.0478	5.184577E-17	39	650.1218	0.07308194	14748.72	1170.732	4.15992E-28	33	794.8875	0.02700398	7991.793	224.5751	9.976873E-06	35	392.8116	0.05271749	12563.31	704.7293	6.146793E-19	32	702.4908	0.05497194	15064.78	882.1299	3.868926E-32	40	451.4362	0.06681958	13125.67	947.0128	7.335861E-17	29	511.1623	0.05737975	14251.83	873.6332	1.158067E-13	32	565.8611	0.07296491	9741.269	774.5848	8.665608E-12	29	535.233	0.0511108	15808.72	856.9046	3.915492E-30	25	697.637	FANCF	FANCF_P13_F	42716285	NM_022725.2	FANCF	2188	11	36.1	22603976	-13	Y	CCGCTTTCACCTTGGAGACGGCGACTCTCTGCGTACTGATTGGAACATCCGCG	FAF	go_component: nucleus; go_function: protein binding; go_process: DNA repair	Fanconi anemia, complementation group F
FANCG_E207_R	1330	0.4129876	1288.124	976.6028	0.2683677	35	86.35116	0.05979341	6120.584	395.6044	0.0002325361	36	262.1152	0.04117559	7671.83	333.7521	8.812273E-07	35	367.1731	0.4310423	1333.539	1086.049	0.3214442	31	74.76892	0.0701277	5336.723	410.0185	0.001120373	20	354.8405	0.05255827	7259.503	408.2602	4.64003E-07	16	426.2788	0.05389758	6152.208	356.1759	0.001030575	29	256.1884	0.04427857	6830.986	321.1125	0.00252252	32	249.124	0.06705929	5653.571	413.5637	0.0005509141	20	351.114	0.05476266	8390.134	491.8789	3.088995E-08	24	528.744	FANCG	FANCG_E207_R	4759335	NM_004629.1	FANCG	2189	9	36.1	35069806	207	Y	TGAAGAGTTAGTTCCCGCGGGAAACTCGGGGAGGAAACGAGTCAGCAACC	FAG, XRCC9	DNA repair protein XRCC9; X-ray repair, complementing defective, in Chinese hamster, 9; X-ray repair complementing defective repair in Chinese hamster cells 9; go_component: nucleus; go_function: binding; go_function: damaged DNA binding; go_process: DNA repair; go_process: cell cycle checkpoint	Fanconi anemia, complementation group G
FAS_P322_R	4870	0.1223864	3463.911	497.0005	0.01651403	42	156.4273	0.2863997	5514.654	2253.411	4.981436E-06	31	258.4778	0.2866735	6437.338	2627.242	1.059295E-08	24	491.6148	0.06701532	3574.009	263.9002	0.08167563	33	146.6779	0.190896	6447.863	1544.87	8.972677E-07	26	375.4396	0.2481925	6290.946	2109.829	1.777999E-08	31	348.8567	0.2398346	6271.18	2010.127	8.733058E-06	22	274.9243	0.3046035	6582.397	2927.08	1.720194E-05	24	426.0096	0.34279	5038.08	2679.938	2.699755E-06	25	384.9598	0.361754	5552.499	3203.802	5.25249E-08	42	301.0487	FAS	FAS_P322_R	23510419	NM_000043.3	FAS	355	10	36.1	90739946	-322	N	CATATGGTTAACTGTCCATTCCAGAAACGTCTGTGAGCCTCTCATGTTGCAGCCACAAC	APT1, CD95, FAS1, APO-1, FASTM, ALPS1A, TNFRSF6, Apo-1 Fas	isoform 1 precursor is encoded by transcript variant 1; tumor necrosis factor receptor superfamily, member 6; apoptosis antigen 1; Fas antigen; APO-1 cell surface antigen; CD95 antigen; go_component: membrane; go_component: cytosol; go_component: integral to membrane; go_component: soluble fraction; go_function: identical protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: immune response; go_process: anti-apoptosis; go_process: signal transduction; go_process: signal transduction; go_process: induction of apoptosis; go_process: regulation of apoptosis; go_process: protein complex assembly	tumor necrosis factor receptor superfamily, member 6 isoform 1 precursor
FAS_P65_F	4863	0.04296172	6609.13	301.1747	9.486627E-07	39	167.2547	0.2212467	8585.702	2467.64	4.353587E-12	20	583.04	0.2360459	9858.018	3076.82	3.653895E-18	34	469.2948	0.2042587	781.7198	226.3285	0.6779999	40	43.99378	0.2090507	8473.609	2266.035	3.049788E-12	32	753.3597	0.2155074	10831.88	3003.09	7.740249E-24	32	672.2651	0.2198896	8770.246	2500.254	1.140062E-10	27	747.8453	0.2251711	11686.49	3425.242	1.22737E-13	33	429.7972	0.2306788	8660.669	2626.863	1.171034E-13	30	513.5186	0.2437766	10844.41	3528.045	4.089449E-22	32	340.3327	FAS	FAS_P65_F	23510419	NM_000043.3	FAS	355	10	36.1	90740203	-65	Y	GTGAGCATGCCAGCCACTGCAGGAACGCCCCGGGACAGGAATGCCCATTTGTG	APT1, CD95, FAS1, APO-1, FASTM, ALPS1A, TNFRSF6, Apo-1 Fas	isoform 1 precursor is encoded by transcript variant 1; tumor necrosis factor receptor superfamily, member 6; apoptosis antigen 1; Fas antigen; APO-1 cell surface antigen; CD95 antigen; go_component: membrane; go_component: cytosol; go_component: integral to membrane; go_component: soluble fraction; go_function: identical protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: immune response; go_process: anti-apoptosis; go_process: signal transduction; go_process: signal transduction; go_process: induction of apoptosis; go_process: regulation of apoptosis; go_process: protein complex assembly	tumor necrosis factor receptor superfamily, member 6 isoform 1 precursor
FASLG_P687_F	5572	0.06684574	5200.205	379.6758	0.0001739506	35	157.6797	0.9314607	1074.459	15961.1	1.786357E-29	32	885.2708	0.7963099	3154.837	12724.52	5.861337E-28	30	648.3987	0.1559114	699.5494	147.6846	0.7148417	23	63.73203	0.05728277	7692.397	473.4931	4.605224E-07	21	599.1367	0.04579469	9914.163	480.6046	4.093133E-13	20	641.1236	0.05024334	8563.604	458.3158	7.853275E-07	36	543.4534	0.8130983	3048.629	13697.82	7.988392E-17	32	623.3073	0.07276574	7783.459	618.6632	1.874529E-07	38	432.0559	0.04088929	10704.24	460.6119	4.23645E-13	24	466.8961	FASLG	FASLG_P687_F	4557328	NM_000639.1	FASLG	356	1	36.1	170894121	-687	N	CTGGGCAAACAATGAAAATGAAAACATTGCGAAATACAAAGCAGCTCTGTGGGTTC	FASL, CD178, CD95L, TNFSF6, APT1LG1	CD95 ligand; apoptosis (APO-1) antigen ligand 1; tumor necrosis factor (ligand) superfamily, member 6; go_component: membrane; go_component: extracellular space; go_component: integral to plasma membrane; go_function: tumor necrosis factor receptor binding; go_process: apoptosis; go_process: immune response; go_process: cell-cell signaling; go_process: signal transduction; go_process: induction of apoptosis; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	fas ligand
FASTK_P257_F	4872	0.1533768	3660.678	681.2959	0.006720434	33	144.445	0.1101074	7682.183	962.8981	2.085826E-07	25	345.1619	0.103961	9168.474	1075.355	3.549339E-11	28	492.8004	0.03066725	5991.15	192.7087	0.001681228	31	234.7355	0.1528408	7156.44	1309.175	1.394547E-07	26	374.5171	0.1379615	7626.796	1236.604	1.889507E-09	23	411.6752	0.1664698	7566.599	1531.147	6.051778E-07	38	298.5938	0.1565741	9470.71	1776.713	1.460333E-07	26	324.8759	0.128166	6694.77	998.8808	2.953909E-06	29	370.9462	0.1577546	7634.284	1448.65	1.298074E-08	30	270.3226	FASTK	FASTK_P257_F	39995106	NM_033015.2	FASTK	10922	7	36.1	150409141	-257	Y	ACAGTTACTTTAATCTGCACGGGTTCCGGGGAACTCCTCTGCCCCTCCC	FAST	isoform 4 is encoded by transcript variant 4; FAST kinase; go_function: ATP binding; go_function: kinase activity; go_function: transferase activity; go_function: protein kinase activity; go_function: protein serine/threonine kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	Fas-activated serine/threonine kinase isoform 4
FASTK_P598_R	4874	0.6453952	2346.806	4453.287	1.537754E-06	26	292.0229	0.9316277	882.2818	13384.38	2.117526E-20	22	1171.748	0.9510968	971.5087	20839.33	3.678E-38	29	1049.691	0.8048291	734.774	3442.369	0.05300608	20	141.8255	0.9161893	1272.225	15000.68	5.52419E-29	24	963.7381	0.8891416	1829.25	15473.57	3.687609E-38	26	907.9918	0.9027802	1753.845	17214.75	1.82768E-31	30	840.6904	0.9211696	1918.537	23587.53	3.678E-38	23	809.096	0.8949156	1390.377	12692.29	1.013016E-21	28	899.5161	0.9214766	889.8458	11615.9	1.477983E-16	27	404.8701	FASTK	FASTK_P598_R	39995106	NM_033015.2	FASTK	10922	7	36.1	150409482	-598	Y	GGGAAGAGGCAGGCCGGAGAGGCGGGCCTGGGCAGGCAGCAGCTCC	FAST	isoform 4 is encoded by transcript variant 4; FAST kinase; go_function: ATP binding; go_function: kinase activity; go_function: transferase activity; go_function: protein kinase activity; go_function: protein serine/threonine kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: induction of apoptosis by extracellular signals	Fas-activated serine/threonine kinase isoform 4
FAT_P279_R	3988	0.1924603	3381.767	829.8069	0.009249467	23	135.4465	0.182028	7978.861	1797.835	1.924708E-09	33	453.1032	0.1988511	9039.666	2268.533	1.022836E-13	22	419.8835	0.04609102	6199.539	304.3814	0.0008378304	31	223.3351	0.1469093	7904.055	1378.365	4.150649E-09	29	574.1791	0.3378082	7026.127	3635.298	8.024092E-14	32	636.701	0.1794881	9169.379	2027.689	1.577974E-10	25	322.9198	0.2136815	9237.965	2537.586	2.846176E-08	23	562.8812	0.2812794	6725.996	2671.43	2.368177E-09	24	345.1748	0.1326807	10050.78	1552.844	3.506008E-14	22	534.1188	FAT	FAT_P279_R	75813622	NM_005245.3	FAT	2195	4	36.1	187882260	-279	Y	AGGCTTGTGATGCCGAGGTTAGTTACGGCCAGCCACAGGCGCTGTGCAAGGA	ME5, FAT1, CDHF7, hFat1	cadherin ME5; cadherin-related tumor suppressor; cadherin family member 7; go_component: membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: morphogenesis; go_process: cell-cell signaling; go_process: homophilic cell adhesion	FAT tumor suppressor 1 precursor
FAT_P973_R	4000	0.0337159	5340.175	189.8203	0.0002060418	27	236.1652	0.2669751	6446.129	2384.166	1.014087E-07	31	381.5622	0.2291301	7891.837	2375.459	3.142513E-11	22	464.1497	0.06935069	2365.132	183.6982	0.2916985	22	106.7007	0.1871494	7338.206	1712.561	1.168809E-08	26	374.1088	0.3196232	6637.863	3165.272	1.283302E-11	24	716.4685	0.2241955	7413.653	2171.329	1.06591E-07	23	390.1862	0.2392409	8536.845	2716.084	1.436291E-07	23	522.5444	0.1879632	6297.692	1480.882	2.155616E-06	26	381.7473	0.2089344	7802.794	2087.267	3.168723E-10	20	465.8994	FAT	FAT_P973_R	75813622	NM_005245.3	FAT	2195	4	36.1	187882954	-973	Y	GGACAAGAGGGCGGACTTGATCTCGGAAAGTTTGTGGGACTCAGG	ME5, FAT1, CDHF7, hFat1	cadherin ME5; cadherin-related tumor suppressor; cadherin family member 7; go_component: membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion; go_process: morphogenesis; go_process: cell-cell signaling; go_process: homophilic cell adhesion	FAT tumor suppressor 1 precursor
FER_E119_F	581	0.1092736	5181.312	647.907	7.256057E-05	29	194.7838	0.07360615	9425.407	756.8364	3.049828E-10	27	551.5778	0.07242148	10168.03	801.685	7.068127E-13	29	454.1311	0.04453925	4545.847	216.5683	0.02273717	22	373.7671	0.07777654	9944.23	847.0892	2.309046E-12	25	403.787	0.07625129	9157.941	764.2013	6.539116E-12	17	698.7108	0.06785215	10925.95	802.5921	1.419447E-11	28	623.7107	0.09121113	10934.74	1107.508	1.20571E-08	22	622.9271	0.06646114	8563.296	616.7633	6.466399E-09	22	752.422	0.08134349	11416.54	1019.745	2.289478E-16	24	440.4899	FER	FER_E119_F	4885230	NM_005246.1	FER	2241	5	36.1	108111541	119	N	CTTTTGGTGAAGGACGCTTCAGAAACGGCCATCACTGAAGAGCAGACCCGTTTG	TYK3	go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94)
FER_P581_F	3706	0.9020134	502.152	5543.094	3.27496E-05	24	243.5544	0.9685879	491.3877	18235.39	6.859621E-36	32	1466.297	0.9754473	515.2758	24444.12	3.678E-38	24	1351.798	0.7698095	1654.293	5866.755	6.96407E-05	30	323.5338	0.968033	521.779	18828.85	3.678E-38	26	1327.358	0.9702745	510.7113	19934.31	3.678E-38	26	1531.437	0.9652955	622.5513	20097.56	7.283051E-38	31	1202.338	0.9710042	648.4413	25063.66	3.678E-38	21	1404.32	0.9496972	526.5165	11828.38	1.694605E-16	33	666.2114	0.9726036	495.6849	21147.53	3.678E-38	19	1479.288	FER	FER_P581_F	4885230	NM_005246.1	FER	2241	5	36.1	108110841	-581	N	CTTTATGACGGAAGGTAGTTTTGCAACACGGAGCAAGTTGCTCACCGAAGTTACGCT	TYK3	go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94)
FES_E34_R	605	0.09765562	3093.107	345.5719	0.04789599	31	110.7981	0.08631206	15363.2	1460.74	1.018848E-28	31	1063.696	0.08689218	18280.46	1749.102	3.678E-38	40	767.4501	0.03263045	5731.443	196.7011	0.002847961	31	250.8712	0.1107289	13712.6	1719.896	6.04296E-26	23	1065.576	0.1970419	11619.43	2875.889	2.716373E-26	34	948.3749	0.06722721	17666.68	1280.488	2.169475E-31	40	842.3005	0.09425664	16674.89	1745.687	1.807343E-20	23	695.1113	0.0947822	8886.024	940.8953	2.997634E-10	24	492.0043	0.06163008	15405.6	1018.374	3.16108E-29	24	1179.871	FES	FES_E34_R	13376997	NM_002005.2	FES	2242	15	36.1	89228747	34	Y	GCACCGGGCCTGAGTCGGTCCGAGGCCGTCCCAGGAGCAGCTGCC	FPS	Oncogene FES, feline sarcoma virus; feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog; c-fes/fps protein; proto-oncogene c-fes variant 1; proto-oncogene c-fes variant 2; proto-oncogene c-fes variant 3; proto-oncogene c-fes variant 4; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: development; go_process: cell proliferation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	V-FES feline sarcoma viral/V-FPS fujinami avian sarcoma viral oncogene homolog
FES_P223_R	4002	0.1384843	2679.062	446.7201	0.08282481	25	124.9585	0.2047233	5910.489	1547.244	1.392001E-05	25	276.1101	0.157291	7127.929	1349.087	1.335146E-07	34	300.8757	0.05180294	6056.817	336.366	0.00107108	19	191.7081	0.2178889	6309.047	1785.501	6.074214E-07	23	289.9012	0.3031338	4961.81	2201.865	3.560163E-06	31	338.1506	0.1198944	7113.922	982.7328	1.532164E-05	27	339.4549	0.1224655	8350.651	1179.342	1.63491E-05	37	252.4879	0.157799	5740.916	1094.383	5.639014E-05	25	331.2197	0.1315064	5800.447	893.4399	8.989112E-05	23	211.1848	FES	FES_P223_R	13376997	NM_002005.2	FES	2242	15	36.1	89228490	-223	Y	CGCTGCCGGGCCCTGGGGCCTGCGGGGCGCGGGCGGCTCTTGGCTGGGCCATT	FPS	Oncogene FES, feline sarcoma virus; feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog; c-fes/fps protein; proto-oncogene c-fes variant 1; proto-oncogene c-fes variant 2; proto-oncogene c-fes variant 3; proto-oncogene c-fes variant 4; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: development; go_process: cell proliferation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	V-FES feline sarcoma viral/V-FPS fujinami avian sarcoma viral oncogene homolog
FGF1_E5_F	619	0.1977033	5711.829	1432.161	3.30307E-07	28	456.1529	0.903774	1589.584	15868.91	5.125571E-31	25	1141.897	0.9092669	1566.269	16698.25	1.513159E-37	35	694.0189	0.3260588	3126.959	1561.232	0.0254953	31	166.6445	0.9073412	1504.727	15713.93	1.285633E-32	27	921.73	0.8837311	1765.009	14175.48	4.119196E-32	18	865.9145	0.9064564	1373.309	14276.65	4.875436E-21	26	1227.327	0.9173473	1634.67	19252.79	1.50912E-26	29	937.4688	0.8764977	1487.139	11263.96	1.258502E-17	35	685.5473	0.9252059	1352.652	17969.36	3.678E-38	27	1064.104	FGF1	FGF1_E5_F	15055540	NM_033136.1	FGF1	2246	5	36.1	142045807	5	N	CTTGGTGTCTTCTTCTCAGAGTAGCCCGGCTCTCTGAACCTCCAGGCTACTGCAGCT	AFGF, ECGF, FGFA, ECGFA, ECGFB, HBGF1, GLIO703, ECGF-beta, FGF-alpha	isoform 2 precursor is encoded by transcript variant 2; heparin-binding growth factor 1 precursor; endothelial cell growth factor, alpha; endothelial cell growth factor, beta; go_component: extracellular space; go_function: heparin binding; go_function: protein binding; go_function: growth factor activity; go_function: growth factor activity; go_process: angiogenesis; go_process: morphogenesis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: cell differentiation; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 1 (acidic) isoform 2 precursor
FGF1_P357_R	3718	0.4894173	3213.441	3176.088	8.566121E-06	28	315.7382	0.8946739	1601.329	14451.65	4.731522E-26	34	928.8346	0.897861	2075.452	19123.49	3.678E-38	36	974.4024	0.7271349	1179.636	3409.991	0.02958591	37	122.5344	0.9200767	1180.153	14737.11	1.122148E-27	17	1048.294	0.8682054	2093.814	14451.9	9.893591E-35	27	1290.005	0.8993819	1577.21	14991.85	1.054127E-23	39	991.8585	0.9212236	1614.663	20051.54	1.215421E-28	26	1247.725	0.8667054	1814.37	12447.57	2.624918E-22	38	739.5027	0.9409507	1153.413	19973.14	3.678E-38	21	1201.419	FGF1	FGF1_P357_R	15055540	NM_033136.1	FGF1	2246	5	36.1	142046169	-357	N	AGCCAGGAGGGAGGTAGAGACAGAAGACGGTGGCAGCAGCTACCCTGGGTG	AFGF, ECGF, FGFA, ECGFA, ECGFB, HBGF1, GLIO703, ECGF-beta, FGF-alpha	isoform 2 precursor is encoded by transcript variant 2; heparin-binding growth factor 1 precursor; endothelial cell growth factor, alpha; endothelial cell growth factor, beta; go_component: extracellular space; go_function: heparin binding; go_function: protein binding; go_function: growth factor activity; go_function: growth factor activity; go_process: angiogenesis; go_process: morphogenesis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: cell differentiation; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 1 (acidic) isoform 2 precursor
FGF12_E61_R	437	0.1336856	5876.075	922.2	1.549936E-06	29	224.414	0.2394974	8087.002	2578.25	3.036918E-11	30	488.6853	0.2159477	10235.62	2846.69	1.335747E-18	42	562.8552	0.3320634	3396.972	1738.513	0.01238655	29	195.762	0.2079597	9736.767	2582.761	3.077462E-16	29	631.7353	0.2893621	10252.65	4215.459	3.44869E-26	27	997.7068	0.2352254	8633.085	2686.076	9.178833E-11	26	948.954	0.2467527	11191.7	3698.994	3.101756E-13	29	605.9318	0.2091126	8071.303	2160.513	3.864678E-11	30	616.4851	0.2268983	12222.87	3616.649	4.29686E-27	21	820.312	FGF12	FGF12_E61_R	21614509	NM_021032.2	FGF12	2257	3	36.1	193928005	61	Y	AGCTGCAGGCAGGAGCTGTCCTCCGAGCGTGGTGCTGCAGGTGTAGTGACAG	FHF1, FGF12B	isoform 1 is encoded by transcript variant 1; fibroblast growth factor 12B; fibroblast growth factor homologous factor 1; myocyte-activating factor; fibroblast growth factor FGF-12b; go_component: nucleus; go_function: growth factor activity	fibroblast growth factor 12 isoform 1
FGF12_P210_R	3722	0.05783654	5065.734	317.1086	0.0003358367	29	195.615	0.1315619	10069.5	1540.604	2.335681E-13	32	454.6977	0.1147846	10861.57	1421.371	2.67375E-16	24	404.795	0.04475433	4149.142	199.0771	0.04194185	31	130.1075	0.09321771	9276.994	963.96	4.132199E-11	19	539.7765	0.1912894	8385.03	2007.018	4.160709E-13	33	543.803	0.1352978	9343.641	1477.623	8.012908E-10	24	614.4156	0.1356797	10623.02	1683.283	5.039444E-09	30	341.3775	0.1245134	9122.501	1311.642	1.33882E-11	40	350.1916	0.08680617	10709.09	1027.488	1.612392E-14	20	617.126	FGF12	FGF12_P210_R	21614509	NM_021032.2	FGF12	2257	3	36.1	193928276	-210	Y	AAACTAGAAAATGGATTGGACTAGTACTGCGTGCATCAGGACGAATTACTGAAGTCT	FHF1, FGF12B	isoform 1 is encoded by transcript variant 1; fibroblast growth factor 12B; fibroblast growth factor homologous factor 1; myocyte-activating factor; fibroblast growth factor FGF-12b; go_component: nucleus; go_function: growth factor activity	fibroblast growth factor 12 isoform 1
FGF2_P153_F	4008	0.1190232	1304.703	189.7806	0.5278026	23	49.85122	0.5586671	1403.665	1903.434	0.1257044	21	183.8674	0.5798535	1635.948	2395.821	0.04554216	27	127.4461	0.08856025	2540.554	256.5701	0.2384564	25	125.2598	0.5170941	1475.591	1687.138	0.1404291	32	105.5726	0.5782922	1563.074	2280.591	0.04022289	28	187.6659	0.5684491	1601.651	2241.455	0.1044842	28	180.1273	0.5861545	1823.873	2724.898	0.09235506	33	132.7306	0.5320603	1464.567	1778.956	0.1436135	19	213.0106	0.5320072	1593.54	1925.19	0.0925122	27	162.2046	FGF2	FGF2_P153_F	41352694	NM_002006.3	FGF2	2247	4	36.1	123967160	-153	Y	TGACTTTTGGGGGATAAGGGGCGGTGGAGCCCAGGGAATGCCA	BFGF, FGFB, HBGH-2	non-AUG (CUG) translation initiation codon; 34-kDa isoform; heparin-binding growth factor 2 precusor; prostatropin; basic fibroblast growth factor; basic fibroblast growth factor bFGF; go_component: extracellular space; go_function: heparin binding; go_function: protein binding; go_function: growth factor activity; go_process: angiogenesis; go_process: chemotaxis; go_process: muscle development; go_process: cell proliferation; go_process: cell-cell signaling; go_process: cell differentiation; go_process: organ morphogenesis; go_process: signal transduction; go_process: nervous system development; go_process: activation of MAPK activity; go_process: Ras protein signal transduction; go_process: regulation of progression through cell cycle; go_process: positive regulation of cell proliferation	fibroblast growth factor 2
FGF2_P229_F	3726	0.09643497	14589.44	1567.763	3.678E-38	28	1213.436	0.2686341	5271.737	1973.065	2.737875E-05	27	347.0206	0.2830116	5850.656	2348.859	4.118789E-07	34	335.4592	0.08686736	8095.877	779.6832	1.315768E-06	32	501.4153	0.3043774	5340.882	2380.719	2.464483E-06	26	387.5053	0.2840412	4586.861	1859.411	4.857103E-05	33	304.1439	0.21762	5861.833	1658.291	8.03434E-05	25	221.6167	0.3051884	6656.044	2967.519	1.294391E-05	26	458.8516	0.2709475	4261.562	1620.945	0.0009061852	29	342.1315	0.1937187	5254.528	1286.49	0.0001420785	26	692.649	FGF2	FGF2_P229_F	41352694	NM_002006.3	FGF2	2247	4	36.1	123967084	-229	Y	GTCACGGCTGGTTGCGCAGCAAAAGCCCCGCAGTGTGGAGAAAGCCTAAACGTG	BFGF, FGFB, HBGH-2	non-AUG (CUG) translation initiation codon; 34-kDa isoform; heparin-binding growth factor 2 precusor; prostatropin; basic fibroblast growth factor; basic fibroblast growth factor bFGF; go_component: extracellular space; go_function: heparin binding; go_function: protein binding; go_function: growth factor activity; go_process: angiogenesis; go_process: chemotaxis; go_process: muscle development; go_process: cell proliferation; go_process: cell-cell signaling; go_process: cell differentiation; go_process: organ morphogenesis; go_process: signal transduction; go_process: nervous system development; go_process: activation of MAPK activity; go_process: Ras protein signal transduction; go_process: regulation of progression through cell cycle; go_process: positive regulation of cell proliferation	fibroblast growth factor 2
FGF3_E198_R	1333	0.2949906	5680.363	2418.624	2.85937E-09	30	296.8805	0.03678964	9684.19	373.7054	5.414758E-10	32	311.4939	0.02357462	13225.06	321.7177	5.157897E-20	29	555.5051	0.07829083	6773.859	583.8719	0.00010681	33	280.3686	0.02659095	10912.86	300.8422	2.242566E-13	36	526.4019	0.04315605	10171.45	463.2679	9.467012E-14	25	785.7101	0.03069297	11707.11	373.8705	2.675774E-12	30	609.4059	0.02166911	13779.3	307.4134	7.935006E-12	28	782.9203	0.04670504	8153.872	404.3842	9.813338E-08	22	358.92	0.02578914	12010.5	320.5871	4.418743E-16	28	559.4834	FGF3	FGF3_E198_R	15451899	NM_005247.2	FGF3	2248	11	36.1	69342931	198	Y	CAAAGCGCTGAAAGAAAGGACGGTTCGCCAACAAAAGGCCGACGTGGTCC	INT2, HBGF-3	INT-2 proto-oncogene protein precursor; oncogene INT2; V-INT2 murine mammary tumor virus integration site oncogene homolog; murine mammary tumor virus integration site 2, mouse, included; go_component: extracellular space; go_function: growth factor activity; go_process: morphogenesis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 3 precursor
FGF3_P171_R	5573	0.07347476	2131.755	176.9813	0.2555777	24	120.8423	0.07673777	6634.072	559.7084	3.208533E-05	17	359.3328	0.07961541	7942.791	695.7201	6.788992E-08	18	379.9337	0.1676152	537.8884	128.45	0.7537155	33	34.8757	0.07590488	6720.604	560.2422	1.165993E-05	30	343.5392	0.1386231	6622.616	1081.884	3.97367E-07	29	392.6035	0.08112229	7017.517	628.3636	5.668494E-05	32	264.5455	0.07530643	8500.716	700.4366	3.636466E-05	19	482.7272	0.1154668	6113.214	811.0717	4.236673E-05	36	262.0174	0.0999628	7577.568	852.7106	1.996461E-07	29	378.5682	FGF3	FGF3_P171_R	15451899	NM_005247.2	FGF3	2248	11	36.1	69343300	-171	Y	GATGACTGATGTCCGTGAAAACAACTTGCGGGGAAGTCGAGCTGACAAAC	INT2, HBGF-3	INT-2 proto-oncogene protein precursor; oncogene INT2; V-INT2 murine mammary tumor virus integration site oncogene homolog; murine mammary tumor virus integration site 2, mouse, included; go_component: extracellular space; go_function: growth factor activity; go_process: morphogenesis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 3 precursor
FGF5_E16_F	453	0.05397823	8410.724	485.6059	3.153998E-11	34	297.2938	0.1000087	9901.901	1111.43	5.338401E-12	23	669.2651	0.06882846	11871.59	884.8918	1.212738E-17	34	474.9006	0.04182435	4808.927	214.2746	0.01495499	20	223.8493	0.1165329	9256.419	1234.149	1.141198E-11	27	426.3155	0.1579796	9218.171	1748.272	1.173691E-14	32	695.7437	0.1000853	10838.93	1216.589	3.024421E-12	26	819.2835	0.08135571	12694.55	1133.093	2.159452E-11	22	769.3472	0.1079701	9577.958	1171.407	2.445671E-12	21	817.343	0.084375	12060.16	1120.56	1.820609E-18	22	425.8895	FGF5	FGF5_E16_F	73486654	NM_004464.3	FGF5	2250	4	36.1	81406782	16	Y	GGGTGAGGGGAAGCTTCGCAGGCGTGCACGGAGCAGTGAGATCACTGG	HBGF-5, Smag-82	isoform 1 precursor is encoded by transcript variant 1; heparin-binding growth factor 5; go_component: extracellular space; go_function: growth factor activity; go_process: cell proliferation; go_process: cell-cell signaling; go_process: nervous system development; go_process: regulation of progression through cell cycle; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor 5 isoform 1 precursor
FGF5_P238_R	3734	0.05926346	7325.958	467.8121	1.408634E-08	26	310.2265	0.07643393	9563.859	799.7769	1.301007E-10	32	492.3654	0.06361	13455.69	920.8529	1.117965E-22	32	510.68	0.2759651	847.2188	361.0314	0.6296052	24	45.61155	0.0630735	11148.6	757.2509	3.934535E-15	27	450.3337	0.07837779	10320.73	886.2132	2.467084E-15	28	1042.107	0.0529558	11930.57	672.7122	2.031997E-13	26	652.064	0.0551591	12303.15	724.0868	4.164995E-10	23	598.5189	0.0603242	8542.955	554.8502	9.388268E-09	26	468.6496	0.04193088	14826.63	653.2794	8.002978E-26	28	734.7016	FGF5	FGF5_P238_R	73486654	NM_004464.3	FGF5	2250	4	36.1	81406528	-238	Y	AGGACTCAGCTGCTAACGCCGAGCTCGTTTCCACGCGGCTCTGGTCCTAGTCG	HBGF-5, Smag-82	isoform 1 precursor is encoded by transcript variant 1; heparin-binding growth factor 5; go_component: extracellular space; go_function: growth factor activity; go_process: cell proliferation; go_process: cell-cell signaling; go_process: nervous system development; go_process: regulation of progression through cell cycle; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor 5 isoform 1 precursor
FGF6_E294_F	460	0.3452361	2464.323	1352.086	0.02260144	31	128.5437	0.9351454	818.7754	13247.93	8.175579E-20	21	618.0062	0.9408962	850.3524	15129.01	2.487508E-28	24	725.0696	0.7425157	541.9017	1851.072	0.3277232	29	132.1022	0.9263022	688.4971	9910.559	6.451294E-12	35	686.888	0.9335994	798.8325	12637.68	2.032749E-22	37	738.7509	0.9306506	786.8282	11901	1.32302E-13	27	877.4898	0.9415253	862.8582	15503.4	4.746933E-16	31	592.4567	0.9090422	859.9708	9594.06	1.204755E-11	39	500.6659	0.9347942	849.6827	13614.72	2.067341E-22	32	779.3486	FGF6	FGF6_E294_F	10337586	NM_020996.1	FGF6	2251	12	36.1	4424747	294	Y	CGTTGCAGTAGAGCCTCCGCTGCCGCTTGATCCCCACCAAATAGCCA	HST2, HBGF-6	go_component: extracellular region; go_function: growth factor activity; go_process: angiogenesis; go_process: cell differentiation; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 6 precursor
FGF6_P139_R	4016	0.5592481	843.8899	1197.655	0.3377728	34	39.93575	0.941873	563.5989	10752.76	1.115672E-12	38	420.5455	0.9489411	632.8976	13621.07	2.839282E-22	26	797.4481	0.2276026	375.0689	139.9887	0.7839045	21	22.47304	0.9342011	607.8718	10050.24	4.716052E-12	26	453.5762	0.9414491	607.079	11369.24	1.293823E-17	22	663.3691	0.936892	664.5912	11351	3.662461E-12	29	386.1577	0.939738	775.4163	13651.43	2.064097E-12	24	750.8947	0.9195746	754.7535	9773.157	8.124102E-12	27	565.5779	0.9482858	563.5589	12167.72	3.501603E-17	21	643.0732	FGF6	FGF6_P139_R	10337586	NM_020996.1	FGF6	2251	12	36.1	4425180	-139	Y	GAGAGCAGAGGGACCCAGGCTGAGCCGCGGCCGGTAGAGACCATGGCTCG	HST2, HBGF-6	go_component: extracellular region; go_function: growth factor activity; go_process: angiogenesis; go_process: cell differentiation; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 6 precursor
FGF7_P44_F	5679	0.3021784	2077.854	943.0782	0.09805193	43	104.5539	0.9345942	738.0065	11974.41	4.398345E-16	37	634.0478	0.9511849	675.7831	15116.5	1.230266E-27	32	632.543	0.5587012	848.6083	1200.974	0.4125497	21	80.65076	0.9387307	536.2684	9748.507	3.305219E-11	30	1027.777	0.9204525	854.9661	11050.02	2.1407E-17	30	745.7603	0.9076592	974.6667	10563.39	3.415756E-11	22	762.3752	0.93984	826.6308	14476.13	5.439917E-14	31	505.5316	0.9042664	890.4227	9355.188	3.597985E-11	34	433.367	0.926468	882.9146	12384.25	1.017357E-18	29	622.2134	FGF7	FGF7_P44_F	15147344	NM_002009.2	FGF7	2252	15	36.1	47502707	-44	N	GCTTCCAATGAGGTCAGCAAAGGTATTTATCGAAAAGCCCTGAATAAAAGGCTCACAC	KGF, HBGF-7	keratinocyte growth factor; go_component: extracellular region; go_function: growth factor activity; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: response to wounding; go_process: epidermis development; go_process: regulation of progression through cell cycle; go_process: positive regulation of cell proliferation	fibroblast growth factor 7 precursor
FGF7_P610_F	5625	0.558097	2389.586	3144.198	0.0002034224	21	237.8731	0.9144825	1569.199	17849.6	3.678E-38	29	1615.927	0.9263443	1718.627	22872.28	3.678E-38	24	1313.297	0.7582519	1315.071	4438.423	0.00402164	20	275.3729	0.9157594	1381.465	16104.66	1.098154E-33	30	1600.49	0.8971034	1936.109	17751.8	3.678E-38	36	1292.643	0.8951558	2038.499	18258.41	2.920262E-36	47	1138.345	0.8902851	2297.076	19451.15	7.232275E-29	23	939.2551	0.878988	1337.513	10441.58	6.274307E-15	29	831.5626	0.9226565	1608.717	20383.87	3.678E-38	23	1301.436	FGF7	FGF7_P610_F	15147344	NM_002009.2	FGF7	2252	15	36.1	47502141	-610	N	TGAGACTCTGGAACAGCAGGTAACTTGCCCGAAGTCATACTGGTCATTAGTGGTCCAA	KGF, HBGF-7	keratinocyte growth factor; go_component: extracellular region; go_function: growth factor activity; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: response to wounding; go_process: epidermis development; go_process: regulation of progression through cell cycle; go_process: positive regulation of cell proliferation	fibroblast growth factor 7 precursor
FGF8_E183_F	1334	0.084073	3743.696	352.8131	0.01213673	30	159.512	0.06645055	9797.589	704.5157	6.710975E-11	35	599.8005	0.04202417	10830.73	479.5058	1.010785E-13	31	852.4752	0.04068597	3611.8	157.4231	0.08869421	31	151.9101	0.04186805	10783.74	475.5931	1.732561E-13	26	558.3132	0.06004429	9379.063	605.5218	4.573401E-12	27	538.8831	0.04359113	11710.4	538.2935	1.185522E-12	31	694.3265	0.04798961	13334.92	677.2369	1.060754E-11	25	762.759	0.1460002	7535.113	1305.302	2.938248E-08	26	536.018	0.03799794	8803.217	351.6665	9.463766E-09	22	501.9649	FGF8	FGF8_E183_F	15147351	NM_006119.2	FGF8	2253	10	36.1	103525634	183	Y	CACAGGCAGCTCAGCGCGGAGCGGGGGCTGCCCATGGCGCGCGGCCC	AIGF, HBGF-8	isoform B precursor is encoded by transcript variant B; androgen-induced growth factor; go_component: extracellular space; go_function: growth factor activity; go_process: gastrulation; go_process: morphogenesis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 8 isoform B precursor
FGF8_P473_F	5683	0.04607017	6015.747	295.3608	1.171915E-05	35	234.1175	0.03310687	9586.17	331.6589	1.023713E-09	24	941.4215	0.02377228	14974.59	367.0837	5.305787E-26	27	725.6847	0.06850783	2029.944	156.6496	0.3779568	24	82.47065	0.02830025	13483.3	395.6064	8.519614E-21	21	945.8414	0.0331231	11126.56	384.5975	3.244897E-16	20	695.2996	0.03024207	11725.32	368.7746	2.511996E-12	23	941.0765	0.0272447	16559.53	466.5961	2.091181E-17	30	556.9988	0.0470216	10228.45	509.6234	2.601945E-12	26	655.2523	0.02568471	11872.92	315.6278	1.066217E-15	32	507.3135	FGF8	FGF8_P473_F	15147351	NM_006119.2	FGF8	2253	10	36.1	103526290	-473	Y	GCCTGGAGCGCCCGAGTCTGGCGGGTCTGGGTCTCCGCCTCCGGGCC	AIGF, HBGF-8	isoform B precursor is encoded by transcript variant B; androgen-induced growth factor; go_component: extracellular space; go_function: growth factor activity; go_process: gastrulation; go_process: morphogenesis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 8 isoform B precursor
FGF9_P1404_F	4026	0.05817842	8237.073	514.9996	7.394683E-11	34	607.2304	0.1162567	15511.38	2053.682	2.063555E-31	34	1113.892	0.1084551	18511.73	2264.089	3.678E-38	31	732.2283	0.06789396	5610.347	415.9377	0.002333547	22	505.6188	0.1570581	14592.57	2737.54	4.635403E-33	27	1020.566	0.1543864	18086.74	3320.413	3.678E-38	26	770.961	0.1716725	15114.9	3153.317	4.439473E-29	34	1065.002	0.179993	19190.59	4234.318	1.111489E-33	26	863.5486	0.1821915	11068.59	2488.14	4.762864E-20	27	1296.559	0.1157855	17897.3	2356.698	3.678E-38	31	923.3427	FGF9	FGF9_P1404_F	4503706	NM_002010.1	FGF9	2254	13	36.1	21142471	-1404	Y	TCGTCCTAAGCAGCGTGGTTTGAGGGCGAGAAGACGCCTACTGGAGCGCTC	GAF, HBFG-9, MGC119914, MGC119915	glia-activating factor; go_component: extracellular space; go_function: heparin binding; go_function: growth factor activity; go_process: cell proliferation; go_process: cell differentiation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 9 precursor
FGF9_P862_R	4028	0.7723393	4201.994	14594.52	3.678E-38	31	690.4785	0.3830439	9120.861	5724.872	3.756563E-22	36	900.1554	0.4066337	11720.54	8100.608	3.678E-38	32	778.5366	0.890619	1736.938	14957.01	4.445716E-23	29	667.8536	0.3993414	9451.979	6350.53	2.918917E-27	32	479.4779	0.4019133	9606.727	6522.904	6.423565E-33	21	630.3434	0.4369805	9544.359	7485.349	4.198664E-25	22	652.0818	0.4432733	10393.02	8354.687	3.158414E-21	21	797.2615	0.3188719	7276.869	3453.5	2.714057E-12	22	1066.25	0.4250534	10051.5	7504.92	1.326953E-33	24	609.4481	FGF9	FGF9_P862_R	4503706	NM_002010.1	FGF9	2254	13	36.1	21143013	-862	Y	GACTCAGGGTTTCTTCCTCCCGCCTCTCGCAGTGCATCTTTCATTTGCTTTT	GAF, HBFG-9, MGC119914, MGC119915	glia-activating factor; go_component: extracellular space; go_function: heparin binding; go_function: growth factor activity; go_process: cell proliferation; go_process: cell differentiation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle	fibroblast growth factor 9 precursor
FGFR1_E317_F	620	0.05418171	6674.258	388.067	4.79859E-07	33	277.7132	0.1161118	15043	1989.258	1.835916E-29	26	758.3972	0.09863801	18497.45	2035.16	3.678E-38	25	750.8787	0.02799011	9051.307	263.5221	3.086906E-07	32	448.3487	0.1166789	12767.71	1699.712	1.125562E-22	33	753.5666	0.1331188	14585.14	2255.059	4.806049E-36	24	839.566	0.1242929	13656.91	1952.577	6.330664E-21	27	1007.809	0.1125076	18833.37	2400.188	1.813301E-27	26	782.5754	0.1138636	9855.873	1279.275	2.817626E-13	25	696.2491	0.1213901	15919.34	2213.257	5.922573E-36	28	808.7925	FGFR1	FGFR1_E317_F	13186232	NM_000604.2	FGFR1	2260	8	36.1	38444976	317	Y	GCCTCACTTTCCTTGCAGACCGGGCTCCATCGCCCTGCGGAGGCC	H2, H3, H4, H5, CEK, FLG, FLT2, KAL2, BFGFR, C-FGR, CD331, N-SAM	isoform 1 precursor is encoded by transcript variant 1; hydroxyaryl-protein kinase; fms-related tyrosine kinase-2; heparin-binding growth factor receptor; FMS-like tyrosine kinase 2; basic fibroblast growth factor receptor 1; protein-tyrosine kinase; N-sam tyrosine kinase; tyrosylprotein kinase; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATP binding; go_function: heparin binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_process: cell growth; go_process: MAPKKK cascade; go_process: skeletal development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor receptor 1 isoform 1 precursor
FGFR1_P204_F	4033	0.1406805	3197.442	539.8293	0.02667206	25	113.4485	0.09968291	9362.23	1047.656	1.044094E-10	32	635.3311	0.1012527	12238.76	1390.082	2.863892E-20	28	794.3967	0.0621954	3241.041	221.5785	0.1255359	23	149.5343	0.1149281	10013.35	1313.235	1.181858E-13	28	504.4608	0.1779036	9141.424	1999.865	3.791149E-15	32	712.9496	0.1054935	9412.941	1121.907	2.647222E-09	31	765.0482	0.1263347	13586.72	1979.142	1.740388E-14	35	537.2977	0.1910083	6990.612	1674.141	6.259377E-08	34	476.9153	0.07087526	13092.4	1006.339	3.026884E-21	31	561.665	FGFR1	FGFR1_P204_F	13186232	NM_000604.2	FGFR1	2260	8	36.1	38445497	-204	Y	CTACAGCCTGGTCTCCTTTGGCGTTTGCGCCCCTGCATCTGAGCACGTCCCA	H2, H3, H4, H5, CEK, FLG, FLT2, KAL2, BFGFR, C-FGR, CD331, N-SAM	isoform 1 precursor is encoded by transcript variant 1; hydroxyaryl-protein kinase; fms-related tyrosine kinase-2; heparin-binding growth factor receptor; FMS-like tyrosine kinase 2; basic fibroblast growth factor receptor 1; protein-tyrosine kinase; N-sam tyrosine kinase; tyrosylprotein kinase; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: ATP binding; go_function: heparin binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_process: cell growth; go_process: MAPKKK cascade; go_process: skeletal development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor receptor 1 isoform 1 precursor
FGFR2_P266_R	2485	0.1141438	7697.098	1004.667	9.915568E-11	34	349.0567	0.09079694	8230.967	831.9663	3.99653E-08	31	351.9889	0.079756	8062.486	707.4289	3.871829E-08	20	395.3065	0.1907381	2477.593	607.5226	0.1840177	28	162.7679	0.07941494	7685.441	671.6168	2.162204E-07	35	440.4667	0.1233314	6576.217	939.2228	8.741313E-07	24	662.3182	0.1138589	7089.642	923.7863	1.964146E-05	32	558.5957	0.1088779	8828.229	1090.857	6.081684E-06	27	479.7433	0.1228848	5340.145	762.1705	0.0004999737	25	552.5339	0.09228143	8222.735	846.1146	1.380435E-08	33	367.5853	FGFR2	FGFR2_P266_R	13186270	NM_023030.1	FGFR2	2263	10	36.1	123348173	-266	Y	GCGATGCGGCCGTAGGGATGCAGCGACAGCCTCCGAATAAGGCCTGGTC	BEK, JWS, CEK3, CFD1, ECT1, KGFR, TK14, TK25, BFR-1, CD332, K-SAM	isoform 12 precursor is encoded by transcript variant 12; hydroxyaryl-protein kinase; keratinocyte growth factor receptor; protein tyrosine kinase, receptor like 14; FGF receptor; bacteria-expressed kinase; fibroblast growth factor receptor BEK; tyrosylprotein kinase; K-sam protein; transmembrane protein tyrosine kinase; fibroblast growth factor receptor, BEK protein; BEK fibroblast growth factor receptor; go_component: membrane; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: ATP binding; go_function: heparin binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_process: cell growth; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	fibroblast growth factor receptor 2 isoform 12 precursor
FGFR2_P460_R	2501	0.03846562	6935.512	281.4516	2.355572E-07	28	329.9658	0.3860191	6841.087	4363.966	1.993909E-12	27	423.1408	0.3152052	8994.077	4185.926	6.809657E-19	31	485.3738	0.03265117	7444.648	254.6564	4.312457E-05	32	317.9617	0.3825688	6787.759	4267.75	5.43559E-13	29	519.7062	0.4438893	6815.52	5519.991	9.728934E-19	23	686.6503	0.3162457	8552.459	4001.881	2.600974E-13	24	792.16	0.3269419	10033	4922.164	2.37066E-13	29	516.7539	0.5203632	4746.67	5258.205	1.232991E-10	20	621.4393	0.3403067	7771.332	4060.473	9.186426E-15	37	475.5774	FGFR2	FGFR2_P460_R	13186270	NM_023030.1	FGFR2	2263	10	36.1	123348367	-460	Y	GAGACTTTAAAATGCGCCTGCTTGATACTGCGGGGAGGGTTGCCAGGCAG	BEK, JWS, CEK3, CFD1, ECT1, KGFR, TK14, TK25, BFR-1, CD332, K-SAM	isoform 12 precursor is encoded by transcript variant 12; hydroxyaryl-protein kinase; keratinocyte growth factor receptor; protein tyrosine kinase, receptor like 14; FGF receptor; bacteria-expressed kinase; fibroblast growth factor receptor BEK; tyrosylprotein kinase; K-sam protein; transmembrane protein tyrosine kinase; fibroblast growth factor receptor, BEK protein; BEK fibroblast growth factor receptor; go_component: membrane; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: ATP binding; go_function: heparin binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_function: fibroblast growth factor receptor activity; go_process: cell growth; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	fibroblast growth factor receptor 2 isoform 12 precursor
FGFR3_E297_R	4098	0.04195879	4430.115	198.4029	0.003189579	27	164.219	0.06663825	9056.322	653.7243	2.583874E-09	33	735.9974	0.06704145	11908.27	862.9022	1.099418E-17	41	609.8855	0.04175746	4418.281	196.8937	0.02847658	27	238.6052	0.068402	9511.963	705.7524	4.649621E-11	31	599.1732	0.07438085	9674.338	785.4457	2.763269E-13	32	581.4141	0.07284711	8948.509	710.9483	8.09702E-08	29	665.1823	0.06440285	13159.05	912.7015	8.411882E-12	28	488.8123	0.08081138	6760.803	603.1743	9.644371E-06	38	377.4026	0.08657095	8280.513	794.2696	1.345144E-08	23	477.6046	FGFR3	FGFR3_E297_R	13112047	NM_022965.1	FGFR3	2261	4	36.1	1765718	297	Y	CGCTGCCTCCTTGCCGGAGAGCGCGGCCAGAGCTAGCGCGGCGACTTGTGGTG	ACH, CEK2, JTK4, CD333, HSFGFR3EX	isoform 2 precursor is encoded by transcript variant 2; hydroxyaryl-protein kinase; tyrosine kinase JTK4; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: identical protein binding; go_function: protein-tyrosine kinase activity; go_function: fibroblast growth factor receptor activity; go_process: cell growth; go_process: MAPKKK cascade; go_process: JAK-STAT cascade; go_process: skeletal development; go_process: protein amino acid phosphorylation; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor receptor 3 isoform 2 precursor
FGFR3_P1152_R	2536	0.1691071	7720.209	1591.605	2.47539E-12	27	328.349	0.7543711	3472.841	10972.85	6.205201E-21	24	867.9378	0.7803786	3740.307	13645.72	7.653106E-34	32	1072.772	0.03086025	5739.655	185.9518	0.00286252	22	498.0941	0.749726	3275.76	10112.5	2.693721E-19	18	559.5951	0.7766998	3108.001	11158.31	1.994274E-25	24	733.0917	0.6835539	4680.246	10325.79	2.843616E-19	27	1026.088	0.7052153	5626.205	13698.83	1.337657E-22	24	739.0276	0.648123	3824.619	7228.765	4.487529E-13	29	945.8771	0.6134007	4282.993	6954.308	2.828849E-13	25	441.4613	FGFR3	FGFR3_P1152_R	13112047	NM_022965.1	FGFR3	2261	4	36.1	1764269	-1152	Y	GCGGGGCTCTCAGGCGGCTTAGCTGCGTGCGGCCCCAGGTCAGTCAACG	ACH, CEK2, JTK4, CD333, HSFGFR3EX	isoform 2 precursor is encoded by transcript variant 2; hydroxyaryl-protein kinase; tyrosine kinase JTK4; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: identical protein binding; go_function: protein-tyrosine kinase activity; go_function: fibroblast growth factor receptor activity; go_process: cell growth; go_process: MAPKKK cascade; go_process: JAK-STAT cascade; go_process: skeletal development; go_process: protein amino acid phosphorylation; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor receptor 3 isoform 2 precursor
FGFR4_P610_F	4036	0.4845233	2939.612	2857.089	8.154155E-05	32	287.6308	0.9234582	894.6213	11999.87	1.466581E-16	33	803.4838	0.9393021	919.0546	15769.9	4.783151E-31	36	801.1116	0.5025355	2214.094	2337.684	0.03129516	28	237.7317	0.9303936	813.7416	12213.52	3.128207E-18	28	739.804	0.919513	1007.122	12648.18	3.423984E-23	22	701.2813	0.9298119	959.8399	14040.15	2.951578E-19	31	736.0916	0.9376783	1010.62	16710.13	6.73018E-19	39	663.8809	0.9102973	857.515	9716.804	6.332338E-12	27	627.278	0.9493342	801.8724	16898.55	3.493265E-34	23	923.9246	FGFR4	FGFR4_P610_F	47524174	NM_213647.1	FGFR4	2264	5	36.1	176445917	-610	N	GAGTAGCAGGGTGGGAGCCAGGAGGCGTGGGTCATGGCAATCTATGTATAAAG	TKF, JTK2, CD334, MGC20292	isoform 1 precursor is encoded by transcript variant 3; hydroxyaryl-protein kinase; tyrosine kinase related to fibroblast growth factor receptor; tyrosylprotein kinase; protein-tyrosine kinase; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: fibroblast growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: fibroblast growth factor receptor signaling pathway	fibroblast growth factor receptor 4 isoform 1 precursor
FGR_P39_F	5688	0.6471897	1870.458	3614.578	0.0002396228	35	142.6728	0.9411094	997.5742	17539.95	3.865576E-35	24	1331.447	0.9438316	1379.026	24852.97	3.678E-38	36	1203.812	0.8120433	479.3061	2502.819	0.2025318	23	161.1173	0.9522566	818.7501	18324.74	3.678E-38	30	1336.356	0.9367007	1171.763	18819.51	3.678E-38	37	1056.573	0.930286	1402.311	20047.35	3.678E-38	33	1162.984	0.9662123	913.4572	28981.37	3.678E-38	22	1315.849	0.9112687	1159.608	12936.16	9.184307E-22	31	654.0352	0.969054	762.7221	27015.62	3.678E-38	26	1154.468	FGR	FGR_P39_F	4885234	NM_005248.1	FGR	2268	1	36.1	27823199	-39	N	GGCGGAACTGGGCCACCTACTGTACCGTTCAGTCTGCCTCACAGTATGTCCCC	SRC2, c-fgr, p55c-fgr	Oncogene FGR; tyrosine kinase; p55-c-fgr protein; c-src-2 protein; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein kinase activity; go_function: protein-tyrosine kinase activity; go_process: response to virus; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
FHIT_E19_R	2728	0.06723629	4521.606	333.1387	0.001697282	32	146.7377	0.04911163	13012.54	677.2384	9.847448E-19	43	812.4587	0.04012102	16671.62	701.0203	8.684222E-34	24	661.1915	0.06672721	3777.546	277.2371	0.06225337	32	235.326	0.04135762	13412.99	582.9756	3.661049E-21	39	687.314	0.05824379	13855.77	863.1075	3.749076E-27	18	823.5643	0.04131062	13050.31	566.6564	9.53631E-16	21	1347.313	0.04113164	15669.03	676.4285	5.226082E-16	27	713.7903	0.05318038	9685.012	549.5985	3.809134E-11	25	816.0106	0.04283313	15519.33	698.9636	1.821082E-28	30	662.0649	FHIT	FHIT_E19_R	4503718	NM_002012.1	FHIT	2272	3	36.1	61212145	19	Y	GGAACAGAGGGCAAAAAGTCCTGTGACCGGACAGAGCAGAGCGGGGACTG	FRA3B, AP3Aase	bis(5'-adenosyl)-triphosphatase; dinucleosidetriphosphatase; diadenosine 5',5'''-P1,P3-triphosphate hydrolase; AP3A hydrolase; tumor suppressor protein; go_component: cytoplasm; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: hydrolase activity; go_function: bis(5'-adenosyl)-triphosphatase activity; go_process: cell cycle; go_process: nucleotide metabolism; go_process: negative regulation of progression through cell cycle	fragile histidine triad gene
FHIT_P93_R	1887	0.05002178	4089.235	220.5871	0.00727942	29	122.9828	0.03683317	7730.565	299.4544	2.013044E-06	26	444.849	0.03607825	10308.88	389.5898	3.167592E-12	19	343.7458	0.339466	3218.85	1705.646	0.0175786	19	193.3162	0.03359869	7036.11	248.0998	1.152722E-05	31	478.8958	0.06231404	7213.412	486.0137	4.059901E-07	30	472.1016	0.03658836	8236.188	316.5909	3.716796E-06	22	489.6777	0.03969781	7586.013	317.7312	0.000617246	19	380.396	0.04746234	6420.292	324.8883	7.497934E-05	25	469.9972	0.04019057	7898.6	334.9292	4.341734E-07	33	352.6893	FHIT	FHIT_P93_R	4503718	NM_002012.1	FHIT	2272	3	36.1	61212257	-93	Y	GGAGCGGAGGCCAATACGCGCAGAGCATGCGCCTACGCCGGGCCAATTGAAAGC	FRA3B, AP3Aase	bis(5'-adenosyl)-triphosphatase; dinucleosidetriphosphatase; diadenosine 5',5'''-P1,P3-triphosphate hydrolase; AP3A hydrolase; tumor suppressor protein; go_component: cytoplasm; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: hydrolase activity; go_function: bis(5'-adenosyl)-triphosphatase activity; go_process: cell cycle; go_process: nucleotide metabolism; go_process: negative regulation of progression through cell cycle	fragile histidine triad gene
FHL1_E229_R	2964	0.2108642	5665.784	1540.67	2.473727E-07	23	237.1908	0.02905994	8210.735	248.7377	4.220614E-07	29	387.9408	0.02416361	10102.55	252.635	1.986198E-11	37	318.754	0.05500135	6701.236	395.8494	0.000206675	26	201.7789	0.3396325	6093.754	3185.5	4.210664E-09	28	620.6257	0.3105252	6607.762	3021.037	3.38728E-11	23	513.8792	0.352635	6403.14	3542.415	2.750983E-08	32	410.9785	0.3459461	7875.886	4218.653	1.016168E-08	32	482.312	0.2882653	5453.197	2249.144	2.860756E-06	32	357.6797	0.290568	6117.783	2546.669	7.697785E-08	43	299.7413	FHL1	FHL1_E229_R	34147646	NM_001449.3	FHL1	2273	X	36.1	135057575	229	Y	GCCGCTCGGGGCTGGTCCCTGCGGTCCCGGCTGCCTGGCCTTCCA	FHL1B, KYO-T, SLIM1, MGC111107, bA535K18.1	Four-and-a-half LIM domains 1; bA535K18.1 (LIM protein SLIMMER); go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_process: cell growth; go_process: cell differentiation; go_process: muscle development; go_process: organ morphogenesis	four and a half LIM domains 1
FHL1_P768_F	2192	0.08645203	2056.184	204.0467	0.2696923	34	53.39589	0.1083711	6410.847	791.3472	3.125972E-05	32	426.1012	0.08937065	6836.701	680.7791	5.424709E-06	35	272.4741	0.1391805	750.4321	137.501	0.7057091	38	24.87101	0.4695207	5188.716	4680.979	2.622097E-10	31	459.2719	0.4790724	5276.659	4944.658	1.151493E-12	35	507.0218	0.4219465	6052.048	4490.648	2.563228E-09	26	774.8525	0.4586329	7644.137	6560.644	4.992717E-12	42	529.9322	0.4753599	4759.638	4403.166	6.994809E-09	33	504.5618	0.415356	7099.24	5114.647	9.124627E-16	28	481.8031	FHL1	FHL1_P768_F	34147646	NM_001449.3	FHL1	2273	X	36.1	135056578	-768	Y	AGAGCCCGGCACTGAGCTTGGCACATGGCGAGGGCTCAGTAAACTGAATGCTG	FHL1B, KYO-T, SLIM1, MGC111107, bA535K18.1	Four-and-a-half LIM domains 1; bA535K18.1 (LIM protein SLIMMER); go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_process: cell growth; go_process: cell differentiation; go_process: muscle development; go_process: organ morphogenesis	four and a half LIM domains 1
FLI1_E29_F	1337	0.1620955	24658.44	4789.605	3.678E-38	35	1285.658	0.0738865	9634.065	776.596	1.040243E-10	24	494.5733	0.08614685	10574.75	1006.284	2.049385E-14	22	329.8861	0.1028366	9349.492	1083.141	5.369292E-09	24	655.4411	0.07623135	9634.543	803.3152	1.501958E-11	30	639.1683	0.08348431	10762.08	989.4138	6.253055E-17	35	473.7413	0.09339602	10072.84	1047.98	2.205729E-10	22	281.826	0.09018412	10414.23	1042.207	7.725235E-08	32	542.9241	0.07512945	8668.62	712.296	2.558431E-09	39	383.4312	0.06848735	10260.58	761.7382	9.29584E-13	27	375.2579	FLI1	FLI1_E29_F	7110592	NM_002017.2	FLI1	2313	11	36.1	128069228	29	Y	TGCACAGGGGAGTGAGGGCAGGGCGCTCGCAGGGGGCACGCAGGG	EWSR2, SIC-1	DNA binding protein; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: hemostasis; go_process: organ morphogenesis; go_process: regulation of transcription, DNA-dependent	Friend leukemia virus integration 1
FLI1_P620_R	5708	0.1000368	1389.832	165.6047	0.5061202	32	64.66464	0.0474769	4262.215	217.4272	0.02238756	33	221.7708	0.02771218	5146.622	149.5394	0.003762069	28	203.6203	0.08880067	1128.477	119.7208	0.6196676	29	41.59092	0.03660283	4017.98	156.4565	0.0319548	32	310.4993	0.03782931	4643.379	186.4937	0.00519372	32	274.6276	0.05208698	3378.892	191.162	0.142433	28	256.1304	0.03459632	6774.761	246.3648	0.003168635	21	379.7678	0.05377964	3818.223	222.6972	0.04597341	31	241.7026	0.04482877	3985.371	191.7375	0.0338244	33	210.496	FLI1	FLI1_P620_R	7110592	NM_002017.2	FLI1	2313	11	36.1	128068579	-620	Y	GAGTCTTCCCCGGCAGTAGGCGCTGGGTTACCCGCAGCCCTAGCCA	EWSR2, SIC-1	DNA binding protein; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: hemostasis; go_process: organ morphogenesis; go_process: regulation of transcription, DNA-dependent	Friend leukemia virus integration 1
FLJ20712_P984_R	807	0.4035375	622.808	489.0168	0.6595743	34	35.44691	0.7720339	918.4844	3449.217	0.02713506	23	251.5282	0.8064505	790.1078	3708.756	0.02004348	28	147.0089	0.5350357	457.951	642.0358	0.6560895	22	41.24136	0.820362	680.829	3565.851	0.02818858	21	205.2139	0.709354	1064.105	2841.128	0.0360127	32	164.2117	0.80722	806.0256	3793.765	0.03799003	24	169.4857	0.7753137	897.0956	3440.627	0.1137948	31	178.5137	0.7635423	760.7849	2779.549	0.09759589	27	219.5572	0.8490738	578.387	3816.44	0.0231137	20	207.788	FLJ20712	FLJ20712_P984_R	89025854	XM_940022.1	FLJ20712	55025	7	36.1	33731140	-984	N	ACTGCTTTGTTGAGCCCCAGAACCGGCAGCGGATACTCCCTGCCAATCAC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein LOC55025
FLT1_E444_F	515	0.2467095	2084.922	715.5818	0.1365434	22	137.6155	0.06517965	12196.78	857.384	5.517036E-17	35	721.5024	0.05782824	17599.28	1086.339	3.678E-38	23	1396.793	0.04316342	4029.503	186.2841	0.05032346	32	136.8719	0.06807701	12954.77	953.6515	6.890462E-21	18	963.7813	0.05464413	16352.53	951.001	3.678E-38	24	1399.889	0.04697262	15383.33	763.1392	1.859595E-22	36	773.6938	0.04692874	18532.85	917.4719	6.641794E-23	27	973.4282	0.06514082	9496.238	668.6642	5.458223E-11	41	711.4171	0.05159289	18080.08	988.9877	3.678E-38	26	971.1167	FLT1	FLT1_E444_F	32306519	NM_002019.2	FLT1	2321	13	36.1	27966788	444	Y	CGCTGCAACTAGTGTCCCAGGTTCTCGCCGTAGCCAGCTTCTCCGGGCTACAG	FLT, VEGFR1	go_component: membrane; go_component: extracellular space; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: angiogenesis; go_process: pregnancy; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
FLT1_P302_F	3789	0.2370703	1463.617	485.8734	0.3682911	26	59.34024	0.05165591	9495.341	522.6542	6.498735E-10	20	550.4849	0.03954349	9348.576	389.0126	4.531186E-10	22	541.1979	0.08711773	3164.33	311.52	0.1237531	25	196.6736	0.0398779	7781.664	327.3586	5.74375E-07	26	530.5125	0.08389191	8769.598	812.2268	4.384541E-11	27	452.1418	0.04949324	8057.166	424.7466	4.660192E-06	20	673.3782	0.06835677	10042.69	744.1925	5.661284E-07	26	344.3869	0.06492827	5927.29	418.5149	0.0002505681	34	489.1251	0.03487536	10167.59	371.0257	1.227354E-11	30	344.2449	FLT1	FLT1_P302_F	32306519	NM_002019.2	FLT1	2321	13	36.1	27967534	-302	Y	GCAGGTTCAGGGTCTTTGCTCCGCGCCCTCTTGCCCTTGCCCCTCC	FLT, VEGFR1	go_component: membrane; go_component: extracellular space; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: angiogenesis; go_process: pregnancy; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
FLT1_P615_R	3783	0.08271796	4330.954	399.5711	0.002411119	28	209.6749	0.1955254	9726.462	2388.295	1.430408E-14	26	703.6987	0.1808349	11368.49	2531.728	3.977293E-21	17	613.2967	0.0438915	4915.872	230.2607	0.01216409	23	207.5197	0.1731881	9158.581	1939.349	4.292944E-13	27	615.9459	0.261117	9239.303	3300.455	2.148846E-19	28	751.5342	0.1221595	11665.06	1637.215	5.300211E-15	34	667.9318	0.1570458	13037.98	2447.658	2.469345E-14	28	571.5156	0.1811665	8944.662	2001.127	8.229102E-13	25	693.5677	0.1407097	12709.27	2097.531	1.562236E-23	28	669.5399	FLT1	FLT1_P615_R	32306519	NM_002019.2	FLT1	2321	13	36.1	27967847	-615	Y	GAAGTCTAGGAAGGCACCGGAGACCCTCGGCACAAGGCACTGAACCTGGAGCG	FLT, VEGFR1	go_component: membrane; go_component: extracellular space; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: angiogenesis; go_process: pregnancy; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
FLT3_E326_R	542	0.1553582	2842.163	541.163	0.05302577	30	206.5581	0.1511637	5989.623	1084.461	4.630805E-05	30	468.1298	0.1189169	8365.497	1142.56	1.367928E-09	24	445.7228	0.2271905	2875.683	874.7914	0.09068583	25	227.3774	0.1498505	6633.869	1186.937	1.711036E-06	38	391.4258	0.1939713	7161.496	1747.484	1.503449E-09	25	352.9421	0.1384403	6654.266	1085.313	4.351223E-05	28	417.523	0.1032118	8505.455	990.4063	1.779105E-05	22	257.6798	0.1908311	3931.939	950.8757	0.009619662	28	380.5956	0.1609264	9009.802	1747.174	3.892484E-12	21	450.5022	FLT3	FLT3_E326_R	4758395	NM_004119.1	FLT3	2322	13	36.1	27572379	326	Y	CGCGGCCCGAGCCAGAGGAGAGACTTCGGAGAAGAGGGAAGAGGAC	FLK2, STK1, CD135	stem cell tyrosine kinase 1; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 3
FLT3_P302_F	4037	0.1875709	1541.635	379.0152	0.378037	32	74.22417	0.0545508	7646.542	446.9622	1.607573E-06	24	227.6095	0.051131	9108.12	496.1911	8.639334E-10	19	794.2933	0.1450207	3469.942	605.53	0.06060701	29	205.5393	0.05420626	6592.679	383.5774	3.202624E-05	28	452.6638	0.06095441	7755.228	509.8909	3.339856E-08	38	315.5425	0.05675074	7997.764	487.2032	4.61519E-06	36	306.6482	0.07472244	9757.676	796.0742	1.096196E-06	27	354.8238	0.08593947	5776.403	552.4962	0.0002631665	32	399.9381	0.04185482	10140.39	447.3329	9.502355E-12	28	300.586	FLT3	FLT3_P302_F	4758395	NM_004119.1	FLT3	2322	13	36.1	27573007	-302	Y	AGTTGCACTGGCTCCGCGGCTCTGCCGCCTTGCTGCCCCTGTGAGTCCCCGA	FLK2, STK1, CD135	stem cell tyrosine kinase 1; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 3
FLT4_E206_F	559	0.04863902	5865.007	304.9653	2.035782E-05	25	131.8491	0.09530569	6382.515	682.9053	4.754087E-05	33	320.267	0.104086	7376.932	868.6589	3.426809E-07	31	310.18	0.09855553	2178.207	249.0779	0.3196377	37	109.085	0.06878179	7522.392	563.0063	6.292462E-07	33	245.1035	0.1225471	7379.181	1044.559	1.596083E-08	23	279.9185	0.09788547	7185.035	790.4752	2.197214E-05	25	351.86	0.1021529	9636.094	1107.728	6.404385E-07	28	366.2365	0.1136685	5963.916	777.6735	7.582804E-05	26	392.089	0.08279299	5831.542	535.4191	0.0002355633	28	188.1278	FLT4	FLT4_E206_F	4503752	NM_002020.1	FLT4	2324	5	36.1	180008966	206	Y	CGTGCTCCCCTCAGGCGTCCGCGCACCAGGGCCACCGTGTCCC	PCL, FLT41, VEGFR3	isoform 2 is encoded by transcript variant 2; fms-related tyrosine kinase-4 (vascular endothelial growth factor receptor 3); Vascular endothelial growth factor receptor 3; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: vascular endothelial growth factor receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 4 isoform 2
FLT4_P180_R	3804	0.09666937	5084.908	554.8597	0.0001416049	24	263.834	0.1031272	10608.51	1231.322	6.660214E-14	21	921.7673	0.08571447	18502.56	1743.994	3.678E-38	31	883.9889	0.3739422	6233.313	3782.866	2.581978E-08	26	434.9609	0.07206312	14091.61	1102.113	4.09451E-25	39	679.7524	0.09542836	11884.98	1264.363	2.005153E-21	29	863.3502	0.1126536	13801.52	1764.877	8.353335E-21	32	826.0064	0.1064526	19318.87	2313.463	1.505091E-28	31	1036.057	0.1255259	8617.226	1251.309	2.439409E-10	22	453.3342	0.1000828	13629.84	1526.941	1.039821E-24	30	678.9154	FLT4	FLT4_P180_R	4503752	NM_002020.1	FLT4	2324	5	36.1	180009352	-180	Y	GGCGTCCGGTGCACCCGAGCAGTGCGCGCTCCGCACCACAGGGTCCGGGCC	PCL, FLT41, VEGFR3	isoform 2 is encoded by transcript variant 2; fms-related tyrosine kinase-4 (vascular endothelial growth factor receptor 3); Vascular endothelial growth factor receptor 3; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: vascular endothelial growth factor receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fms-related tyrosine kinase 4 isoform 2
FMR1_P484_R	814	0.9852691	403.5155	33677.32	3.678E-38	32	1452.253	0.263927	3208.034	1186.131	0.02594287	31	150.1057	0.1859517	4145.356	969.7599	0.005671377	33	179.7423	0.9796019	327.784	20544	1.684178E-36	16	2606.494	0.4237321	2886.492	2195.98	0.005419202	30	190.6329	0.7190191	2620.022	6960.429	4.417664E-11	31	278.8613	0.4879713	2958.952	2915.229	0.004059736	34	278.1016	0.7024534	2770.857	6777.572	1.561715E-05	24	312.6853	0.5977863	2332.057	3614.621	0.0007639197	27	306.6092	0.6344959	2327.766	4214.474	0.0001415666	19	342.9336	FMR1	FMR1_P484_R	50053960	NM_002024.3	FMR1	2332	X	36.1	146800717	-484	Y	CCTCCCGCTCAGTCAGACTGCGCTACTTTGAACCGGACCAAACCAA	FMRP, FRAXA, MGC87458	go_component: polysome; go_component: ribosome; go_component: nucleus; go_component: nucleoplasm; go_component: soluble fraction; go_function: RNA binding; go_function: mRNA binding; go_process: transport; go_process: mRNA processing; go_process: mRNA export from nucleus	fragile X mental retardation 1
FMR1_P62_R	38	0.07432842	1998.2	168.4786	0.2979723	38	51.26334	0.02471321	6914.715	177.7488	4.379199E-05	31	382.9112	0.02810459	9023.714	263.8331	3.840253E-09	26	264.4198	0.05046541	2059.728	114.7842	0.3809724	24	74.19664	0.5004662	4925.857	5035.238	1.675987E-10	35	452.3029	0.4244091	5207.748	3913.641	5.088596E-10	30	442.7534	0.3644312	6186.632	3604.716	4.945385E-08	20	491.4706	0.487677	6888.997	6652.781	6.359719E-11	44	499.9522	0.3523442	5280.935	2927.39	4.103295E-07	28	446.6746	0.4503105	6062.209	5048.136	5.729452E-13	30	321.2802	FMR1	FMR1_P62_R	50053960	NM_002024.3	FMR1	2332	X	36.1	146801139	-62	Y	GGGGGTTCGGCCTCAGTCAGGCGCTCAGCTCCGTTTCGGTTTCACTTC	FMRP, FRAXA, MGC87458	go_component: polysome; go_component: ribosome; go_component: nucleus; go_component: nucleoplasm; go_component: soluble fraction; go_function: RNA binding; go_function: mRNA binding; go_process: transport; go_process: mRNA processing; go_process: mRNA export from nucleus	fragile X mental retardation 1
FN1_E469_F	3293	0.03041369	6276.433	200.014	6.019296E-06	26	154.0287	0.1044362	11194.97	1317.164	1.442714E-15	17	742.7585	0.1356513	11626.58	1840.374	9.106482E-20	31	566.8615	0.2513492	3683.05	1270.107	0.01677908	21	338.3193	0.1441278	10855.07	1844.819	2.708785E-17	27	732.5869	0.223048	10624.57	3078.818	2.304759E-23	28	541.876	0.1551078	9249.447	1716.398	4.321298E-10	27	641.6515	0.1195136	12724.56	1740.753	1.76844E-12	27	628.7601	0.1548284	8126.268	1506.983	7.716289E-10	36	543.5334	0.1307447	14361.04	2175.084	1.204202E-29	23	969.9109	FN1	FN1_E469_F	47132546	NM_054034.2	FN1	2335	2	36.1	216008567	469	Y	AACTTCAGCCCCAACTTTGGTCGGCTTTAGGGTCCCATCCCTGAGGCA	FN, CIG, MSF, FINC, LETS, DKFZp686H0342, DKFZp686I1370, DKFZp686F10164, DKFZp686O13149	isoform 7 preproprotein is encoded by transcript variant 7; cold-insoluble globulin; migration-stimulating factor; migration stimulating factor; go_component: extracellular region; go_component: extracellular matrix (sensu Metazoa); go_component: ER-Golgi intermediate compartment; go_function: heparin binding; go_function: collagen binding; go_function: oxidoreductase activity; go_function: extracellular matrix structural constituent; go_process: metabolism; go_process: cell adhesion; go_process: cell migration; go_process: cell adhesion; go_process: acute-phase response; go_process: response to wounding; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fibronectin 1 isoform 7 preproprotein
FN1_P229_R	815	0.1130812	4486.219	584.7378	0.0008965382	23	141.2105	0.2360062	7791.413	2437.745	2.450758E-10	23	398.4734	0.2393768	8571.61	2729.055	1.068591E-13	26	426.9642	0.05443768	4384.885	258.2027	0.02730431	19	195.3433	0.2649931	7203.898	2633.285	3.071073E-10	20	637.5552	0.2466293	8247.877	2732.827	1.071172E-14	23	657.8637	0.2558658	7707.458	2684.545	4.73754E-09	20	580.8695	0.2844202	9086.425	3651.311	1.155937E-09	33	429.7986	0.259385	7023.717	2494.934	1.336149E-09	27	565.6199	0.2459069	9221.839	3039.817	6.79633E-16	40	310.7578	FN1	FN1_P229_R	47132546	NM_054034.2	FN1	2335	2	36.1	216009265	-229	Y	GCAGCGAACAAAAGAGATGCTGATGGCCCGCCAGGACTGGGGCAAGACAACTT	FN, CIG, MSF, FINC, LETS, DKFZp686H0342, DKFZp686I1370, DKFZp686F10164, DKFZp686O13149	isoform 7 preproprotein is encoded by transcript variant 7; cold-insoluble globulin; migration-stimulating factor; migration stimulating factor; go_component: extracellular region; go_component: extracellular matrix (sensu Metazoa); go_component: ER-Golgi intermediate compartment; go_function: heparin binding; go_function: collagen binding; go_function: oxidoreductase activity; go_function: extracellular matrix structural constituent; go_process: metabolism; go_process: cell adhesion; go_process: cell migration; go_process: cell adhesion; go_process: acute-phase response; go_process: response to wounding; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	fibronectin 1 isoform 7 preproprotein
FOLR1_E368_R	1599	0.5243996	1140.545	1367.832	0.2017929	25	80.98352	0.9485763	636.3328	13582.6	2.92903E-20	26	738.8307	0.955445	599.7096	15004.68	5.998775E-27	28	828.4003	0.2112256	719.4659	219.4445	0.6940833	35	36.56516	0.9449631	589.608	11840.32	1.533195E-16	30	943.087	0.9473609	707.3265	14529.7	3.342434E-29	32	794.8671	0.9438502	626.4824	12211.81	6.114829E-14	26	1045.251	0.9524658	762.7421	17287.18	1.251755E-19	28	591.5534	0.9215266	772.8632	10250.18	5.328041E-13	31	654.1885	0.9557616	641.8833	16028.24	3.765052E-30	42	673.6827	FOLR1	FOLR1_E368_R	12056965	NM_000802.2	FOLR1	2348	11	36.1	71578618	368	N	CCAGAGTGTGGCCTGCTCAAGGTTAAACGACAAGTTAGTGTTCATCCCCCTGAAC	FBP, FOLR, MOv18, FR-alpha	folate binding protein; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: receptor activity; go_function: folic acid binding; go_process: folic acid transport; go_process: receptor mediated endocytosis	folate receptor 1 precursor
FOSL2_E384_R	585	0.2762515	2971.317	1172.307	0.01087151	33	152.6296	0.7011759	4324.691	10382.32	1.003052E-21	36	924.1602	0.7497196	4289.707	13149.45	4.629873E-34	21	1033.288	0.3406439	3674.79	1950.174	0.005144668	19	340.4579	0.7496044	3841.435	11799.4	1.107937E-26	21	1107.276	0.722051	4256.328	11316.79	1.419933E-30	39	903.7995	0.8910234	2679.734	22727.88	3.678E-38	24	1024.523	0.8863471	2942.84	23730.26	3.678E-38	33	875.8617	0.8121005	2261.147	10204.86	8.250779E-17	28	961.8469	0.4879425	6316.567	6114.384	2.367444E-16	30	626.5823	FOSL2	FOSL2_E384_R	44680151	NM_005253.3	FOSL2	2355	2	36.1	28469667	384	Y	CGCCTTTTTGGCCCTGTCTGAAATCGGGGGTCCCCAGGGCTGGCAGGCC	FRA2, FLJ23306	go_component: nucleus; go_function: transcription factor activity; go_process: cell death; go_process: regulation of transcription from RNA polymerase II promoter	FOS-like antigen 2
FRK_P258_F	2195	0.07736735	1685.107	149.6902	0.4074886	32	49.76929	0.8950862	747.8821	7233.815	2.385613E-06	22	328.3994	0.9128314	723.9205	8628.106	2.848123E-09	35	284.908	0.8041138	400.2257	2053.429	0.313481	35	104.5727	0.9148181	581.6989	7321.163	1.259986E-06	37	382.3843	0.9056798	766.0468	8315.943	6.235236E-10	35	518.159	0.9260371	611.4845	8907.997	1.354639E-07	37	278.8698	0.9019494	908.8183	9279.937	2.981659E-06	22	407.0663	0.9046776	638.2439	7006.465	3.53526E-06	27	251.7073	0.9223931	710.98	9638.867	3.240699E-11	37	398.9067	FRK	FRK_P258_F	31657133	NM_002031.2	FRK	2444	6	36.1	116488872	-258	N	CCTTTACCAAACTGTTAAAGCAGCCGCTAAAATCTATATTCCTTTTGTTTCATCCT	GTK, RAK, PTK5	tyrosine-protein kinase FRK; nuclear tyrosine protein kinase RAK; PTK5 protein tyrosine kinase 5; go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: negative regulation of cell proliferation; go_process: regulation of progression through cell cycle	fyn-related kinase
FRK_P36_F	1913	0.227496	1344.247	425.3186	0.4302312	29	80.32732	0.8925427	1141.515	10312.06	5.404664E-13	22	647.9354	0.9028565	967.8704	9924.841	1.086818E-12	36	302.2998	0.2512269	3077.698	1066.175	0.0554054	29	232.5934	0.9154501	655.5478	8180.567	2.968404E-08	34	587.962	0.9083086	901.7236	9923.229	2.885283E-14	40	496.1798	0.9074424	846.0245	9274.902	1.393494E-08	23	596.4478	0.8823931	1223.896	9933.065	1.915603E-07	29	444.8503	0.8840494	966.7791	8133.512	9.283634E-09	23	594.7267	0.9109617	850.8614	9728.375	9.933178E-12	32	321.7859	FRK	FRK_P36_F	31657133	NM_002031.2	FRK	2444	6	36.1	116488650	-36	N	CCTGTTTCAAGTCTGTTCCTGTCTTTCGACCAGTCCGGATCTGGACGGCTCTCT	GTK, RAK, PTK5	tyrosine-protein kinase FRK; nuclear tyrosine protein kinase RAK; PTK5 protein tyrosine kinase 5; go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: negative regulation of cell proliferation; go_process: regulation of progression through cell cycle	fyn-related kinase
FRZB_E186_R	623	0.07083563	8431.22	650.3847	1.030966E-11	32	300.6071	0.2918397	9972.12	4150.819	5.603431E-20	24	622.6602	0.2371256	12762.54	3998.086	2.500966E-31	20	655.8536	0.03411379	8383.385	299.6216	2.422365E-06	26	294.1715	0.2958426	9334.524	3963.792	4.99741E-19	28	657.0703	0.4055316	9016.352	6218.95	3.396532E-29	27	757.8193	0.2554492	9708.724	3365.292	1.787236E-14	30	995.8539	0.2420786	12019.71	3871.012	4.13429E-15	30	527.3254	0.2409659	8984.962	2884.148	3.614251E-15	24	794.67	0.1967298	13240.63	3267.269	1.536298E-29	27	513.3208	FRZB	FRZB_E186_R	38455387	NM_001463.2	FRZB	2487	2	36.1	183439557	186	Y	CAGGATGGGGCAGGGTGCAGCCGCGCAGTGGACGCCAAAAGGCCCGCT	FRE, FZRB, hFIZ, FRITZ, FRP-3, FRZB1, SFRP3, SRFP3, FRZB-1, FRZB-PEN	frizzled (Drosophila) homolog-related; go_component: membrane; go_component: extracellular region; go_function: Wnt-protein binding; go_process: cell differentiation; go_process: skeletal development; go_process: Wnt receptor signaling pathway; go_process: negative regulation of Wnt receptor signaling pathway	frizzled-related protein
FRZB_P406_F	4041	0.1542529	6254.372	1158.952	9.293469E-08	23	328.6433	0.07838368	9009.579	774.7718	1.86041E-09	28	522.0331	0.07329484	10569.94	843.9051	5.517596E-14	22	448.5735	0.1050482	3651.089	440.2977	0.05936389	28	189.4208	0.05784525	9038.719	561.0877	9.560999E-10	19	562.0823	0.1059102	9283.56	1111.538	4.085015E-13	22	434.1769	0.07177418	8168.297	639.3383	1.61721E-06	29	715.9293	0.06007001	11078.95	714.436	2.689149E-08	29	426.2746	0.08533117	7261.567	686.7744	1.133897E-06	33	400.9579	0.04770261	10048.91	508.3806	1.113729E-11	28	460.8452	FRZB	FRZB_P406_F	38455387	NM_001463.2	FRZB	2487	2	36.1	183440149	-406	Y	GGGACGTCTGTGCCTCTGCCCGGGCGGCTCTGCACTTTCCTACCTCCCGC	FRE, FZRB, hFIZ, FRITZ, FRP-3, FRZB1, SFRP3, SRFP3, FRZB-1, FRZB-PEN	frizzled (Drosophila) homolog-related; go_component: membrane; go_component: extracellular region; go_function: Wnt-protein binding; go_process: cell differentiation; go_process: skeletal development; go_process: Wnt receptor signaling pathway; go_process: negative regulation of Wnt receptor signaling pathway	frizzled-related protein
FVT1_P225_F	4044	0.5626822	16739.11	21666.31	3.678E-38	24	791.1844	0.08040059	13528.7	1191.558	9.136394E-22	31	773.8519	0.06853555	18198.02	1346.337	3.678E-38	29	944.1709	0.5271783	9940.971	11195.31	1.852348E-37	28	1826.528	0.08441997	14435.31	1340.211	3.650832E-27	31	865.814	0.09562538	14580.51	1552.266	6.226599E-33	30	639.9905	0.08257607	15174.42	1374.829	1.208213E-23	29	1180.834	0.09789012	17259.83	1883.757	3.654962E-22	28	721.9677	0.1109231	10716.92	1349.542	1.060483E-15	22	1357.049	0.08014978	17600.27	1542.287	3.678E-38	25	931.3666	FVT1	FVT1_P225_F	4503816	NM_002035.1	FVT1	2531	18	36.1	59185663	-225	Y	CAGCCTCTCCCGTGGAAACCGGGCCTCCCGTCCCTGTGCGTCGC	.	go_component: integral to membrane; go_component: endoplasmic reticulum; go_component: extracellular space; go_function: oxidoreductase activity; go_function: 3-dehydrosphinganine reductase activity; go_process: metabolism	follicular lymphoma variant translocation 1
FYN_P352_R	4057	0.7802384	3089.185	11322.84	1.074183E-30	29	1198.419	0.04688971	11852.96	588.0441	2.188695E-15	32	910.3408	0.04150929	18151.04	790.3962	3.678E-38	27	918.8453	0.5812647	4005.562	5699.111	7.971595E-08	21	509.1685	0.0521351	12769.16	707.8381	1.457298E-19	26	1066.558	0.06997447	15495.54	1173.397	2.810727E-35	34	844.2077	0.06345463	14421.41	983.8828	2.337688E-20	26	928.3092	0.04763039	18168.6	913.6585	5.12145E-22	20	1058.36	0.07320276	9478.107	756.5235	3.808725E-11	28	598.852	0.09011174	14754.75	1471.156	1.707579E-28	30	969.0845	FYN	FYN_P352_R	23510363	NM_153048.1	FYN	2534	6	36.1	112301672	-352	Y	AGAGCGGAGAGTGTGAACTGCAGTTTCCGCTTTGCGGAAGGTTGCAGCTG	SLK, SYN, MGC45350	isoform c is encoded by transcript variant 3; proto-oncogene tyrosine-protein kinase fyn; src/yes-related novel gene; src-like kinase; c-syn protooncogene; tyrosine kinase p59fyn(T); OKT3-induced calcium influx regulator; go_component: cellular component unknown; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein self binding; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: learning; go_process: feeding behavior; go_process: calcium ion transport; go_process: protein kinase cascade; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: T cell receptor signaling pathway; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	protein-tyrosine kinase fyn isoform c
FZD7_E296_F	1600	0.2953618	972.8138	449.6892	0.5532972	20	68.26344	0.08068272	5879.816	524.811	0.0003150611	24	432.2261	0.04856009	7034.405	364.1295	8.272121E-06	19	326.073	0.1951438	666.0839	185.7432	0.7138179	31	49.39523	0.06352067	5887.545	406.1306	0.0002554841	30	402.3576	0.07099996	8069.853	624.3909	4.360027E-09	27	378.6157	0.07410294	7468.242	605.7142	1.640053E-05	32	388.4773	0.07613908	8440.171	703.8298	4.164363E-05	19	338.685	0.1117308	6101.896	780.1045	4.85602E-05	30	350.5141	0.04437262	7145.581	336.4339	6.914202E-06	34	295.2482	FZD7	FZD7_E296_F	4503832	NM_003507.1	FZD7	8324	2	36.1	202607851	296	Y	TGCTGGGCCACACGAACCAAGAGGACGCGGGCCTCGAGGTGCACCAGTTCT	FzE3	Frizzled, drosophila, homolog of, 7; frizzled (Drosophila) homolog 7; go_component: plasma membrane; go_component: integral to membrane; go_function: receptor activity; go_function: Wnt receptor activity; go_function: G-protein coupled receptor activity; go_process: development; go_process: frizzled signaling pathway; go_process: G-protein coupled receptor protein signaling pathway	frizzled 7
FZD9_E458_F	5551	0.3607177	4133.231	2388.618	4.994616E-06	17	171.328	0.2986873	9007.156	3878.715	1.545458E-16	24	728.1984	0.3343024	11340.01	5744.984	1.278806E-32	19	1017.607	0.2721789	4105.312	1572.635	0.004651691	20	191.4814	0.3104238	8404.443	3828.412	5.291944E-16	34	677.7164	0.411959	7045.521	5005.878	7.587201E-18	36	464.4562	0.3434837	9098.102	4812.367	1.848142E-16	41	493.8938	0.3482637	12578.41	6774.873	1.142845E-22	35	928.7355	0.3240691	8407.798	4078.989	7.205956E-17	22	960.0983	0.2352096	9883.597	3070.433	8.206339E-18	30	629.7054	FZD9	FZD9_E458_F	62865872	NM_003508.2	FZD9	8326	7	36.1	72486503	458	Y	GCGGCTGCCGAGCTAGCGGAGTTCGCGCCGCTGGTGCAGTACGGCTGCC	FZD3	frizzled (Drosophila) homolog 9; go_component: plasma membrane; go_component: integral to membrane; go_function: receptor activity; go_function: Wnt receptor activity; go_function: G-protein coupled receptor activity; go_process: development; go_process: frizzled signaling pathway; go_process: nervous system development; go_process: G-protein coupled receptor protein signaling pathway	frizzled 9
FZD9_P15_R	4880	0.100058	1472.891	174.8784	0.4732619	31	58.32843	0.04568341	9371.532	453.405	1.552936E-09	25	306.841	0.04259933	8917.196	401.2181	3.329315E-09	32	262.6988	0.03470874	4784.72	175.6387	0.01658315	29	210.368	0.0401073	7954.794	336.5544	2.810441E-07	30	260.6248	0.05619186	8401.087	506.1324	1.516818E-09	23	294.4342	0.06272887	8531	577.6481	5.827986E-07	23	289.3692	0.05400589	10379.86	598.2852	3.250934E-07	34	381.143	0.06670347	7538.347	545.9189	6.697643E-07	26	316.6664	0.05740898	6899.799	426.3263	1.180192E-05	36	163.4234	FZD9	FZD9_P15_R	62865872	NM_003508.2	FZD9	8326	7	36.1	72486030	-15	Y	GGGGCTGGTAGCCTCGGCCCCGGGAGGTTGCGCCGGCTCTGGCTCAGCGG	FZD3	frizzled (Drosophila) homolog 9; go_component: plasma membrane; go_component: integral to membrane; go_function: receptor activity; go_function: Wnt receptor activity; go_function: G-protein coupled receptor activity; go_process: development; go_process: frizzled signaling pathway; go_process: nervous system development; go_process: G-protein coupled receptor protein signaling pathway	frizzled 9
FZD9_P175_F	4876	0.1573761	4400.731	840.5977	0.0005290868	26	124.3296	0.09097653	11417.99	1152.739	1.021431E-15	23	929.8274	0.0749865	16291.6	1328.79	8.22991E-35	29	706.4904	0.09669448	4838.525	528.6452	0.008267761	31	262.8262	0.1246751	11319.97	1626.58	5.357141E-18	34	544.6182	0.2005934	11895.3	3009.955	7.009315E-28	26	921.6603	0.1575064	11736.72	2212.905	1.480326E-16	25	1173.775	0.1349841	14110.74	2217.56	5.656831E-16	34	665.3862	0.1552927	8941.44	1662.196	5.406496E-12	28	896.6912	0.1753424	14407.55	3084.66	2.396802E-33	37	636.1118	FZD9	FZD9_P175_F	62865872	NM_003508.2	FZD9	8326	7	36.1	72485870	-175	Y	CAGGCAGCAAGGGAAGGGAAGAAACCGAGTGTAAGCGGAGGGCAAGCG	FZD3	frizzled (Drosophila) homolog 9; go_component: plasma membrane; go_component: integral to membrane; go_function: receptor activity; go_function: Wnt receptor activity; go_function: G-protein coupled receptor activity; go_process: development; go_process: frizzled signaling pathway; go_process: nervous system development; go_process: G-protein coupled receptor protein signaling pathway	frizzled 9
G6PD_E190_F	1340	0.04363541	3869.215	181.1007	0.01349915	31	197.11	0.03025553	8108.327	256.0956	6.013417E-07	33	331.1219	0.0411186	10208	442.0262	4.12159E-12	31	481.4189	0.1125674	1159.565	159.771	0.6017777	37	47.43893	0.540543	6233.156	7450.844	3.415845E-20	33	592.1678	0.5622409	5301.246	6937.151	1.975258E-18	35	588.6098	0.4106054	6933.445	4899.893	8.694281E-12	26	721.0574	0.5208144	7283.58	8025.02	5.3052E-14	24	513.7593	0.5629902	4533.542	5969.291	9.290089E-12	23	406.9261	0.4578196	6943.466	5947.535	1.240785E-17	29	571.8789	G6PD	G6PD_E190_F	21361093	NM_003639.2	IKBKG	8517	X	36.1	153428473	-783	Y	CGCCGGCTGCCTGCCATACCCGCTGCCGCTGCTCTGCATCCCCAATT	IP, IP2, FIP3, NEMO, FIP-3, Fip3p, IKK-gamma	NFkappaB essential modulator; go_component: nucleus; go_function: kinase activity; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: signal transducer activity; go_process: transcription; go_process: immune response; go_process: induction of apoptosis; go_process: I-kappaB kinase/NF-kappaB cascade; go_process: regulation of transcription, DNA-dependent	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
G6PD_P1065_R	822	0.05474163	6188.487	364.1777	4.39652E-06	24	175.6272	0.1586859	7248.74	1386.096	2.169591E-07	27	337.7054	0.10888	7965.672	985.4904	1.755086E-08	29	352.8597	0.03319148	5213.182	182.4067	0.007856504	30	217.1574	0.8116246	2233.791	10055.25	3.725787E-16	27	992.0594	0.7584641	3018.724	9793.325	2.74703E-20	41	842.1455	0.8196442	2711.011	12774.91	1.398819E-20	27	1102.788	0.8029528	3374.962	14160.21	1.710982E-18	36	588.3212	0.8350623	2226.709	11779.89	1.786236E-21	22	596.6744	0.8000544	2893.476	11977.97	9.520642E-24	32	539.0756	G6PD	G6PD_P1065_R	21361093	NM_003639.2	IKBKG	8517	X	36.1	153429728	472	Y	CCGTTGTAGGGAGATTGGCTTTTACGCAGAAGGCAACGGGGATCCATG	IP, IP2, FIP3, NEMO, FIP-3, Fip3p, IKK-gamma	NFkappaB essential modulator; go_component: nucleus; go_function: kinase activity; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: signal transducer activity; go_process: transcription; go_process: immune response; go_process: induction of apoptosis; go_process: I-kappaB kinase/NF-kappaB cascade; go_process: regulation of transcription, DNA-dependent	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
G6PD_P196_F	5723	0.193852	3088.612	766.7559	0.02079822	25	187.1902	0.04186361	10117.18	446.4166	4.985513E-11	19	805.1675	0.05106708	11704.2	635.246	1.861595E-16	29	717.1993	0.0701384	5850.443	448.8351	0.001314022	31	245.9887	0.5588014	5282.848	6817.661	1.200792E-15	34	630.7385	0.4712899	7856.896	7092.743	4.685479E-28	29	1003.088	0.5467057	6940.623	8491.501	1.971167E-20	31	1000.796	0.5682065	7789.258	10381.65	6.687629E-20	38	869.464	0.6187438	5318.931	8794.429	8.049923E-22	33	540.1087	0.4527094	8361.841	6999.489	2.065329E-25	33	740.5922	G6PD	G6PD_P196_F	21361093	NM_003639.2	IKBKG	8517	X	36.1	153428859	-397	Y	GGCGGTGACGCCCTGCAAAGTGGCCGGCGTGCTTATCATTACCGAGCTTCCGC	IP, IP2, FIP3, NEMO, FIP-3, Fip3p, IKK-gamma	NFkappaB essential modulator; go_component: nucleus; go_function: kinase activity; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: signal transducer activity; go_process: transcription; go_process: immune response; go_process: induction of apoptosis; go_process: I-kappaB kinase/NF-kappaB cascade; go_process: regulation of transcription, DNA-dependent	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
G6PD_P597_F	839	0.2447691	1873.868	639.7272	0.2004843	28	120.4811	0.4833025	3283.188	3164.528	0.0002803967	38	318.8501	0.5171946	3689.81	4059.749	2.325897E-06	26	309.0097	0.0808363	2848.326	259.292	0.1801174	22	172.4629	0.7767737	2152.561	7838.37	1.446667E-10	23	433.4387	0.7428073	2361.017	7107.748	8.110364E-11	27	456.6578	0.7871175	2112.391	8180.153	7.065712E-09	33	411.8135	0.755824	2991.709	9570.095	2.122042E-09	33	323.1428	0.7974389	1904.688	7892.021	3.4791E-10	26	438.2715	0.7366033	2375.136	6921.854	5.02662E-09	40	329.4493	G6PD	G6PD_P597_F	21361093	NM_003639.2	IKBKG	8517	X	36.1	153429260	4	Y	CTTTTTTGGGCCCCAGCCCGTTCCTGCTCCGCGCTTCTGGAGCACTGG	IP, IP2, FIP3, NEMO, FIP-3, Fip3p, IKK-gamma	NFkappaB essential modulator; go_component: nucleus; go_function: kinase activity; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: signal transducer activity; go_process: transcription; go_process: immune response; go_process: induction of apoptosis; go_process: I-kappaB kinase/NF-kappaB cascade; go_process: regulation of transcription, DNA-dependent	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
GABRA5_E44_R	3295	0.6990906	2341.757	5672.835	4.476064E-09	29	364.3879	0.786987	2613.901	10026.64	6.752929E-16	30	487.3658	0.7576663	3010.109	9723.889	1.408849E-17	22	1070.09	0.4759152	2140.557	2034.623	0.05314529	27	177.176	0.77777	2709.396	9832.445	7.511479E-17	33	864.043	0.7871156	3161.402	12058.66	3.912538E-29	23	654.2407	0.7878259	2736.19	10531.09	6.39584E-15	25	714.2478	0.7480198	3953.087	12031.86	2.707894E-15	31	704.9731	0.8307248	1796.512	9307.209	3.371136E-13	31	598.7723	0.7434965	3456.693	10309.36	3.254112E-20	37	550.7309	GABRA5	GABRA5_E44_R	6031207	NM_000810.2	GABRA5	2558	15	36.1	24742740	44	N	CCCATGCAGCTTGAGGACTTCCCGATGGATGCGCACGCTTGCCCTCTGAAATTT	.	putative; go_component: postsynaptic membrane; go_component: integral to plasma membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: transporter activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: chloride transport; go_process: signal transduction; go_process: gamma-aminobutyric acid signaling pathway	gamma-aminobutyric acid (GABA) A receptor, alpha 5 precursor
GABRA5_P1016_F	844	0.7669281	865.2351	3176.126	0.01377802	25	193.5462	0.9326233	1386.523	20576.34	3.678E-38	28	1279.782	0.9495707	1219.364	24843.3	3.678E-38	40	1060.869	0.8124899	415.9322	2235.558	0.2690263	32	93.76265	0.9218952	1202.822	15377.62	3.851734E-30	23	1119.523	0.9147493	1595.759	18195.66	3.678E-38	32	1202.525	0.9425299	1081.93	19384.06	6.749721E-37	31	1275.51	0.9236215	1657.888	21257.6	3.545008E-32	32	1140.834	0.8972774	1222.647	11553.25	1.066117E-17	26	1423.604	0.9454209	1101.733	20816.45	3.678E-38	27	720.1697	GABRA5	GABRA5_P1016_F	6031207	NM_000810.2	GABRA5	2558	15	36.1	24741680	-1016	N	TGGTAGAGAAATGAAAGCACCACAGTGTGGCGGCTCTGGGAGTGCACTGGC	.	putative; go_component: postsynaptic membrane; go_component: integral to plasma membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: transporter activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: chloride transport; go_process: signal transduction; go_process: gamma-aminobutyric acid signaling pathway	gamma-aminobutyric acid (GABA) A receptor, alpha 5 precursor
GABRA5_P862_R	840	0.5458235	736.0533	1004.758	0.4403349	29	74.94803	0.9168441	1183.107	14147.04	1.123249E-23	23	1085.531	0.9334801	1188.932	18087.71	3.678E-38	39	519.0718	0.3029561	331.5638	187.5705	0.7831202	42	14.25658	0.9150116	1238.295	14408.51	1.054938E-26	28	622.4677	0.9031956	1342.018	13454.18	1.875152E-27	29	882.8384	0.9191675	1209.98	14896.12	2.435643E-22	23	910.1568	0.9100776	1573.05	16932.45	1.152953E-20	30	484.5793	0.8748077	1091.125	8323.237	2.187329E-09	25	728.4382	0.9298187	1171.776	16849.52	1.710213E-35	29	603.3062	GABRA5	GABRA5_P862_R	6031207	NM_000810.2	GABRA5	2558	15	36.1	24741834	-862	N	AGCAGCTCTGCATTCTAGGCCCCGAATTCCTTAATATCCGCACCTCACTT	.	putative; go_component: postsynaptic membrane; go_component: integral to plasma membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: transporter activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: chloride transport; go_process: signal transduction; go_process: gamma-aminobutyric acid signaling pathway	gamma-aminobutyric acid (GABA) A receptor, alpha 5 precursor
GABRB3_E42_F	3299	0.03892963	5385.371	222.1934	0.0001582228	32	200.6593	0.1170712	8992.773	1205.648	2.828662E-10	34	576.4809	0.08914088	12044.05	1188.473	4.729302E-19	23	621.4272	0.04951955	3352.02	179.8485	0.1164018	30	123.3976	0.09826236	10945.52	1203.63	8.895894E-16	31	554.2266	0.1381214	11218.62	1813.879	5.008567E-21	34	895.0424	0.06986541	10842.71	821.9423	1.909127E-11	31	557.4999	0.1011312	15217.05	1723.312	3.162527E-17	26	832.4955	0.1233398	8484.971	1207.844	5.782893E-10	37	616.944	0.06501762	12777.36	895.4771	6.258857E-20	27	666.1707	GABRB3	GABRB3_E42_F	30061561	NM_021912.2	GABRB3	2562	15	36.1	24569978	42	Y	CGGAGCACATGGCGCTGTTCCTCCGGCCTAACCTGCTGGGATCCGCTCTCC	MGC9051	isoform 2 is encoded by variant 2 isoform 2 precursor is encoded by transcript variant 2; go_component: postsynaptic membrane; go_component: integral to plasma membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: signal transduction	gamma-aminobutyric acid (GABA) A receptor, beta 3 isoform 2 precursor
GABRB3_P92_F	861	0.8429649	1654.99	9420.792	1.117128E-17	27	495.2633	0.3734755	7072.019	4275.289	9.48237E-13	22	516.3589	0.3501093	7678.684	4190.535	3.575209E-15	23	438.677	0.8690503	1046.224	7606.938	2.659053E-06	26	775.7293	0.3186682	7324.105	3472.356	2.245803E-12	25	504.3094	0.4011049	6012.598	4093.86	2.258962E-12	28	895.2523	0.3768095	7616.604	4665.813	1.004937E-12	35	535.0761	0.371714	7899.688	4732.87	1.664029E-09	26	403.2847	0.4412361	4893.057	3942.841	2.996622E-08	19	1220.699	0.3999307	6781.049	4586.042	1.361862E-13	27	455.7543	GABRB3	GABRB3_P92_F	30061561	NM_021912.2	GABRB3	2562	15	36.1	24570112	-92	Y	CTTCCAGCCCCTGCCGTGGCGGCCCTATTTTTCATTTATACAATTGGACCT	MGC9051	isoform 2 is encoded by variant 2 isoform 2 precursor is encoded by transcript variant 2; go_component: postsynaptic membrane; go_component: integral to plasma membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: signal transduction	gamma-aminobutyric acid (GABA) A receptor, beta 3 isoform 2 precursor
GABRG3_E123_R	3303	0.7105575	671.8699	1894.877	0.1874494	29	69.55748	0.9512082	588.6008	13424.46	1.170422E-19	28	953.1276	0.9647011	588.9249	18827.96	3.678E-38	19	1245.628	0.8233065	440.8066	2519.898	0.2065179	29	144.3263	0.9536366	532.3026	13005.68	9.52892E-20	34	1202.824	0.9587891	666.8001	17839.94	3.678E-38	17	1305.426	0.9568208	664.5536	16941.97	6.456001E-27	30	1174.292	0.9616653	737.5235	21010.13	7.25849E-29	26	1209.504	0.9209109	829.7118	10825.54	1.329445E-14	25	786.3408	0.9691367	585.3658	21521.14	3.678E-38	25	630.7557	GABRG3	GABRG3_E123_R	15193297	NM_033223.1	GABRG3	2567	15	36.1	25343888	123	N	CCGTACAACTCCCCTGGGAGACGACAGCTGGAGGCCCCTGGCTTGTTGACTGC	.	go_component: integral to membrane; go_component: postsynaptic membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: chloride transport; go_process: synaptic transmission; go_process: gamma-aminobutyric acid signaling pathway	gamma-aminobutyric acid (GABA) A receptor, gamma 3
GABRG3_P75_F	864	0.5497801	679.5073	951.8852	0.4790831	30	46.80571	0.8369443	1569.696	8570.339	3.709328E-10	32	329.9411	0.8660631	1306.304	9093.446	1.571189E-11	30	333.8507	0.9501333	400.411	9534.55	3.477734E-08	22	470.952	0.8614411	1168.307	7885.248	1.154542E-08	35	356.9445	0.8590159	1345.393	8806.778	1.7294E-12	27	338.0966	0.8753784	1157.157	8830.636	2.33831E-08	32	241.5677	0.8610502	1246.774	8345.754	1.39906E-05	30	480.5977	0.8560252	1272.155	8158.367	2.027349E-09	23	348.3329	0.8509843	1321.905	8120.074	2.604982E-09	24	215.0097	GABRG3	GABRG3_P75_F	15193297	NM_033223.1	GABRG3	2567	15	36.1	25343690	-75	N	TTCAGAGCATAGCAGGGGCCTAGGGCCATGCGATATCAGCTTGACCTCTGGAGGG	.	go_component: integral to membrane; go_component: postsynaptic membrane; go_function: ion channel activity; go_function: GABA-A receptor activity; go_function: neurotransmitter receptor activity; go_function: extracellular ligand-gated ion channel activity; go_process: ion transport; go_process: chloride transport; go_process: synaptic transmission; go_process: gamma-aminobutyric acid signaling pathway	gamma-aminobutyric acid (GABA) A receptor, gamma 3
GADD45A_P737_R	5733	0.1503125	5238.097	944.3268	1.940155E-05	26	333.0555	0.2758079	8834.499	3402.696	7.118036E-15	33	582.2128	0.2614051	9303.735	3328.191	2.77164E-17	31	526.7669	0.1679033	5446.696	1119.232	0.0007286098	26	200.0499	0.2572679	8378.424	2936.761	1.261262E-13	37	485.1531	0.3972481	7820.686	5220.188	4.691802E-21	37	514.4039	0.2974354	8361.387	3582.184	5.163419E-12	22	670.0601	0.2777364	9633.056	3742.711	1.176864E-10	41	416.5962	0.3180167	7520.825	3553.68	3.980715E-13	28	556.6239	0.2378471	9021.086	2846.443	7.428682E-15	28	457.0518	GADD45A	GADD45A_P737_R	9790904	NM_001924.2	GADD45A	1647	1	36.1	67922734	-737	N	ATGTGGTCACCAGCTCCCCACGCAGACCAGCTCACGATTTCCCA	DDIT1, GADD45	DNA damage-inducible transcript 1; DNA damage-inducible transcript-1; DNA-damage-inducible transcript 1; go_component: nucleus; go_process: cell cycle; go_process: apoptosis; go_process: DNA repair; go_process: cell cycle arrest; go_process: regulation of cyclin dependent protein kinase activity	growth arrest and DNA-damage-inducible, alpha
GAGE7B_P686_F	885	0.8288298	921.0791	4944.207	6.369208E-05	26	184.3462	0.9533083	977.1408	21992.1	3.678E-38	23	1449.248	0.9603574	1002.556	26709.83	3.678E-38	34	1143.363	0.710245	1471.234	3851.394	0.008950436	21	212.4152	0.9649575	1074.568	32343.85	3.678E-38	17	876.3954	0.9547914	1429.802	32308.94	3.678E-38	25	751.9651	0.9657231	1131.378	34693.08	3.678E-38	22	673.4513	0.9639164	1281.247	36897.88	3.678E-38	24	670.6259	0.938863	1069.627	17961.62	3.678E-38	29	1995.734	0.9654027	1060.299	32377.02	3.678E-38	28	704.2596	GAGE7B	GAGE7B_P686_F	11024640	NM_021123.1	GAGE7	2579	X	36.1	49102935	-661	N	GGTGTTGGGAACCGTGCACTTTCCGCTGCTGTGGGAGCATGTCCTT	GAGE-7	synonym: GAGE-7	G antigen 7
GALR1_E52_F	3314	0.05822752	3471.515	220.8181	0.02924464	26	166.2108	0.05853751	10608.18	665.8047	1.392755E-12	31	606.9918	0.05182494	12599.81	694.1408	3.081043E-19	22	622.3405	0.0929838	2472.368	263.7092	0.2510345	34	99.28278	0.06350169	10765.37	736.7548	4.301576E-14	29	557.0215	0.08520878	10449.82	982.6693	5.515774E-16	30	778.4703	0.0903451	10810.92	1083.65	6.513844E-12	30	581.8492	0.07807003	12332.69	1052.814	1.135413E-10	36	529.5291	0.1002748	7306.803	825.4915	5.546338E-07	32	356.9969	0.03828209	13644.94	547.1304	1.536913E-21	27	653.5709	GALR1	GALR1_E52_F	6031165	NM_001480.2	GALR1	2587	18	36.1	73090773	52	Y	GCTCGCGCACCGTGACTTCTAAGGGGCGCGGATTTCAGCCGAGCTGTTTTC	GALNR, GALNR1	go_component: plasma membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: galanin receptor activity; go_function: galanin receptor activity; go_function: rhodopsin-like receptor activity; go_process: ion transport; go_process: digestion; go_process: signal transduction; go_process: synaptic transmission; go_process: neuropeptide signaling pathway; go_process: G-protein coupled receptor protein signaling pathway; go_process: negative regulation of adenylate cyclase activity	galanin receptor 1
GALR1_P80_F	889	0.2437938	2957.215	985.6175	0.01718924	28	143.0449	0.04291093	6698.208	304.7965	5.73823E-05	31	404.8878	0.03179177	12068.93	399.5751	8.083699E-17	25	614.8138	0.1037212	3840.773	456.043	0.04505008	21	239.9324	0.03999656	9256.989	389.8396	7.654428E-10	27	524.317	0.0353163	10380.07	383.6672	4.240086E-14	29	602.8041	0.05749697	8798.688	542.8605	2.572499E-07	25	478.2143	0.04409403	9165.614	427.4042	1.397346E-05	34	537.5624	0.06974826	6365.645	484.78	5.373233E-05	27	387.5346	0.03145668	9495.242	311.6376	4.725689E-10	26	358.521	GALR1	GALR1_P80_F	6031165	NM_001480.2	GALR1	2587	18	36.1	73090641	-80	Y	CCTGGCCCGCGGCATCCGGCAGCCCCGCCTTCAGCCCGCCGGGCAGGTCC	GALNR, GALNR1	go_component: plasma membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: galanin receptor activity; go_function: galanin receptor activity; go_function: rhodopsin-like receptor activity; go_process: ion transport; go_process: digestion; go_process: signal transduction; go_process: synaptic transmission; go_process: neuropeptide signaling pathway; go_process: G-protein coupled receptor protein signaling pathway; go_process: negative regulation of adenylate cyclase activity	galanin receptor 1
GAS1_E22_F	1343	0.05334596	6336.667	362.7198	2.371551E-06	21	337.7126	0.03852757	12700.72	512.9431	2.049871E-17	29	778.4541	0.03017045	16400.98	513.3295	6.16163E-32	24	1161.89	0.07815752	5749.112	495.9113	0.001476381	31	205.7227	0.02937697	12652.3	385.9624	2.90618E-18	25	1131.266	0.03582683	14938.79	558.8124	2.906836E-30	31	698.0344	0.03692409	13807.7	533.2178	1.549885E-17	31	808.2324	0.04517412	16664.39	793.1461	2.519809E-18	23	706.196	0.05817603	9741.552	607.9081	2.092669E-11	33	764.4569	0.03603032	13421.72	505.4017	1.038753E-20	24	549.3396	GAS1	GAS1_E22_F	4503918	NM_002048.1	GAS1	2619	9	36.1	88751902	22	Y	GCCTGCAGATCCGTTGTGCGGCCGGCTGTCCCCGTGCCGGCTGCTCGC	.	Growth arrest-specific gene-1; go_component: membrane; go_component: anchored to plasma membrane; go_function: molecular function unknown; go_process: cell cycle; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: negative regulation of S phase of mitotic cell cycle	growth arrest-specific 1
GAS1_P754_R	5626	0.06044299	3758.156	248.2005	0.01491632	20	101.3977	0.02383621	10195.03	251.3867	8.768531E-11	21	752.8979	0.01757813	12759.25	230.0862	2.522888E-18	25	628.9396	0.0311272	4994.872	163.6841	0.01190893	23	216.5542	0.02098599	11289.08	244.1346	3.589991E-14	27	583.2347	0.02514168	10498.66	273.3403	4.026083E-14	35	742.0291	0.02104198	11720.12	254.0647	4.463417E-12	36	495.5096	0.02246984	13081.59	302.9964	1.139262E-10	30	718.4987	0.04769155	7331.122	372.1501	2.850939E-06	24	607.9562	0.02122113	12923.11	282.3571	1.541839E-18	22	529.8531	GAS1	GAS1_P754_R	4503918	NM_002048.1	GAS1	2619	9	36.1	88752678	-754	Y	AAGGAGGCTCGGATATGCAGCCCCAGCTCGCGCACAGAACCAGCGGGCAGGGCT	.	Growth arrest-specific gene-1; go_component: membrane; go_component: anchored to plasma membrane; go_function: molecular function unknown; go_process: cell cycle; go_process: cell cycle arrest; go_process: negative regulation of cell proliferation; go_process: negative regulation of S phase of mitotic cell cycle	growth arrest-specific 1
GAS7_E148_F	606	0.04254019	5112.296	231.5837	0.0003811769	30	273.2748	0.05121147	10966.78	597.3364	2.992538E-13	32	690.9597	0.03983497	14686.58	613.4603	7.466257E-26	31	668.8661	0.03998376	4473.369	190.4765	0.02645885	23	381.6336	0.04952169	10320.74	542.9399	1.559954E-12	30	761.2694	0.04920448	11304.11	590.1725	2.308037E-17	28	795.9248	0.05042512	11201.2	600.1255	1.010433E-11	22	964.8657	0.04775991	14676.52	741.1214	3.316194E-14	28	946.139	0.05586918	7941.263	475.8438	1.76273E-07	20	590.2408	0.05212313	11973.48	663.9126	6.399714E-17	23	703.8835	GAS7	GAS7_E148_F	41406075	NM_003644.2	GAS7	8522	17	36.1	10042445	148	Y	CCGGACATGGCCTTGGCGCCCGGGTTCACAGCGCAGCCTGCATTCC	MGC1348, KIAA0394	isoform a is encoded by transcript variant a; go_function: transcription factor activity; go_process: cell differentiation; go_process: cell cycle arrest; go_process: nervous system development	growth arrest-specific 7 isoform a
GAS7_P622_R	4060	0.1019871	1534.239	185.6001	0.4477291	37	49.71314	0.4679728	4237.062	3814.894	1.86296E-06	27	273.0553	0.44211	5371.954	4336.348	5.22624E-10	28	280.7142	0.0552768	3823.257	229.5541	0.06241217	24	129.0427	0.4699636	4294.096	3896.082	4.188246E-07	21	354.0215	0.4262084	4566.919	3466.555	9.528713E-08	27	283.5758	0.451497	4546.15	3824.452	6.617929E-06	26	365.3481	0.5125386	4259.602	4583.879	8.355068E-05	21	484.7929	0.508761	3640.584	3874.006	5.661259E-06	29	396.1703	0.4842301	4142.495	3983.062	6.588905E-07	23	259.8404	GAS7	GAS7_P622_R	41406075	NM_003644.2	GAS7	8522	17	36.1	10043215	-622	Y	AACCTGGGGTTGAACTTGTCTCACCGGAAACTGAACAATGGGTGAA	MGC1348, KIAA0394	isoform a is encoded by transcript variant a; go_function: transcription factor activity; go_process: cell differentiation; go_process: cell cycle arrest; go_process: nervous system development	growth arrest-specific 7 isoform a
GATA6_P21_R	5858	0.09643278	8762.294	945.8242	1.926985E-13	31	364.6158	0.04750756	13582.1	682.4233	2.148715E-20	34	849.9747	0.03461189	18722.18	674.8284	3.678E-38	32	1240.491	0.06158873	9929.98	658.2761	2.930632E-09	25	462.8577	0.03560097	14347.93	533.3481	4.761923E-24	39	1015.014	0.0470116	15965.14	792.5047	1.128833E-35	27	1388.48	0.06598789	16723.91	1188.608	6.620272E-28	23	1659.914	0.05381503	18530.86	1059.645	3.016227E-23	27	1041.902	0.06326044	12032.77	819.3571	6.388254E-18	31	979.5222	0.04678856	16849.13	831.9512	4.182132E-34	26	1139.569	GATA6	GATA6_P21_R	40288196	NM_005257.3	GATA6	2627	18	36.1	18003393	-21	Y	CAGCGCCCAGCTGCTCGCTGAGCGCAGTTCCGACCCACAGCCTGGC	.	GATA-binding protein 6; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcriptional activator activity; go_process: transcription; go_process: muscle development; go_process: positive regulation of transcription; go_process: regulation of transcription, DNA-dependent	GATA binding protein 6
GATA6_P726_F	5874	0.1880723	3608.598	859.0477	0.004882534	33	170.216	0.1052384	10165.64	1207.405	8.279952E-13	44	441.6582	0.1081979	11828.89	1447.272	3.489017E-19	38	708.0465	0.1509402	5602.628	1013.775	0.0006495606	32	212.1007	0.1082601	8503.269	1044.465	1.221316E-09	41	451.2523	0.2050115	8306.8	2167.944	2.523396E-13	26	646.6473	0.1115589	8898.301	1129.89	2.000139E-08	16	619.1968	0.1408849	11461.47	1895.947	1.259054E-10	41	445.5105	0.1073083	7258.554	884.554	5.314735E-07	32	697.465	0.1017502	12034.4	1374.537	3.880857E-19	27	657.383	GATA6	GATA6_P726_F	40288196	NM_005257.3	GATA6	2627	18	36.1	18002688	-726	Y	GGGACATCAAAAGTTGGAGAGCGTCCTCGGACACGACTGATGTGGAAGCC	.	GATA-binding protein 6; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcriptional activator activity; go_process: transcription; go_process: muscle development; go_process: positive regulation of transcription; go_process: regulation of transcription, DNA-dependent	GATA binding protein 6
GDF10_E39_F	3315	0.7146435	4642.982	11878.27	3.678E-38	26	726.0032	0.3664411	8651.313	5061.629	8.469253E-19	33	695.178	0.3236991	11520.96	5562.163	1.301123E-32	19	774.6147	0.741345	3519.225	10373.25	6.909563E-16	27	973.5706	0.3784991	8662.987	5336.729	3.562803E-21	26	681.6779	0.3181489	9789.133	4614.229	6.074304E-26	34	1064.362	0.3664486	8504.298	4976.758	2.011533E-15	22	1270.546	0.358014	11938.52	6713.478	5.280068E-21	25	779.1794	0.3853706	7075.312	4498.896	2.162339E-14	27	887.6189	0.4422629	8722.414	6995.815	1.161821E-26	40	503.0906	GDF10	GDF10_E39_F	11641417	NM_004962.2	GDF10	2662	10	36.1	48059133	39	Y	GACCTCTGGGGCTGCAGCTGACAGGGTCGTCCCTGGCCCGGCTGCCGTGTGCGTGC	BMP3B, BMP-3b	bone morphogenetic protein 3B; go_component: extracellular space; go_component: extracellular region; go_function: cytokine activity; go_function: growth factor activity; go_function: growth factor activity; go_process: skeletal development; go_process: transforming growth factor beta receptor signaling pathway	growth differentiation factor 10 precursor
GDF10_P95_R	890	0.1488774	2955.73	534.5048	0.04348304	31	134.4415	0.2329604	5348.805	1654.877	5.726586E-05	36	271.2947	0.1874572	8847.075	2064.13	9.80436E-13	37	424.3413	0.06617523	5916.356	426.3474	0.001196016	33	302.2607	0.1969555	6931.146	1724.466	6.369417E-08	29	450.013	0.1869906	8191.053	1906.926	2.373356E-12	29	473.0265	0.2160958	7354.741	2055.02	2.015187E-07	28	681.6144	0.2437439	8967.14	2922.369	1.977215E-08	22	391.948	0.2813382	5522.475	2201.059	2.645207E-06	24	650.4753	0.2301009	6337.575	1924.007	3.891637E-07	31	280.5537	GDF10	GDF10_P95_R	11641417	NM_004962.2	GDF10	2662	10	36.1	48059267	-95	Y	CTCCCCAGCCGAGAGCCCGAGACCCAGCCCCGCAGCCGGCTCCTGTGTGTCGG	BMP3B, BMP-3b	bone morphogenetic protein 3B; go_component: extracellular space; go_component: extracellular region; go_function: cytokine activity; go_function: growth factor activity; go_function: growth factor activity; go_process: skeletal development; go_process: transforming growth factor beta receptor signaling pathway	growth differentiation factor 10 precursor
GFAP_P1214_F	5878	0.2136587	5552.485	1535.851	4.262795E-07	34	285.0576	0.9308891	851.1813	12811.93	1.170988E-18	34	786.9573	0.9484438	1050.243	21160.23	3.678E-38	21	1331.472	0.5041894	3313.783	3471.473	0.0004390727	41	213.22	0.936704	830.3641	13768.26	4.17447E-23	20	812.1174	0.9167815	1164.767	13933.38	1.205656E-28	27	984.2939	0.9293228	1064.971	15318.01	3.768943E-23	32	1247.935	0.9336219	1286.599	19502.79	2.731801E-26	35	933.9822	0.9002324	1016.192	10071.72	3.688586E-13	25	667.0699	0.9540308	735.0949	17331.31	1.113717E-35	33	979.4256	GFAP	GFAP_P1214_F	24430142	NM_002055.2	GFAP	2670	17	36.1	40349608	-1214	N	CCTGGAGACTTCAGGTCCATCTACGCCCTCCACTCTGGTCCCACAGG	FLJ45472	intermediate filament protein; go_component: intermediate filament; go_component: intermediate filament; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton	glial fibrillary acidic protein
GFAP_P56_R	5877	0.4031653	2463.299	1731.523	0.009628322	36	107.5051	0.8723781	1271.554	9375.451	3.320843E-11	32	418.9046	0.8832723	1450.853	11735.23	6.52882E-19	41	504.1127	0.06681108	2892.549	214.2497	0.1802585	31	133.688	0.8887507	1190.467	10309.31	4.36071E-14	16	529.6414	0.8671928	1364.156	9560.514	1.532822E-14	30	547.7919	0.8386574	1820.202	9981.193	1.01008E-11	24	396.579	0.8770452	1513.38	11508.35	4.247702E-10	17	555.7617	0.8453829	1641.721	9523.018	2.378527E-13	25	674.9362	0.867929	1462.103	10265.65	1.69823E-14	31	410.8092	GFAP	GFAP_P56_R	24430142	NM_002055.2	GFAP	2670	17	36.1	40348450	-56	N	GAGTGGGCTAGACTGGCGATGCCCGGGTGCCCCTGGCAACACCCCCT	FLJ45472	intermediate filament protein; go_component: intermediate filament; go_component: intermediate filament; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton	glial fibrillary acidic protein
GFI1_E136_F	607	0.1209918	2567.275	367.1393	0.1120863	34	129.6756	0.336684	6068.918	3131.201	2.277552E-08	30	356.881	0.3293265	8538.431	4241.801	1.034822E-17	27	571.8535	0.0337028	4650.147	165.6771	0.02091188	29	246.9005	0.2830547	6703.737	2686.16	2.540954E-09	27	326.3831	0.2899936	6922.918	2868.426	1.371243E-11	22	420.5702	0.2511334	7691.61	2612.927	6.734834E-09	28	514.1157	0.2537822	8577.553	2951.16	6.178768E-08	33	366.9608	0.3063732	5591.125	2513.755	6.177792E-07	30	393.6174	0.2968653	7722.964	3302.875	9.118442E-13	26	417.5534	GFI1	GFI1_E136_F	71037376	NM_005263.2	GFI1	2672	1	36.1	92724885	136	Y	AAAATACCTTGACACCCAATCCGAGAGGTTTGCTCATTTCCCTTCGGATT	ZNF163	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: viral life cycle; go_process: regulation of transcription, DNA-dependent; go_process: G1/S-specific transcription in mitotic cell cycle	growth factor independent 1
GFI1_P208_R	4071	0.1063786	4111.435	501.3382	0.003328076	33	163.896	0.6362886	3507.004	6310.211	1.607345E-09	22	865.7809	0.6209134	5727.288	9544.628	9.399189E-26	24	737.6125	0.5073619	3035.693	3229.413	0.001414261	25	256.282	0.4323848	5375.484	4170.988	1.228559E-09	27	430.2702	0.5213577	4485.146	4994.337	7.653804E-11	29	494.1038	0.5481591	4565.451	5659.978	9.229921E-09	23	319.954	0.5361567	5667.266	6666.383	4.598333E-09	33	522.1119	0.5462559	3852.836	4758.762	7.840861E-08	22	489.9052	0.6990534	3661.541	8737.49	2.89186E-16	21	564.5187	GFI1	GFI1_P208_R	71037376	NM_005263.2	GFI1	2672	1	36.1	92725229	-208	Y	GAGGTCATACCCAGGCACTGGGTGTTGGCGGGAGCAGTAAAGCGCCATAAAAGCACC	ZNF163	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: viral life cycle; go_process: regulation of transcription, DNA-dependent; go_process: G1/S-specific transcription in mitotic cell cycle	growth factor independent 1
GFI1_P45_R	4064	0.3861166	4872.347	3127.476	4.838494E-09	40	333.0233	0.05062008	10221.09	550.311	1.799405E-11	29	671.7125	0.05032896	13749.23	733.9566	4.932534E-23	24	865.4025	0.1857905	4084.85	954.9203	0.01454932	30	257.337	0.04102828	12946.33	558.1694	1.203522E-19	32	685.5109	0.04254838	13525.1	605.4884	6.392278E-25	28	760.7731	0.02823791	11550.22	338.5374	6.695312E-12	17	1067.324	0.02874983	15467.02	460.7969	3.501104E-15	34	720.1158	0.03874243	10711.75	435.7557	2.625329E-13	24	551.1589	0.04138552	12554.8	546.3359	3.099111E-18	31	533.0189	GFI1	GFI1_P45_R	71037376	NM_005263.2	GFI1	2672	1	36.1	92725066	-45	Y	GCTCTCGACCGGGTCCGCTCAGCCTTCGACTAATTTCCGGTGGTCGGA	ZNF163	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: viral life cycle; go_process: regulation of transcription, DNA-dependent; go_process: G1/S-specific transcription in mitotic cell cycle	growth factor independent 1
GJB2_E43_F	3318	0.09986281	2441.352	281.942	0.1521948	34	91.60697	0.120277	6871.531	953.1573	4.10772E-06	35	211.3687	0.08312061	7216.315	663.2678	1.427562E-06	33	204.1231	0.05454125	3041.198	181.2082	0.1610375	18	108.8026	0.1315287	6121.418	942.2247	2.409438E-05	34	351.7672	0.1412239	6915.096	1153.618	8.142588E-08	25	336.0473	0.09498826	6779.475	722.0562	8.454506E-05	32	211.114	0.1572257	6736.548	1275.408	0.0004970169	23	376.9916	0.1057612	6601.918	792.6327	8.665063E-06	39	270.5465	0.09545552	7244.621	775.0692	9.85539E-07	33	225.311	GJB2	GJB2_E43_F	42558282	NM_004004.3	GJB2	2706	13	36.1	19664994	43	Y	GTTGGGGTCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGC	HID, KID, PPK, CX26, DFNA3, DFNB1, NSRD1	gap junction protein, beta 2, 26kD (connexin 26); gap junction protein beta 2; go_component: plasma membrane; go_component: connexon complex; go_component: integral to membrane; go_function: connexon channel activity; go_process: transport; go_process: cell-cell signaling; go_process: sensory perception of sound; go_process: sensory perception of sound	gap junction protein, beta 2, 26kDa (connexin 26)
GJB2_P791_R	897	0.1552245	5884.299	1099.593	6.835861E-07	29	210.7456	0.1002474	10917.11	1227.489	1.207572E-14	35	514.8257	0.05374325	14470.06	827.516	7.618499E-26	25	816.0917	0.07598973	6012.247	502.6654	0.0008174321	27	217.3178	0.1023825	11720.86	1348.291	2.36267E-18	19	796.322	0.06723524	14717.33	1068.058	1.856859E-31	25	647.4434	0.07944705	14083.28	1224.068	4.344682E-20	25	706.9946	0.07727695	15521.63	1308.293	5.368533E-17	27	602.3889	0.1267143	9267.385	1359.213	4.775251E-12	35	555.5261	0.07421757	13121.49	1059.932	1.660992E-21	26	529.9418	GJB2	GJB2_P791_R	42558282	NM_004004.3	GJB2	2706	13	36.1	19665828	-791	Y	GTGCCAAGGACTAAGGTTGGGGGCGGTGGGAGAGACAAGCCTCGTT	HID, KID, PPK, CX26, DFNA3, DFNB1, NSRD1	gap junction protein, beta 2, 26kD (connexin 26); gap junction protein beta 2; go_component: plasma membrane; go_component: connexon complex; go_component: integral to membrane; go_function: connexon channel activity; go_process: transport; go_process: cell-cell signaling; go_process: sensory perception of sound; go_process: sensory perception of sound	gap junction protein, beta 2, 26kDa (connexin 26)
GJB2_P931_R	895	0.1708838	6385.087	1336.599	2.031316E-08	32	269.5226	0.2702783	7506.734	2817.424	1.568358E-10	22	629.0182	0.301509	8375.255	3658.409	1.291124E-15	29	432.9553	0.2142967	1838.002	528.5806	0.333998	23	156.1197	0.2320476	7306.362	2237.936	1.241133E-09	27	867.2765	0.3089751	8041.201	3640.141	1.015236E-16	33	504.2183	0.2297101	7407.672	2238.882	8.493535E-08	30	468.2416	0.3266066	8048.003	3951.912	1.383861E-08	23	354.896	0.2665133	7436.819	2738.513	5.173163E-11	26	592.5881	0.2356303	9585.247	2985.647	9.779396E-17	33	438.05	GJB2	GJB2_P931_R	42558282	NM_004004.3	GJB2	2706	13	36.1	19665968	-931	Y	GGAACTGCAAGGAGGTGACTCCTTTCGGGGTGAGGAGGCCCAGAC	HID, KID, PPK, CX26, DFNA3, DFNB1, NSRD1	gap junction protein, beta 2, 26kD (connexin 26); gap junction protein beta 2; go_component: plasma membrane; go_component: connexon complex; go_component: integral to membrane; go_function: connexon channel activity; go_process: transport; go_process: cell-cell signaling; go_process: sensory perception of sound; go_process: sensory perception of sound	gap junction protein, beta 2, 26kDa (connexin 26)
GLA_E47_F	1608	0.02907094	5778.354	176.0059	4.596559E-05	35	172.217	0.04262551	8687.512	391.2494	3.747349E-08	18	475.9082	0.02966107	9753.648	301.2038	9.348138E-11	27	530.106	0.04357738	2977.541	140.2217	0.178376	26	113.9726	0.5844557	5562.907	7964.778	1.023932E-19	27	601.2181	0.6247314	4785.794	8133.663	1.203657E-20	33	916.0642	0.5507621	6068.064	7561.999	8.870476E-16	29	558.6071	0.5985166	5767.861	8747.59	1.444689E-12	25	673.4364	0.6083468	4329.998	6881.021	1.82297E-13	32	666.6442	0.5897242	5187.229	7599.785	2.442066E-17	34	643.6951	GLA	GLA_E47_F	4504008	NM_000169.1	GLA	2717	X	36.1	100549560	47	Y	CCTCAGCTGCATTGTCACGGTGACCGGACAGCATAAATTTCCGCGGGTAACCT	GALA	go_component: lysosome; go_component: lysosome; go_component: Golgi apparatus; go_component: extracellular region; go_component: extracellular region; go_function: receptor binding; go_function: alpha-galactosidase activity; go_function: protein homodimerization activity; go_function: hydrolase activity, hydrolyzing O-glycosyl compounds; go_process: oligosaccharide metabolism; go_process: glycosphingolipid catabolism; go_process: negative regulation of nitric oxide biosynthesis; go_process: negative regulation of nitric-oxide synthase activity	galactosidase, alpha
GLA_E98_R	3324	0.07460871	2859.848	238.6347	0.08660652	36	149.9401	0.06808178	9825.068	725.0811	5.3212E-11	38	616.7201	0.05587385	10165.77	607.5331	2.1033E-12	28	1066.248	0.03942578	6021.213	251.2389	0.001392141	27	253.4591	0.4282291	6659.392	5062.462	1.184003E-14	24	970.4963	0.4322654	6627.099	5121.921	6.361196E-17	30	769.6395	0.5290246	6138.041	7006.9	1.2282E-14	29	1171.659	0.3874919	9611.841	6144.015	7.539213E-15	24	702.9756	0.4417474	6051.13	4867.412	9.584432E-13	29	659.3121	0.4521267	8408.521	7021.568	1.193093E-25	26	1461.315	GLA	GLA_E98_R	4504008	NM_000169.1	GLA	2717	X	36.1	100549509	98	Y	CGAGGGCCAGGAAGCGAAGCGCAAGCGCGCAGCCCAGATGTAGTTCTGGGTT	GALA	go_component: lysosome; go_component: lysosome; go_component: Golgi apparatus; go_component: extracellular region; go_component: extracellular region; go_function: receptor binding; go_function: alpha-galactosidase activity; go_function: protein homodimerization activity; go_function: hydrolase activity, hydrolyzing O-glycosyl compounds; go_process: oligosaccharide metabolism; go_process: glycosphingolipid catabolism; go_process: negative regulation of nitric oxide biosynthesis; go_process: negative regulation of nitric-oxide synthase activity	galactosidase, alpha
GLA_P112_F	901	0.06508321	4966.784	352.7186	0.0004123693	21	123.8979	0.03906595	8154.359	335.5739	3.764222E-07	31	210.3318	0.04199912	7996.69	354.962	2.233407E-07	34	401.6529	0.3430525	2440.527	1326.642	0.0889108	19	387.7567	0.8340885	2118.829	11154.74	5.918681E-19	31	1002.785	0.82836	2157.568	10895.35	4.270746E-21	28	865.6595	0.857608	1966.422	12445.79	1.019617E-17	30	1104.112	0.7811837	3398.937	12491.36	4.142222E-15	30	859.4969	0.8165023	2120.999	9882.688	1.570323E-15	23	498.9334	0.852338	2939.348	17543.8	3.678E-38	27	1037.802	GLA	GLA_P112_F	4504008	NM_000169.1	GLA	2717	X	36.1	100549719	-112	Y	AATAATCAGTCACGTAAGACGTTCCGCTAACCAATCACCCTCTTCCTTT	GALA	go_component: lysosome; go_component: lysosome; go_component: Golgi apparatus; go_component: extracellular region; go_component: extracellular region; go_function: receptor binding; go_function: alpha-galactosidase activity; go_function: protein homodimerization activity; go_function: hydrolase activity, hydrolyzing O-glycosyl compounds; go_process: oligosaccharide metabolism; go_process: glycosphingolipid catabolism; go_process: negative regulation of nitric oxide biosynthesis; go_process: negative regulation of nitric-oxide synthase activity	galactosidase, alpha
GLA_P343_R	5650	0.1573867	6371.961	1208.859	4.106005E-08	25	228.2823	0.02550018	13456.04	354.727	4.466491E-19	27	639.4081	0.02485421	14735.83	378.131	3.394444E-25	35	1036.244	0.2949308	1855.609	818.032	0.264253	36	114.925	0.6937824	5133.681	11857.7	1.006578E-31	32	1465.651	0.631903	6578.697	11465.15	3.678E-38	22	1141.291	0.7595969	4976.319	16039.54	3.678E-38	31	1100.446	0.6312495	8494.169	14712.02	4.965157E-33	32	1053.478	0.638648	5067.356	9132.704	4.192872E-22	22	1129.371	0.7254482	6864.157	18401.39	3.678E-38	27	1421.726	GLA	GLA_P343_R	4504008	NM_000169.1	GLA	2717	X	36.1	100549950	-343	Y	GAGGGAAGAAGGAGGAAAATTACCCGGTATCGTTAGAGGTTGGTGTG	GALA	go_component: lysosome; go_component: lysosome; go_component: Golgi apparatus; go_component: extracellular region; go_component: extracellular region; go_function: receptor binding; go_function: alpha-galactosidase activity; go_function: protein homodimerization activity; go_function: hydrolase activity, hydrolyzing O-glycosyl compounds; go_process: oligosaccharide metabolism; go_process: glycosphingolipid catabolism; go_process: negative regulation of nitric oxide biosynthesis; go_process: negative regulation of nitric-oxide synthase activity	galactosidase, alpha
GLI2_E90_F	609	0.3613224	984.7318	613.671	0.4908216	35	44.51816	0.9709064	444.2087	18161.26	2.082389E-35	26	1007.504	0.9752569	474.152	22630.42	3.678E-38	30	1133.816	0.7728554	358.411	1559.735	0.4463902	22	66.48959	0.9701426	453.0802	17970.99	1.415376E-37	27	842.496	0.9603787	607.1069	17139.53	3.678E-38	17	977.3305	0.9701994	454.1428	18040.9	7.684725E-30	30	1447.399	0.9741002	479.1081	21780.43	2.708841E-30	26	1110.076	0.9436573	573.688	11283.29	3.894336E-15	35	612.954	0.9381962	614.751	10850.08	7.803532E-14	22	733.5991	GLI2	GLI2_E90_F	13518230	NM_030379.1	GLI2	2736	2	36.1	121266419	90	N	AAGAAAGTGATGATGCGATGTCTAAAACGTTCAAGGCACCGCATCTGTGATCAAGA	THP2	isoform alpha is encoded by transcript variant 1; tax-responsive element-2 holding protein; oncogene GLI2; tax helper protein 2; zinc finger protein GLI2; tax-responsive element-25-bp sequence binding protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: organ morphogenesis; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	GLI-Kruppel family member GLI2 isoform alpha
GLI2_P295_F	4094	0.483376	1140.288	1160.468	0.2578733	31	99.57829	0.9380275	851.9249	14408.52	1.875605E-23	31	1096.707	0.9525322	896.7994	20002.69	3.678E-38	25	1372.222	0.04932817	2999.232	160.812	0.1712334	23	140.6741	0.9326671	947.2936	14506.67	5.080055E-26	41	825.0857	0.9264834	1041.967	14391.49	5.325351E-30	34	922.5604	0.9334302	1115.979	17050.24	9.69279E-29	27	1386.636	0.9404797	1191.332	20404.32	1.896283E-28	30	910.4699	0.8940457	1103.615	10156.14	1.375675E-13	28	1084.72	0.9392608	969.8544	16544.06	1.96316E-33	24	684.2631	GLI2	GLI2_P295_F	13518230	NM_030379.1	GLI2	2736	2	36.1	121266034	-295	Y	GGGTCCTGGGCACGCATGCCGCACGACTGAGATCACAGCAGAGGTGAGAAC	THP2	isoform alpha is encoded by transcript variant 1; tax-responsive element-2 holding protein; oncogene GLI2; tax helper protein 2; zinc finger protein GLI2; tax-responsive element-25-bp sequence binding protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: organ morphogenesis; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	GLI-Kruppel family member GLI2 isoform alpha
GLI3_E148_R	630	0.4173314	4213.51	3089.514	1.572742E-07	26	282.3583	0.9307796	1138.208	16649.7	3.018679E-32	26	1089.573	0.9311484	1264.131	18448.5	3.678E-38	24	1914.797	0.4749797	1784.12	1704.541	0.1220439	29	155.861	0.9236015	1177.63	15445.6	2.647469E-30	39	896.7252	0.9321039	1105.853	16554.4	3.678E-38	37	1124.36	0.9235857	1243.125	16233.76	1.672291E-26	30	1560.657	0.9323718	1543.048	22652.25	5.049864E-36	28	1095.153	0.9256611	1084.577	14750.25	8.20716E-28	24	1716.94	0.908473	1365.667	14547.82	2.332706E-27	26	1092.286	GLI3	GLI3_E148_R	13518031	NM_000168.2	GLI3	2737	7	36.1	42241564	148	N	CAGACGGCCAGGGTGCAGGCCCCCCACCCGCCATGCCCAATGCGCTCAAGCTGAAAC	PHS, ACLS, GCPS, PAPA, PAPB, PAP-A, PAPA1, PPDIV	zinc finger protein GLI3; oncogene GLI3; DNA-binding protein; go_component: nucleus; go_component: cytoplasm; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: morphogenesis; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter; go_process: protein import into nucleus, translocation	GLI-Kruppel family member GLI3
GLI3_P453_R	3877	0.1693314	3437.766	721.1719	0.01048579	24	121.5851	0.1920911	6652.983	1605.612	8.869588E-07	40	242.7791	0.1678855	7253.364	1483.598	4.46159E-08	25	386.9193	0.0408069	4077.029	177.7031	0.04773054	25	200.2867	0.2116635	5797.304	1583.39	8.278302E-06	25	338.7577	0.2443536	6722.333	2206.14	1.362867E-09	25	460.7076	0.1734259	7875.501	1673.363	1.216829E-07	26	348.4842	0.1626519	7832.188	1540.799	2.404692E-05	31	398.4786	0.2026304	6788.06	1750.418	1.066019E-07	19	561.7477	0.1401289	6867.863	1135.518	1.04802E-06	28	290.91	GLI3	GLI3_P453_R	13518031	NM_000168.2	GLI3	2737	7	36.1	42242165	-453	Y	GAAGCCTGGGGTGCAGCGCCTCTCGGGGGACGGCATCTTACAGAAG	PHS, ACLS, GCPS, PAPA, PAPB, PAP-A, PAPA1, PPDIV	zinc finger protein GLI3; oncogene GLI3; DNA-binding protein; go_component: nucleus; go_component: cytoplasm; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: morphogenesis; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter; go_process: protein import into nucleus, translocation	GLI-Kruppel family member GLI3
GML_E144_F	1628	0.1217436	3833.13	545.2092	0.006134221	22	233.5763	0.9254199	1682.757	22121.18	3.678E-38	30	1725.766	0.9083765	2184.753	22651.57	3.678E-38	24	1383.581	0.8410399	1242.531	7103.179	6.79994E-06	21	456.2407	0.9456212	1365.425	25483.04	3.678E-38	35	990.2636	0.888464	2195.816	18287.81	3.678E-38	33	1365.939	0.6078314	4245.477	6735.158	4.054599E-10	36	473.995	0.6308392	5065.412	8826.896	1.685284E-11	27	569.004	0.6717644	2999.903	6344.236	3.037248E-09	31	541.8621	0.531374	4600.342	5329.708	2.611136E-10	25	390.8384	GML	GML_E144_F	4504032	NM_002066.1	GML	2765	8	36.1	143913363	144	Y	AGGGGCCCAGCTGAGGCAGCCTCCTCGTCAGCTGCTTGGGCCGCCAGGA	LY6DL	Glycosylphosphatidylinositol-anchored molecule-like protein; go_component: plasma membrane; go_component: extrinsic to membrane; go_process: apoptosis; go_process: negative regulation of cell proliferation; go_process: regulation of progression through cell cycle; go_process: DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	GPI anchored molecule like protein
GML_P281_R	5741	0.6355926	325.5266	742.1958	0.673885	37	30.57294	0.9711286	322.9211	14225.54	3.043652E-21	30	826.4114	0.9702097	354.0654	14787.97	2.704612E-25	29	989.0603	0.5803878	2161.715	3128.298	0.009481151	34	169.3626	0.9671526	325.3782	12524.75	1.013674E-17	25	567.1074	0.9668058	383.8627	14092.84	3.198498E-26	30	820.5749	0.9692858	329.8641	13565.77	2.009861E-16	26	861.1731	0.9702141	388.1098	15899.14	6.835033E-16	28	817.4429	0.9466109	463.2992	9987.525	1.22544E-11	41	462.7056	0.9694874	346.7288	14194.09	1.168488E-22	26	583.0262	GML	GML_P281_R	4504032	NM_002066.1	GML	2765	8	36.1	143912938	-281	N	CCTGGGCGGTGCCAACAGGCTGCCGAGGGTGGCTGCTGTCCCGTTTCTCCAGC	LY6DL	Glycosylphosphatidylinositol-anchored molecule-like protein; go_component: plasma membrane; go_component: extrinsic to membrane; go_process: apoptosis; go_process: negative regulation of cell proliferation; go_process: regulation of progression through cell cycle; go_process: DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	GPI anchored molecule like protein
GNAS_E58_F	3330	0.2689094	3034.77	1153.03	0.009791131	29	159.3074	0.8704905	1571.22	11233.01	2.533519E-16	31	447.9435	0.8747275	1797.528	13249.68	5.814331E-25	30	890.0438	0.9201751	892.0014	11435.22	1.691419E-12	22	843.1717	0.8729032	1421.687	10450.97	4.806436E-15	33	615.8364	0.8628943	1654.508	11042.25	6.603533E-20	24	746.1481	0.8586746	1620.277	10452.18	2.787827E-12	28	710.4302	0.8686101	1586.677	11150.52	1.158118E-09	34	1019.859	0.86906	1243.326	8915.771	5.62351E-11	27	573.972	0.8452454	2022.735	11594.05	9.252544E-20	33	493.9346	GNAS	GNAS_E58_F	7706588	NM_016592.1	GNAS	2778	20	36.1	56848248	58	Y	GAGGACCGGCGGAGGCACCTCTCTCGAGTCTTAGGCTGCGGAATCTAAGA	XL, AHO, GSA, GSP, POH, XL2, GPSA, NESP, GNAS1, PHP1A, PHP1B, GNASXL, NESP55, C20orf45, MGC33735, XLalphas, dJ309F20.1.1, dJ806M20.3.3	isoform d is encoded by transcript variant 4; guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1; neuroendocrine secretory protein 55; paternally expressed G protein XL alpha S; guanine nucleotide regulatory protein; G-s-alpha; adenylate cyclase-stimulating G alpha protein; neuroendocrine-specific Golgi protein p55; go_component: plasma membrane; go_component: extracellular region; go_component: heterotrimeric G-protein complex; go_function: GTP binding; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: guanyl nucleotide binding; go_function: signal transducer activity; go_process: pregnancy; go_process: signal transduction; go_process: signal transduction; go_process: protein secretion; go_process: G-protein coupled receptor protein signaling pathway; go_process: G-protein signaling, adenylate cyclase activating pathway	guanine nucleotide binding protein, alpha stimulating activity polypeptide 1 isoform d
GNAS_P86_F	915	0.2747234	1981.947	788.6092	0.1424782	37	84.25238	0.7604198	2101.666	6988.019	3.584232E-08	31	507.4423	0.7895878	2022.604	7965.234	1.311194E-10	18	322.6683	0.5189608	631.693	789.3745	0.5758269	30	82.45909	0.7677953	1846.259	6435.391	2.920742E-07	24	486.8892	0.7472134	2141.606	6625.975	3.041344E-09	24	527.4828	0.7617069	2054.834	6887.953	1.027904E-06	19	582.7883	0.7838008	2171.107	8233.593	1.657741E-06	27	360.6533	0.7184083	1897.165	5095.25	3.393211E-05	32	532.5468	0.7444008	1915.961	5871.234	2.334139E-06	23	306.5235	GNAS	GNAS_P86_F	7706588	NM_016592.1	GNAS	2778	20	36.1	56848104	-86	Y	GCCACAGGCTCGGCGCCACCACGCAGCTCGCGGGGAGGTGGCCCCCACCT	XL, AHO, GSA, GSP, POH, XL2, GPSA, NESP, GNAS1, PHP1A, PHP1B, GNASXL, NESP55, C20orf45, MGC33735, XLalphas, dJ309F20.1.1, dJ806M20.3.3	isoform d is encoded by transcript variant 4; guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1; neuroendocrine secretory protein 55; paternally expressed G protein XL alpha S; guanine nucleotide regulatory protein; G-s-alpha; adenylate cyclase-stimulating G alpha protein; neuroendocrine-specific Golgi protein p55; go_component: plasma membrane; go_component: extracellular region; go_component: heterotrimeric G-protein complex; go_function: GTP binding; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: guanyl nucleotide binding; go_function: signal transducer activity; go_process: pregnancy; go_process: signal transduction; go_process: signal transduction; go_process: protein secretion; go_process: G-protein coupled receptor protein signaling pathway; go_process: G-protein signaling, adenylate cyclase activating pathway	guanine nucleotide binding protein, alpha stimulating activity polypeptide 1 isoform d
GNG7_E310_R	2739	0.7916341	358.5894	1742.296	0.3186364	30	90.31389	0.9767691	285.6398	16214.71	1.39383E-27	21	1403.399	0.9808201	305.3302	20727.71	3.678E-38	25	974.2941	0.726436	275.6294	997.4658	0.6134332	35	42.10828	0.9743657	287.2188	14718.24	1.80802E-24	31	823.2113	0.9739399	317.7648	15613.04	4.527629E-32	31	784.6431	0.9766164	298.9054	16660.33	6.918794E-25	30	1044.342	0.9780036	338.1708	19481.97	8.166526E-24	32	863.6125	0.960853	313.8757	10158.48	1.09293E-11	24	1154.475	0.9834821	308.4584	24319.76	3.678E-38	25	689.376	GNG7	GNG7_E310_R	32698768	NM_052847.1	GNG7	2788	19	36.1	2603280	310	Y	AGGCCAGACGCTGAGAGAGAAAAACACTGCGTAATCCCACGTATTGTGGAGTCCAAAA	FLJ00058	go_component: heterotrimeric G-protein complex; go_function: signal transducer activity; go_process: signal transduction; go_process: regulation of G-protein coupled receptor protein signaling pathway	guanine nucleotide binding protein (G protein), gamma 7
GNG7_P903_F	1944	0.5423573	806.5884	1074.408	0.3915635	29	76.79172	0.9180197	728.0964	9273.066	7.017005E-10	25	623.5646	0.9132864	820.8658	9698.76	8.315358E-12	25	713.7628	0.4191357	507.5693	438.4052	0.6924564	30	48.2083	0.9018621	693.3019	7290.238	9.291692E-07	38	511.6028	0.9068971	873.9958	9487.504	4.999096E-13	26	719.0767	0.9198741	866.8904	11100.26	4.615537E-12	34	444.5861	0.9268197	960.6175	13432.6	2.361805E-12	38	407.9647	0.8814894	952.928	7831.745	3.742529E-08	28	462.7979	0.9420955	665.6062	12456.27	2.698854E-18	30	469.6556	GNG7	GNG7_P903_F	32698768	NM_052847.1	GNG7	2788	19	36.1	2604493	-903	N	GGGGGCCCCCCTGGTTTATACCGTCTTCCCCATCAGGAGTTTATCC	FLJ00058	go_component: heterotrimeric G-protein complex; go_function: signal transducer activity; go_process: signal transduction; go_process: regulation of G-protein coupled receptor protein signaling pathway	guanine nucleotide binding protein (G protein), gamma 7
GNMT_E126_F	3338	0.239031	5572.157	1781.704	1.235545E-07	25	332.705	0.09909528	12486.06	1384.408	3.015003E-19	24	875.8277	0.07096032	14563	1119.964	3.100436E-27	29	725.4704	0.09091479	7662.052	776.2587	5.14601E-06	22	377.0505	0.1033042	11955.17	1388.821	3.653327E-19	30	609.8716	0.123861	11129.05	1587.467	5.685345E-20	31	565.4443	0.117484	13363.58	1792.325	1.122828E-19	23	841.5802	0.1118535	15369.1	1948.184	5.045986E-18	30	692.2755	0.1274818	8933.962	1319.933	3.446552E-11	22	690.0854	0.09433378	12937.36	1357.965	7.219589E-22	33	854.6207	GNMT	GNMT_E126_F	54792737	NM_018960.4	GNMT	27232	6	36.1	43036604	126	Y	TGGCAGCTGTATATCGGAGACACCCGCAGCCGCACCGCCGAGTACAAGGCATGGCTGC	.	go_function: folic acid binding; go_function: transferase activity; go_function: glycine N-methyltransferase activity; go_process: protein modification	glycine N-methyltransferase
GNMT_P197_F	917	0.1759084	6684.813	1448.268	2.382122E-09	36	375.1598	0.3817292	7480.971	4680.599	1.096429E-14	26	517.8622	0.3711245	9529.037	5682.479	1.538517E-25	33	723.9293	0.08617441	6009.918	576.1697	0.000696029	36	295.1458	0.2977095	9093.269	3897.139	4.00115E-18	27	583.9678	0.318026	7405.076	3499.854	1.738191E-14	30	908.9661	0.3251543	8785.22	4281.079	1.861424E-14	29	783.5578	0.320365	11875.01	5644.757	1.847831E-18	27	572.8296	0.2971149	6442.547	2765.584	5.688577E-09	35	475.9629	0.3276631	10519.9	5175.605	1.398468E-26	21	818.5959	GNMT	GNMT_P197_F	54792737	NM_018960.4	GNMT	27232	6	36.1	43036281	-197	Y	GGGATTGCACAGAGGGCTGGGTCCGCAGGCTGGCTAAAAGGACCTAGCCC	.	go_function: folic acid binding; go_function: transferase activity; go_function: glycine N-methyltransferase activity; go_process: protein modification	glycine N-methyltransferase
GP1BB_E23_F	3340	0.02878445	7186.571	215.9561	9.788649E-08	21	233.2835	0.06411551	12190.24	841.9788	6.31563E-17	31	587.1483	0.04730181	15540.92	776.5773	1.311817E-29	38	1085.722	0.02928743	7023.19	214.9142	0.0001451027	42	245.9378	0.05426837	12688.74	733.8488	2.125082E-19	37	702.2164	0.07282978	12376.04	980.0009	3.882171E-22	30	838.3121	0.05641958	13303.27	801.4225	6.104573E-17	30	870.0414	0.05741341	16581.46	1016.076	1.251973E-18	27	824.2933	0.05864451	9896.453	622.7584	8.511335E-12	28	511.5287	0.04768708	13633.72	687.7164	5.957914E-22	33	513.2268	GP1BB	GP1BB_E23_F	9945387	NM_000407.3	GP1BB	2812	22	36.1	18091089	23	Y	GCAGAGTAAGCCGGGCTGCCGTCTTCTCGCCATGGGCTCCGGTGAGTCT	CD42c	giant platelet disorder; platelet glycoprotein Ib beta chain; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: cell adhesion; go_process: platelet activation; go_process: cell surface receptor linked signal transduction	glycoprotein Ib beta polypeptide precursor
GP1BB_P278_R	926	0.1584967	2248.985	442.4301	0.1589916	29	109.4999	0.1361309	6673.026	1067.313	5.471467E-06	31	447.4796	0.1296144	9332.573	1404.662	2.563211E-12	28	327.528	0.3308541	788.3414	439.2337	0.6248081	20	56.31217	0.1301723	7060.427	1071.579	5.254297E-07	20	498.5354	0.1517096	7132.444	1293.462	1.579893E-08	16	621.4792	0.1083389	8242.934	1013.686	3.476199E-07	34	302.5096	0.1239408	9461.602	1352.732	5.231761E-07	33	345.6227	0.1327953	5662.734	882.4495	0.0001387726	21	605.1592	0.1006394	7652.048	867.4625	1.393563E-07	41	282.8951	GP1BB	GP1BB_P278_R	9945387	NM_000407.3	GP1BB	2812	22	36.1	18090788	-278	Y	ACACGATGCTCCGTTTTCTTCCGTTGTGAATGCCGCGTCCTGTCCTGGTGACA	CD42c	giant platelet disorder; platelet glycoprotein Ib beta chain; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: cell adhesion; go_process: platelet activation; go_process: cell surface receptor linked signal transduction	glycoprotein Ib beta polypeptide precursor
GPATC3_P410_R	929	0.2714955	1337.154	535.5915	0.3943951	27	78.76881	0.6753682	3225.087	6917.554	3.664857E-10	21	748.6851	0.5618955	4185.307	5496.167	5.953474E-10	32	557.9872	0.3596275	995.072	614.9828	0.5268203	43	61.57172	0.6820675	3143.695	6958.767	8.30878E-11	34	373.6107	0.7627368	2154.683	7248.193	1.15612E-10	34	506.8401	0.5015539	4147.656	4274.14	5.635964E-06	33	475.667	0.6722358	3745.745	7887.523	4.459821E-08	23	414.528	0.7123979	2335.015	6031.598	2.167447E-07	33	406.3362	0.65852	4127.872	8153.149	6.029019E-16	28	572.303	GPATC3	GPATC3_P410_R	11545792	NM_022078.1	GPATC3	63906	1	36.1	27099954	-410	N	GGTAGAAAAATGGGCCGAAGATACTTCGCAAAAGAGGAAACACGCAGGTCCAATT	FLJ12455	go_component: intracellular; go_function: nucleic acid binding; go_process: biological process unknown	G patch domain containing 3
GPC3_E72_F	3347	0.1910664	4532.127	1094.087	0.0001483891	26	175.6757	0.1520787	5672.273	1035.285	0.0001360952	37	347.9729	0.1107577	7328.648	925.2595	3.314468E-07	25	294.4232	0.05745127	6155.77	381.3086	0.0007776798	30	253.7056	0.7143359	3061.56	7905.844	8.844611E-13	24	645.1632	0.6778611	3659.801	7911.564	2.155937E-16	25	521.154	0.7081516	3165.834	7924.337	2.521673E-10	34	955.6947	0.6517681	4762.849	9101.552	1.87589E-11	29	432.0995	0.67089	3161.418	6648.394	3.261677E-10	26	449.834	0.5908244	4083.704	6041.012	1.004668E-10	34	618.1766	GPC3	GPC3_E72_F	5360213	NM_004484.2	GPC3	2719	X	36.1	132947260	72	Y	CAAGAGACGTGCTGCTACCCAGCCGCTGCAAAAGTTTCCTCGCAGCTACCTGG	SGB, DGSX, SDYS, SGBS, SGBS1	glypican-3 splice variant B; glypican-3 splice variant A; glypican-3 splice variant C; go_component: membrane; go_component: integral to plasma membrane; go_component: extracellular matrix (sensu Metazoa); go_process: morphogenesis	glypican 3
GPC3_P235_R	933	0.1002132	4135.124	471.6845	0.003381942	25	130.4092	0.1110494	7526.474	952.7135	3.919514E-07	40	288.8024	0.06608613	9724.67	695.2187	1.412738E-11	30	352.7645	0.04548276	4783.347	232.6916	0.01513334	30	193.6069	0.5612655	5534.055	7207.549	2.064479E-17	30	765.4225	0.5686426	6029.307	8080.041	7.661864E-25	27	711.7985	0.4830237	6939.535	6577.21	1.654886E-15	32	654.3256	0.5789269	7151.429	9969.878	1.317752E-17	46	617.0278	0.4246867	5894.223	4424.836	2.45407E-11	35	358.2289	0.5157513	6144.648	6650.891	2.310741E-17	33	479.5248	GPC3	GPC3_P235_R	5360213	NM_004484.2	GPC3	2719	X	36.1	132947567	-235	Y	TCCCGGCAGCCGAGCCCAGCTGCCCGCTCGCAGCCGCTCTACACAGGGCGCTCTGG	SGB, DGSX, SDYS, SGBS, SGBS1	glypican-3 splice variant B; glypican-3 splice variant A; glypican-3 splice variant C; go_component: membrane; go_component: integral to plasma membrane; go_component: extracellular matrix (sensu Metazoa); go_process: morphogenesis	glypican 3
GPR116_E328_R	2995	0.862097	603.2925	4396.614	0.00110998	26	183.4596	0.9652694	502.9806	16758.7	2.70768E-30	44	1069.222	0.9714704	514.9919	20941.24	3.678E-38	29	1332.787	0.3034537	3158.059	1419.389	0.03012726	24	136.2639	0.9663849	426.733	15142.79	1.985796E-26	31	979.5129	0.9674408	582.3184	20273.9	3.678E-38	22	1430.167	0.9709926	473.912	19211.1	5.239565E-34	33	1063.493	0.9728068	531.2106	22580.89	9.40887E-33	28	969.744	0.9492373	519.8019	11590	8.076126E-16	31	826.8708	0.972299	448.7697	19261.68	3.678E-38	27	1347.104	GPR116	GPR116_E328_R	44771172	NM_015234.3	GPR116	221395	6	36.1	46990497	328	N	AATGCCCAGGGGTGCATTCCAATTGCAGACGGAGGGAAGCCCTGTGGAA	KPG_001, KIAA0758, DKFZp564O1923	Ig-Hepta homolog; human homolog of rat Ig-Hepta (Acc#:AB019120); go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: G-protein coupled receptor activity; go_process: signal transduction; go_process: neuropeptide signaling pathway	G-protein coupled receptor 116
GPR116_P850_F	2202	0.8001617	1419.391	6083.711	6.014491E-08	24	331.984	0.9378515	1046.658	17303.65	2.098215E-34	40	681.2352	0.9516831	878.7267	19277.69	3.678E-38	38	945.9341	0.7896721	552.597	2450.164	0.1987356	30	97.69398	0.9412245	842.8539	15098.74	9.153658E-28	27	1005.178	0.9315325	1235.079	18164.38	3.678E-38	28	1131.4	0.9513717	804.8083	17701.82	7.021737E-30	38	1172.875	0.950615	1064.827	22421.83	7.263885E-34	31	852.1574	0.91189	874.1968	10082.4	7.745408E-13	26	908.5591	0.9553258	845.5953	20220.88	3.678E-38	26	1126.26	GPR116	GPR116_P850_F	44771172	NM_015234.3	GPR116	221395	6	36.1	46991675	-850	N	TTTCCTGGTTCTCAAGGCTCCCGAGCTTATGCCTTTTCTCCTTCTATGCTCCC	KPG_001, KIAA0758, DKFZp564O1923	Ig-Hepta homolog; human homolog of rat Ig-Hepta (Acc#:AB019120); go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: G-protein coupled receptor activity; go_process: signal transduction; go_process: neuropeptide signaling pathway	G-protein coupled receptor 116
GPX1_E46_R	5567	0.04472206	6479.587	308.0283	1.623236E-06	27	293.9641	0.08938873	10022.62	993.671	5.258669E-12	30	543.348	0.1074471	11509.35	1397.553	4.41477E-18	22	811.043	0.2291437	570.1647	199.2122	0.7319262	30	39.70555	0.09178209	9873.76	1007.922	1.414268E-12	29	501.4106	0.1024047	10061.22	1159.272	2.256888E-15	24	564.9416	0.1017667	8170.676	937.0388	5.846833E-07	35	309.0135	0.1107743	11794.05	1481.688	1.698062E-10	42	498.6094	0.09508661	8392.753	892.4026	3.992545E-09	25	657.2826	0.1010575	9052.684	1028.929	1.243587E-10	24	517.8811	GPX1	GPX1_E46_R	41406083	NM_000581.2	GPX1	2876	3	36.1	49370749	46	Y	GCAATTGTCCAAGAAGCCAGCGGAGCGCCCCGAACAAGCACTGTAAGGGGAGGCC	GSHPX1, MGC14399, MGC88245	isoform 1 is encoded by transcript variant 1; go_function: selenium binding; go_function: oxidoreductase activity; go_function: glutathione peroxidase activity; go_function: glutathione peroxidase activity; go_process: response to oxidative stress	glutathione peroxidase 1 isoform 1
GPX1_P194_F	4901	0.154229	4803.899	894.2414	0.0001155744	31	227.2503	0.3040627	6715.529	2977.779	2.781221E-09	41	409.8494	0.2973457	7946.056	3404.89	7.9742E-14	36	474.0585	0.1462432	3365.923	593.6909	0.07027979	31	165.6312	0.2712459	6903.106	2606.591	1.459037E-09	25	361.3267	0.2756143	6827.002	2635.585	8.385483E-11	30	359.8586	0.3261671	7117.681	3493.7	1.930643E-09	22	447.5925	0.315991	8268.044	3865.778	8.931499E-09	32	427.7463	0.3196021	5971.313	2851.867	3.167115E-08	26	468.0948	0.3005449	8249.689	3587.73	8.885288E-15	21	556.2465	GPX1	GPX1_P194_F	41406083	NM_000581.2	GPX1	2876	3	36.1	49370989	-194	Y	TGGTCTGGCCCAGGCAACCAGGCGGCAGCGGTCCAGGTTACCCTTCC	GSHPX1, MGC14399, MGC88245	isoform 1 is encoded by transcript variant 1; go_function: selenium binding; go_function: oxidoreductase activity; go_function: glutathione peroxidase activity; go_function: glutathione peroxidase activity; go_process: response to oxidative stress	glutathione peroxidase 1 isoform 1
GPX3_E178_F	3348	0.07361353	11855.28	950.0037	5.970947E-24	29	567.0323	0.1086086	11793.29	1449.097	1.712664E-17	31	1134.102	0.0984212	20350.21	2232.455	3.678E-38	22	1041.734	0.04641473	9254.791	455.3343	7.81856E-08	26	385.1757	0.1106454	14655.39	1835.731	8.395159E-30	19	1766.033	0.1136053	15811.17	2039.264	3.678E-38	33	1331.543	0.1229731	17517.01	2470.185	4.127535E-35	33	675.3106	0.1200451	19705.98	2701.969	1.027927E-30	27	845.4962	0.1380634	10495.58	1697.18	4.780081E-16	32	1054.539	0.08854864	17214.67	1682.142	3.678E-38	15	877.3953	GPX3	GPX3_E178_F	6006000	NM_002084.2	GPX3	2878	5	36.1	150380290	178	Y	GCTGCAAGGGTCTCGGCTTGGCCGCGGATTGGTCACACCCGAGGG	.	go_component: soluble fraction; go_component: extracellular region; go_function: selenium binding; go_function: oxidoreductase activity; go_function: electron transporter activity; go_function: glutathione peroxidase activity; go_process: response to lipid hydroperoxide	plasma glutathione peroxidase 3 precursor
GRB10_E85_R	3349	0.02003949	11715.91	241.627	9.511197E-21	32	636.1169	0.05614211	8159.385	491.2809	2.041489E-07	32	557.172	0.04961378	10868.43	572.5938	4.702271E-14	12	479.2057	0.02038657	10124.19	212.7739	7.751545E-09	24	727.8312	0.04392926	9137.748	424.4534	1.14118E-09	32	377.4114	0.08428583	8266.941	770.1252	7.851173E-10	25	628.0043	0.06576995	9641.557	685.8072	6.146139E-09	26	385.4756	0.0436516	12676.79	583.1842	1.798576E-10	28	487.4325	0.05929746	6887.667	440.4697	1.092664E-05	15	311.9598	0.04758513	7607.752	385.0994	1.09036E-06	34	312.302	GRB10	GRB10_E85_R	48762696	NM_001001555.1	GRB10	2887	7	36.1	50828567	85	Y	GCGCTGCCGCCACCCAGGGGCTGCGCGGAAACTTTGGGCTCCACCGG	RSS, IRBP, MEG1, GRB-IR, KIAA0207	isoform c is encoded by transcript variant 4; maternally expressed gene 1; GRB10 adaptor protein; go_component: cytoplasm; go_component: plasma membrane; go_function: protein binding; go_function: SH3/SH2 adaptor activity; go_process: cell-cell signaling; go_process: intracellular signaling cascade; go_process: insulin receptor signaling pathway	growth factor receptor-bound protein 10 isoform c
GRB10_P260_F	943	0.05817197	2775.3	177.5928	0.1089743	23	95.9346	0.07980937	7500.121	659.1686	1.270548E-06	42	437.2842	0.05902033	9988.622	632.7807	4.812325E-12	30	324.826	0.07934362	2638.507	236.0089	0.2230195	33	112.0966	0.07266355	8771.873	695.1758	1.779283E-09	29	460.3579	0.115436	6992.125	925.526	1.588225E-07	25	498.2974	0.08153456	8512.71	764.5726	3.231649E-07	22	627.1384	0.07068453	10021.57	769.8552	5.588003E-07	20	502.3547	0.09565087	6262.286	672.9239	4.089254E-05	27	272.4752	0.08707994	7668.47	741.0046	2.169621E-07	21	515.4562	GRB10	GRB10_P260_F	48762696	NM_001001555.1	GRB10	2887	7	36.1	50828912	-260	Y	GGTTCCTGCCCCGGGCTGCTGAGCGGGTTCCCCCCTCCTGCTGTCCT	RSS, IRBP, MEG1, GRB-IR, KIAA0207	isoform c is encoded by transcript variant 4; maternally expressed gene 1; GRB10 adaptor protein; go_component: cytoplasm; go_component: plasma membrane; go_function: protein binding; go_function: SH3/SH2 adaptor activity; go_process: cell-cell signaling; go_process: intracellular signaling cascade; go_process: insulin receptor signaling pathway	growth factor receptor-bound protein 10 isoform c
GRB10_P496_R	942	0.4605816	937.3672	885.7544	0.4115387	23	58.21143	0.595123	3422.144	5177.149	2.486062E-07	29	347.8555	0.5562705	4058.937	5213.748	4.112718E-09	32	316.1011	0.4606448	1313.37	1207.111	0.2981127	31	101.0418	0.5928413	3301.266	4952.395	3.262947E-07	21	521.9401	0.5982885	3862.737	5901.897	1.592859E-11	24	486.6319	0.5639604	3940.687	5226.104	4.762691E-07	24	507.2036	0.5605218	4531.442	5907.059	1.510232E-06	28	373.1785	0.576517	3277.172	4597.58	1.501102E-06	25	504.2477	0.515074	4077.124	4436.817	1.425372E-07	26	176.5986	GRB10	GRB10_P496_R	48762696	NM_001001555.1	GRB10	2887	7	36.1	50829148	-496	Y	TACTCTGTCGTGGGCTGAAGGCACCCGGCCTGGGAAAAGGAAACC	RSS, IRBP, MEG1, GRB-IR, KIAA0207	isoform c is encoded by transcript variant 4; maternally expressed gene 1; GRB10 adaptor protein; go_component: cytoplasm; go_component: plasma membrane; go_function: protein binding; go_function: SH3/SH2 adaptor activity; go_process: cell-cell signaling; go_process: intracellular signaling cascade; go_process: insulin receptor signaling pathway	growth factor receptor-bound protein 10 isoform c
GRB7_E71_R	1375	0.100917	7986.597	907.6744	3.192945E-11	22	385.3734	0.8093396	2217.214	9836.411	2.020703E-14	36	559.6214	0.7294053	4782.565	13161.27	3.591892E-36	23	885.1365	0.03336093	5579.543	196.0141	0.003852644	37	207.7333	0.6797581	4283.833	9305.294	6.661961E-20	28	881.2119	0.809846	2685.19	11861.83	1.723328E-26	41	712.3163	0.5985837	4655.961	7091.991	1.29675E-11	33	683.2766	0.6417847	5788	10549.04	5.433102E-16	36	641.3074	0.7919998	2085.689	8322.42	1.53657E-11	31	510.1119	0.690951	4521.676	10332.83	1.084238E-23	38	606.3816	GRB7	GRB7_E71_R	71979666	NM_001030002.1	GRB7	2886	17	36.1	35147784	71	N	GCCTCTGACTTCTCTGTCCGAAGTCGGGACACCCTCCTACCACCTGTAGAG	.	go_function: SH3/SH2 adaptor activity; go_process: signal transduction; go_process: intracellular signaling cascade; go_process: epidermal growth factor receptor signaling pathway	growth factor receptor-bound protein 7
GRB7_P160_R	5759	0.03361656	11879.45	416.7163	5.3539E-22	35	691.5513	0.8327776	1499.889	7967.545	7.401867E-09	25	456.9381	0.8150619	2056.277	9503.175	2.331075E-14	23	456.534	0.07680612	6249.491	528.2528	0.0004468998	37	283.4614	0.7829205	2032.894	7692.509	5.26363E-10	31	456.5148	0.8332782	1727.78	9135.271	2.267654E-14	40	409.9306	0.713114	2660.08	6860.746	1.348019E-07	35	437.5763	0.7589326	2659.192	8686.538	1.084224E-07	26	386.9246	0.825588	1526.503	7699.132	5.250447E-09	23	536.6833	0.8301775	1850.662	9535.817	1.219965E-13	25	335.4188	GRB7	GRB7_P160_R	71979666	NM_001030002.1	GRB7	2886	17	36.1	35147553	-160	N	GGTACTGTCTGTTCGGCTGTCTTCCCCGCCTCTCCCCAGGCACCTGCATC	.	go_function: SH3/SH2 adaptor activity; go_process: signal transduction; go_process: intracellular signaling cascade; go_process: epidermal growth factor receptor signaling pathway	growth factor receptor-bound protein 7
GRPR_P200_R	4099	0.4903108	2123.348	2138.817	0.008183356	27	229.3258	0.8042759	2344.774	10046.15	2.930404E-15	29	555.9883	0.7943438	2713.466	10866.97	4.054148E-20	35	624.1737	0.1951359	2083.87	529.4701	0.2773475	44	157.7294	0.8442048	2218.922	12565.51	1.007176E-23	30	592.2457	0.8312581	2622.569	13411.95	1.64036E-32	32	681.2341	0.8487942	2236.43	13115.55	3.277419E-20	29	805.9434	0.8341961	3390.236	17560.15	1.029545E-26	32	726.4725	0.8251048	1752.979	8741.818	9.697209E-12	29	828.2589	0.8511195	2391.649	14244.25	5.071939E-30	39	576.6639	GRPR	GRPR_P200_R	61677286	NM_005314.2	GRPR	2925	X	36.1	16051145	-200	N	CACATGGACACCCTGTGCATCAGTGTGCGTTTAATTCAAAGACAGACCTCATTTGATAG	.	GRP-preferring bombesin receptor; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: bombesin receptor activity; go_function: peptide receptor activity, G-protein coupled; go_process: signal transduction; go_process: cell proliferation; go_process: G-protein coupled receptor protein signaling pathway	gastrin-releasing peptide receptor
GSTM1_P266_F	4902	0.3779819	3693.452	2305.168	3.900094E-05	34	263.429	0.8632031	2207.059	14557.79	1.649523E-28	32	844.4529	0.3575898	15762.95	8829.917	3.678E-38	34	964.0331	0.08668298	5998.548	578.8137	0.0007099624	25	253.4758	0.2931213	13080.11	5465.395	4.275611E-38	23	981.668	0.3408414	11739.71	6122.143	3.678E-38	40	1260.647	0.593838	6095.542	9058.326	1.137195E-19	39	706.7515	0.6044137	7569.082	11717.54	1.656337E-22	29	917.4192	0.3338887	9140.146	4631.629	1.006499E-20	34	882.7711	0.4262468	10037.94	7531.573	1.17591E-33	30	946.8297	GSTM1	GSTM1_P266_F	23065546	NM_146421.1	GSTM1	2944	1	36.1	110031699	-266	Y	TGGCTGGTGTCTCAAGCGCACAGCCAAGTCGCTGTGGACCTAGCAAGGGCTG	MU, H-B, GST1, GTH4, GTM1, MU-1, GSTM1-1, MGC26563, GSTM1a-1a, GSTM1b-1b	isoform 2 is encoded by transcript variant 2; HB subunit 4; glutathione S-transferase, Mu-1; S-(hydroxyalkyl)glutathione lyase; GST class-mu 1; glutathione S-alkyltransferase; glutathione S-aryltransferase; glutathione S-aralkyltransferase; go_component: cytoplasm; go_function: transferase activity; go_function: glutathione transferase activity; go_function: glutathione transferase activity; go_process: metabolism	glutathione S-transferase M1 isoform 2
GSTM1_P363_F	4908	0.6961499	601.9812	1608.307	0.2846216	21	66.65614	0.9315363	619.8395	9794.338	1.022942E-10	27	555.087	0.7931993	4074.08	16009.99	3.678E-38	40	1007.711	0.6362694	1125.377	2143.536	0.1536971	24	137.3895	0.8743893	2165.009	15766.96	1.657304E-35	40	1053.136	0.810266	3333.882	14664.52	3.678E-38	33	1224.404	0.8564447	1659.319	10496.02	1.868087E-12	22	482.0995	0.889328	1709.391	14539.75	8.143535E-16	26	701.0215	0.8241781	2108.291	10351.53	8.590173E-17	27	997.0007	0.9120451	1761.607	19303.86	3.678E-38	32	1071.993	GSTM1	GSTM1_P363_F	23065546	NM_146421.1	GSTM1	2944	1	36.1	110031602	-363	Y	CCCAGAGCCCTTGGGAACTCGGCAGCGGAGAGAAGGCTGAGGGACAC	MU, H-B, GST1, GTH4, GTM1, MU-1, GSTM1-1, MGC26563, GSTM1a-1a, GSTM1b-1b	isoform 2 is encoded by transcript variant 2; HB subunit 4; glutathione S-transferase, Mu-1; S-(hydroxyalkyl)glutathione lyase; GST class-mu 1; glutathione S-alkyltransferase; glutathione S-aryltransferase; glutathione S-aralkyltransferase; go_component: cytoplasm; go_function: transferase activity; go_function: glutathione transferase activity; go_function: glutathione transferase activity; go_process: metabolism	glutathione S-transferase M1 isoform 2
GSTM2_E153_F	3354	0.5506762	10969.64	13566.58	3.678E-38	23	1834.713	0.1812946	7885.278	1768.265	3.310681E-09	31	309.3031	0.1451194	9554.703	1638.924	1.982745E-13	21	571.9651	0.4101789	7360.135	5187.996	5.987379E-13	25	853.6484	0.1515873	8838.654	1597.084	1.51859E-11	21	464.7252	0.2421227	8879.496	2868.722	6.396639E-17	23	867.8228	0.1181159	9534.259	1290.372	7.899357E-10	26	666.2293	0.1256868	12642.68	1831.823	1.704165E-12	26	771.8095	0.1262963	8516.567	1245.548	4.123386E-10	35	411.7457	0.09023853	9980.758	999.9025	1.167041E-12	21	336.4031	GSTM2	GSTM2_E153_F	23065549	NM_000848.2	GSTM2	2946	1	36.1	110012367	153	Y	GGGAAGTGTGGAGCAGCTGCAGGACGGGCTCTAGGGACGGTTCC	GST4, GSTM, GTHMUS, GSTM2-2	glutathione S-transferase 4; GST, muscle; GST class-mu 2; glutathione S-transferase M1; glutathione S-transferase Mu 2; glutathione S-alkyltransferase M2; glutathione S-aryltransferase M2; S-(hydroxyalkyl)glutathione lyase M2; glutathione S-aralkyltransferase M2; go_function: transferase activity; go_function: glutathione transferase activity; go_function: glutathione transferase activity; go_process: metabolism	glutathione S-transferase M2
GSTM2_P109_R	946	0.09003224	4114.001	416.9334	0.004138832	31	254.6676	0.2236181	7540.149	2200.561	2.257104E-09	22	870.4095	0.1930769	8331.565	2017.467	2.051326E-11	38	532.9774	0.2451305	1781.232	610.8967	0.3279235	25	116.4837	0.2061885	6859.065	1807.581	6.08218E-08	19	583.1523	0.2909623	7277.049	3027.263	7.037353E-13	33	754.6388	0.18562	8696.605	2004.992	1.326207E-09	27	597.2256	0.1918074	9859.444	2363.663	6.649202E-09	39	358.5182	0.190093	6334.399	1510.216	1.682316E-06	28	541.2578	0.1756504	10073.25	2167.69	7.72381E-16	25	468.147	GSTM2	GSTM2_P109_R	23065549	NM_000848.2	GSTM2	2946	1	36.1	110012105	-109	N	ATCCTACTCCTAGCCCCATGAGCGCGCTCCAGGCCTCCAGATTGGCC	GST4, GSTM, GTHMUS, GSTM2-2	glutathione S-transferase 4; GST, muscle; GST class-mu 2; glutathione S-transferase M1; glutathione S-transferase Mu 2; glutathione S-alkyltransferase M2; glutathione S-aryltransferase M2; S-(hydroxyalkyl)glutathione lyase M2; glutathione S-aralkyltransferase M2; go_function: transferase activity; go_function: glutathione transferase activity; go_function: glutathione transferase activity; go_process: metabolism	glutathione S-transferase M2
GSTM2_P453_R	944	0.2799741	1464.58	608.3695	0.3275892	27	118.8083	0.8274459	2048.356	10301.97	3.708815E-15	22	792.2795	0.8011598	2480.081	10395.57	5.452152E-18	29	517.5082	0.05909522	2122.412	139.5826	0.3593099	24	130.4183	0.7912437	2159.25	8563.178	3.344879E-12	40	366.7103	0.8323898	1845.972	9664.134	3.268037E-16	27	798.8921	0.7965621	2324.637	9493.679	9.330053E-12	37	638.3619	0.7669449	2932.169	9978.355	6.305492E-10	23	530.2805	0.8124592	1953.935	8898.001	1.388746E-12	28	559.0021	0.793307	2729.094	10858.33	1.134698E-19	21	551.69	GSTM2	GSTM2_P453_R	23065549	NM_000848.2	GSTM2	2946	1	36.1	110011761	-453	N	CCTTGCCTGTGTTGTCCTTCCCACGTTAGGTCTGTCATGCCACGTATGTCCGCAG	GST4, GSTM, GTHMUS, GSTM2-2	glutathione S-transferase 4; GST, muscle; GST class-mu 2; glutathione S-transferase M1; glutathione S-transferase Mu 2; glutathione S-alkyltransferase M2; glutathione S-aryltransferase M2; S-(hydroxyalkyl)glutathione lyase M2; glutathione S-aralkyltransferase M2; go_function: transferase activity; go_function: glutathione transferase activity; go_function: glutathione transferase activity; go_process: metabolism	glutathione S-transferase M2
GSTP1_E322_R	4101	0.07718634	1809.507	159.7157	0.3616711	25	53.12231	0.1347978	6140.348	972.2409	4.118539E-05	29	329.2114	0.1116755	6961.636	887.7521	1.60032E-06	38	289.4381	0.02722249	5125.583	146.2343	0.009789024	38	169.0498	0.05157075	7553.311	416.148	9.801587E-07	30	241.4186	0.09207343	7447.013	765.3476	4.253843E-08	25	383.143	0.1462639	6222.043	1083.106	0.0001434947	31	243.8019	0.1435018	7269.455	1234.713	0.0001774131	28	204.3122	0.07505874	6587.853	542.7175	2.145479E-05	25	365.941	0.08850929	8009.179	787.4328	4.434651E-08	29	280.571	GSTP1	GSTP1_E322_R	6552334	NM_000852.2	GSTP1	2950	11	36.1	67108184	322	Y	CAAACTTTTCTTTGTTCGCTGCAGTGCCGCCCTACACCGTGGTCTATTTCCCAG	PI, DFN7, GST3, FAEES3	deafness, X-linked 7; fatty acid ethyl ester synthase III; go_component: cytoplasm; go_function: transferase activity; go_function: glutathione transferase activity; go_process: metabolism; go_process: anti-apoptosis; go_process: central nervous system development	glutathione transferase
GSTP1_P74_F	2619	0.1584638	2600.135	508.4436	0.08519312	35	112.8857	0.0881027	7837.818	766.91	2.434938E-07	32	426.3821	0.07196148	9376.818	734.8466	7.002429E-11	29	447.458	0.1276832	3508.342	528.1622	0.06373688	35	166.0428	0.08392779	8099.504	751.214	2.788335E-08	29	638.5641	0.1080256	7983.65	978.9976	1.146685E-09	31	499.0554	0.07931811	9077.161	790.6261	3.702777E-08	25	355.0623	0.08270462	10575.73	962.5384	5.998259E-08	28	669.5783	0.1042323	6265.096	740.6484	3.247967E-05	26	375.7044	0.07191209	10563.99	826.2897	1.193941E-13	28	592.8746	GSTP1	GSTP1_P74_F	6552334	NM_000852.2	GSTP1	2950	11	36.1	67107788	-74	Y	GGGACCCTCCAGAAGAGCGGCCGGCGCCGTGACTCAGCACTGGGGCG	PI, DFN7, GST3, FAEES3	deafness, X-linked 7; fatty acid ethyl ester synthase III; go_component: cytoplasm; go_function: transferase activity; go_function: glutathione transferase activity; go_process: metabolism; go_process: anti-apoptosis; go_process: central nervous system development	glutathione transferase
GSTP1_seq_38_S153_R	6038	0.07320257	2935.656	239.7695	0.07626825	31	134.7897	0.03813613	8845.553	354.6747	2.276534E-08	29	452.9487	0.03419902	10661.86	381.0776	4.679392E-13	26	555.335	0.03730316	4476.84	177.3462	0.02684952	33	242.9683	0.03799745	8747.311	349.4536	9.539389E-09	30	323.4646	0.04304016	9323.914	423.8493	1.750516E-11	26	559.4141	0.03943979	9273.374	384.8628	8.133741E-08	33	457.5877	0.03159173	11898.4	391.4156	5.324928E-09	25	512.3956	0.07137048	6876.969	536.2199	8.11536E-06	29	325.0234	0.03659288	10226.43	392.2265	8.082147E-12	34	462.5959	GSTP1	GSTP1_seq_38_S153_R	6552334	NM_000852.2	GSTP1	2950	11	36.1	67107814	-48	Y	CCGTGACTCAGCACTGGGGCGGAGCGGGGCGGGACCACCCTTATAAGGCTCG	PI, DFN7, GST3, FAEES3	deafness, X-linked 7; fatty acid ethyl ester synthase III; go_component: cytoplasm; go_function: transferase activity; go_function: glutathione transferase activity; go_process: metabolism; go_process: anti-apoptosis; go_process: central nervous system development	glutathione transferase
GUCY2D_E419_R	2999	0.08658023	3117.859	305.0109	0.04931886	31	97.90693	0.07001625	8190.498	624.1717	1.078446E-07	31	304.9471	0.07632455	9356.062	781.3672	6.138664E-11	30	341.6738	0.0489352	3331.169	176.5442	0.1195328	37	102.9498	0.07288064	8507.973	676.6708	6.449338E-09	26	265.137	0.108074	7229.355	888.0927	6.542771E-08	41	286.6438	0.09754535	8057.314	881.7153	1.04105E-06	34	365.285	0.09379449	9719.764	1016.37	6.54656E-07	45	308.6627	0.1011718	6650.334	759.8152	8.202693E-06	27	372.4646	0.06623749	8785.066	630.2721	2.942013E-09	25	278.262	GUCY2D	GUCY2D_E419_R	4504216	NM_000180.1	GUCY2D	3000	17	36.1	7847132	419	Y	CGGGTGGGCTTCCGGACCCCGGGCTCTGCGGTCCCGCGTGGTGGGCTCC	LCA, CYGD, LCA1, CORD6, GUC2D, retGC, GUC1A4, RETGC-1, ROS-GC1	go_component: nuclear outer membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: protein kinase activity; go_function: guanylate cyclase activity; go_process: cGMP biosynthesis; go_process: sensory perception; go_process: visual perception; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: receptor guanylyl cyclase signaling pathway	guanylate cyclase 2D, membrane (retina-specific)
GUCY2D_P48_R	1950	0.1098849	7569.675	946.8234	2.871447E-10	25	404.4361	0.1511486	10282.95	1848.813	1.2989E-14	29	457.532	0.1555492	10456.07	1944.445	1.25602E-16	27	438.563	0.265998	3904.814	1451.321	0.008432486	29	241.7093	0.1850386	8993.779	2064.761	5.344864E-13	21	568.3203	0.1897928	10471.47	2476.391	9.664022E-21	22	517.7909	0.1922898	10205.46	2453.398	1.533118E-13	30	607.6674	0.2241277	11778.93	3431.488	8.07316E-14	24	715.0378	0.184023	8553.19	1951.509	9.19794E-12	29	620.1022	0.1707751	9418.022	1960.193	1.278574E-13	30	467.2876	GUCY2D	GUCY2D_P48_R	4504216	NM_000180.1	GUCY2D	3000	17	36.1	7846665	-48	Y	AGGGCTCTGGCCGGCTGTACCCACGCCCCCGCCCTGGCCTGGGCTGGC	LCA, CYGD, LCA1, CORD6, GUC2D, retGC, GUC1A4, RETGC-1, ROS-GC1	go_component: nuclear outer membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: protein kinase activity; go_function: guanylate cyclase activity; go_process: cGMP biosynthesis; go_process: sensory perception; go_process: visual perception; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: receptor guanylyl cyclase signaling pathway	guanylate cyclase 2D, membrane (retina-specific)
GUCY2F_P255_F	1954	0.4733278	2880.666	2678.767	0.0001864933	39	180.5345	0.8228555	2652.281	12784.64	5.095175E-24	30	811.459	0.8739249	2316.296	16749.23	3.678E-38	23	1101.178	0.7597931	989.2126	3445.265	0.03711791	25	139.0534	0.81489	2944.416	13402.1	2.934875E-29	18	1412.855	0.7624266	4758.475	15591.94	3.678E-38	27	1061.872	0.7905902	4199.111	16230.54	9.257485E-37	30	1083.484	0.8238549	4157.303	19911.99	1.236193E-35	30	954.9785	0.7561119	3107.77	9944.86	1.633456E-18	39	1027.416	0.8631349	3143.47	20454.83	3.678E-38	24	1060.029	GUCY2F	GUCY2F_P255_F	4504218	NM_001522.1	GUCY2F	2986	X	36.1	108612196	-255	N	CCATTCTGTCTAATAACCACCAATCGCCCTTTCTCCAGGACAGTTCTAAATGC	CYGF, GC-F, GUC2F, GUC2DL, RETGC-2, ROS-GC2	guanylate cyclase 2D-like, membrane (retina-specific); go_component: nuclear outer membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: guanylate cyclase activity; go_function: protein-tyrosine kinase activity; go_process: cGMP biosynthesis; go_process: sensory perception; go_process: visual perception; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: receptor guanylyl cyclase signaling pathway	guanylate cyclase 2F
GUCY2F_P995_F	1953	0.5102566	622.142	752.3896	0.5701729	28	38.55051	0.8958583	1146.304	10721.08	5.719011E-14	23	337.016	0.9093663	1020.731	11244.77	2.988759E-16	32	370.986	0.7727547	359.6733	1563.134	0.445182	25	64.01337	0.08200568	3088.123	284.7993	0.1076197	20	135.7035	0.09775596	3687.816	410.4007	0.02509435	29	119.2341	0.1789077	2757.673	622.658	0.1737239	33	101.1808	0.8426009	2257.298	12619.28	3.28926E-13	32	615.1944	0.1055284	3509.071	425.7928	0.05450906	38	138.3009	0.819765	1674.594	8071.41	6.315644E-10	34	310.2401	GUCY2F	GUCY2F_P995_F	4504218	NM_001522.1	GUCY2F	2986	X	36.1	108612936	-995	N	AAACCGTTTTCAAGGTTCATGCACGTTCTAGCCTGTACCAGTACTTCATTTCTTT	CYGF, GC-F, GUC2F, GUC2DL, RETGC-2, ROS-GC2	guanylate cyclase 2D-like, membrane (retina-specific); go_component: nuclear outer membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: guanylate cyclase activity; go_function: protein-tyrosine kinase activity; go_process: cGMP biosynthesis; go_process: sensory perception; go_process: visual perception; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: receptor guanylyl cyclase signaling pathway	guanylate cyclase 2F
H19_E213_F	3363	0.3069208	6989.803	3139.624	1.115908E-14	25	510.3555	0.8679628	1977.203	13654.74	1.183995E-24	31	1179.125	0.8310483	2653.801	13545.54	3.696664E-29	41	743.8174	0.3919337	2815.206	1879.018	0.02526112	24	165.2966	0.9363519	1070.264	17216.21	5.437858E-37	24	2005.723	0.8508301	3160.744	18598.51	3.678E-38	29	1300.796	0.8558353	2499.379	15431.25	5.777457E-28	32	1044.183	0.1218674	9178.483	1287.669	1.399005E-06	26	548.0992	0.9036324	1178.621	11989.54	7.363563E-19	26	827.5665	0.8724828	1936.882	13936.51	3.249584E-27	22	622.0574	H19	H19_E213_F	57862814	NR_002196.1	H19	283120	11	36.1	1975428	213	N	TCGCCCTGTCTGCACGATGCCTGGGCGCCTACTCCACACTCCTCACTGGCCT	ASM, BWS, ASM1, MGC4485, PRO2605, D11S813E	synonyms: ASM, BWS, ASM1, MGC4485, PRO2605, D11S813E	.
H19_P1411_R	950	0.2844485	5372.893	2175.603	4.815226E-08	16	261.1605	0.8243653	3712.97	17896.69	3.678E-38	24	1391.302	0.8492303	3808.085	22012.81	3.678E-38	32	874.4683	0.2325045	602.8063	212.9076	0.7218205	28	34.25628	0.8259057	3175.789	15540.39	3.678E-38	29	1157.72	0.8606359	3135.955	19983.48	3.678E-38	28	1377.015	0.82386	3383.685	16294.25	5.557868E-34	30	1333.131	0.8363943	4181.088	21886.02	3.678E-38	21	1038.215	0.8104497	2179.992	9748.435	2.50627E-15	23	792.3899	0.7849143	4288.769	16015.97	3.678E-38	29	673.4083	H19	H19_P1411_R	57862814	NR_002196.1	H19	283120	11	36.1	1977052	-1411	Y	TGTGGGAGGGGCTAGCACAGGATCCGGTCGTGCTGCCAGCAATGCGCAGG	ASM, BWS, ASM1, MGC4485, PRO2605, D11S813E	synonyms: ASM, BWS, ASM1, MGC4485, PRO2605, D11S813E	.
H19_P541_F	949	0.1036146	1308.072	162.7613	0.5361972	30	76.15324	0.1396838	5569.269	920.4816	0.0002500325	27	411.2383	0.1153624	7767.418	1025.961	3.498659E-08	32	355.335	0.5982282	314.6991	617.4765	0.6956308	26	44.27863	0.1393976	6144.232	1011.42	1.777403E-05	28	299.0136	0.7143393	4088.182	10473.21	1.518219E-26	37	704.8607	0.7154053	3803.79	9813.228	9.533591E-16	33	775.7433	0.1877172	7681.052	1798.188	1.853621E-05	25	387.7629	0.1580448	5644.914	1078.387	8.029279E-05	26	283.0169	0.09868962	5808.555	646.9614	0.0001825132	24	366.9673	H19	H19_P541_F	57862814	NR_002196.1	H19	283120	11	36.1	1976182	-541	Y	CGATTCCCATCCAGTTGACCGAGCTTGTGCTGGTCACCGCGGTTTCCGC	ASM, BWS, ASM1, MGC4485, PRO2605, D11S813E	synonyms: ASM, BWS, ASM1, MGC4485, PRO2605, D11S813E	.
HBEGF_E214_F	2753	0.8627648	4548.721	29225.4	3.678E-38	21	1716.909	0.04827501	12869.96	657.8843	2.802827E-18	23	1352.043	0.05117878	19164.38	1039.108	3.678E-38	32	954.9131	0.7059912	4706.003	11540.46	7.832298E-22	24	1164.847	0.06391519	14337.05	985.7512	1.461465E-25	39	1064.465	0.1025198	14089.61	1620.889	3.819235E-31	34	876.856	0.0705393	15173.44	1159.143	5.307129E-23	26	1070.443	0.08232628	20070.88	1809.569	3.11798E-29	28	795.0387	0.07223015	12100.66	949.8646	1.657175E-18	25	1031.468	0.06039441	15732.45	1017.652	1.871758E-30	21	1016.637	HBEGF	HBEGF_E214_F	4503412	NM_001945.1	HBEGF	1839	5	36.1	139706144	214	Y	AGGCACCAGTCACTTTCGAAGCGGCGGCCACTGGGCGCTGGCACCAGA	DTR, DTS, HEGFL	Diphtheria toxin receptor (heparin-binding EGF-like growth factor); diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor); the last disulfide loop of the EGF domain and the transmembrane domain; cytoplasmic domain; go_component: membrane; go_component: cell surface; go_component: extracellular space; go_component: integral to plasma membrane; go_function: receptor activity; go_function: heparin binding; go_function: growth factor activity; go_function: epidermal growth factor receptor binding; go_process: muscle development; go_process: signal transduction	heparin-binding EGF-like growth factor
HBEGF_P32_R	1955	0.1129603	4494.959	585.1461	0.0008719835	26	214.858	0.0284539	9329.132	276.1532	4.085807E-09	29	418.903	0.02735239	10774.93	305.8203	3.777211E-13	32	504.0364	0.05080564	6043.006	328.8044	0.00112244	33	182.3272	0.03822266	8881.138	356.9257	5.072691E-09	37	376.7097	0.03703214	9428.118	366.4158	1.346889E-11	30	403.0139	0.03772704	9771.83	387.0367	1.20061E-08	21	404.6693	0.0388697	11549.81	471.1377	1.292358E-08	29	427.3219	0.03400286	9018.245	320.96	3.107773E-09	28	359.3528	0.04340059	9035.362	414.4683	2.513029E-09	35	340.3809	HBEGF	HBEGF_P32_R	4503412	NM_001945.1	HBEGF	1839	5	36.1	139706390	-32	Y	GCCGAATGAGCGCTGCCCGGCTCGCGGCCGGGAATAAGGCTCCAGG	DTR, DTS, HEGFL	Diphtheria toxin receptor (heparin-binding EGF-like growth factor); diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor); the last disulfide loop of the EGF domain and the transmembrane domain; cytoplasmic domain; go_component: membrane; go_component: cell surface; go_component: extracellular space; go_component: integral to plasma membrane; go_function: receptor activity; go_function: heparin binding; go_function: growth factor activity; go_function: epidermal growth factor receptor binding; go_process: muscle development; go_process: signal transduction	heparin-binding EGF-like growth factor
HBII-13_E48_F	3370	0.5636431	452.497	713.6616	0.6416245	34	35.84625	0.9123449	831.5331	9695.722	5.944259E-11	36	505.3762	0.9199543	825.9801	10642.16	4.007276E-14	30	511.372	0.8651588	344.4568	2851.693	0.165281	26	144.1814	0.9127731	690.1152	8268.05	1.752924E-08	29	543.7808	0.9208891	749.5696	9889.395	9.221518E-14	26	541.003	0.9393648	609.8454	10996.97	2.492587E-11	24	638.4069	0.9103943	967.2424	10843.18	2.547034E-08	18	457.0756	0.9148171	623.4816	7769.789	1.943755E-07	22	669.7108	0.9343238	768.1331	12350.25	2.762598E-18	26	401.5463	HBII-13	HBII-13_E48_F	30089682	NR_001294.1	HBII-13	347686	15	36.1	22781388	48	N	GTTTACTGAGCATGATGAAGTAAAGCTCAACGTGATTACTCTGAAGTCCAGCCTTACTG	.	.	.
HBII-13_P991_R	960	0.7031139	516.506	1460.068	0.3592152	30	83.48991	0.9549457	565.3171	14101.7	1.328853E-21	39	1086.286	0.9617553	643.0248	18685.14	3.678E-38	33	1192.113	0.5538881	1677.643	2207.104	0.07713531	33	128.804	0.9550391	625.5541	15411.89	4.08971E-28	41	789.8566	0.9426389	842.0493	15481.07	9.359922E-34	21	1181.924	0.9507204	802.2877	17407.26	6.960872E-29	18	1235.643	0.9539695	762.6831	17878.87	5.583724E-21	28	1152.895	0.9336654	585.2813	9645.398	3.887481E-11	32	860.7509	0.9632089	662.592	19965.03	3.678E-38	18	1113.726	HBII-13	HBII-13_P991_R	30089682	NR_001294.1	HBII-13	347686	15	36.1	22780349	-991	N	TTTGCTGAGCCGATTCAACTTAAAAAGCGAGGTCCATACTAAGTGCCCAAGAATCA	.	.	.
HBII-52_E142_F	3375	0.4295557	963.5329	800.8611	0.4320453	35	64.8271	0.7442856	2666.072	8050.966	2.354281E-11	28	680.0352	0.7552592	2953.801	9423.89	1.455382E-16	28	697.3362	0.1438604	736.7806	140.6074	0.7080883	31	51.22169	0.7405511	1761.237	5312.575	2.33031E-05	24	427.0768	0.6923293	3852.198	8893.35	4.560869E-20	32	667.6792	0.7451955	2766.794	8384.16	1.932878E-10	22	1133.739	0.7310541	3574.188	9987.252	5.909232E-11	28	574.0591	0.246003	2085.069	712.9122	0.2366101	33	185.2025	0.6773812	2554.434	5573.337	6.53318E-07	29	369.275	HBII-52	HBII-52_E142_F	29171307	NR_001291.1	HBII-52	338433	15	36.1	22967111	142	N	GGCCCCCGACGGGGCCACTGTATTTCGGGCTGCAGACCTAGAGGCCCTG	RNHBII52	synonym: RNHBII52	.
HBII-52_P563_F	961	0.7078128	1631.178	4193.716	7.369875E-05	33	216.1566	0.91063	1076.802	11990.96	5.073364E-17	20	550.7224	0.9305035	944.3529	13983.06	1.517095E-24	32	745.0766	0.3898312	443.9309	347.5125	0.7271369	40	25.20882	0.9126977	1084.561	12383.94	1.545895E-19	33	575.7536	0.8845882	1487.838	12170.19	3.348011E-23	25	620.0839	0.9159355	1076.762	12821.55	1.979685E-16	31	514.8333	0.9101741	1371.044	14905.58	7.177409E-16	30	588.4935	0.9052696	1002.57	10536.47	2.667327E-14	34	473.5676	0.9249781	905.6489	12399.08	7.889453E-19	34	493.3898	HBII-52	HBII-52_P563_F	29171307	NR_001291.1	HBII-52	338433	15	36.1	22966406	-563	Y	GCCCAGGGGCAGGCTATGTGACTGCCCGGTCTGCAGCTGTAAGTGGTTTCT	RNHBII52	synonym: RNHBII52	.
HBII-52_P659_F	963	0.9220061	770.1563	10286.57	1.292736E-17	23	351.7708	0.9337139	682.4148	11021.19	1.406333E-13	26	802.0134	0.9421882	725.4661	13453.04	5.017318E-22	32	679.5394	0.8769255	659.4006	5410.849	0.002131668	22	234.1652	0.94232	596.7062	11382.11	2.5281E-15	31	454.5631	0.942575	672.3055	12676.63	4.109685E-22	28	737.5322	0.9403171	683.7169	12347.63	2.237183E-14	28	596.9476	0.9483745	670.6192	14156.46	4.038643E-13	20	658.0496	0.9215434	638.0287	8668.813	3.611495E-09	29	609.9153	0.9445134	643.4081	12654.57	8.259017E-19	24	736.6051	HBII-52	HBII-52_P659_F	29171307	NR_001291.1	HBII-52	338433	15	36.1	22966310	-659	Y	GTTGGGGATCCGCCGCAGAAATCACGTGGCGCCCAGGCCAAGGCTGCAA	RNHBII52	synonym: RNHBII52	.
HCK_P46_R	5769	0.1346041	4429.946	704.5901	0.0007382322	36	157.4038	0.04760234	9864.442	498.0386	1.308157E-10	35	359.1351	0.03102101	9840.271	318.2291	5.510447E-11	28	728.7241	0.1466307	3126.774	554.4423	0.09833109	37	152.7543	0.02868192	9624.794	287.1621	2.133197E-10	28	485.1555	0.07795218	8128.378	695.6473	2.299402E-09	23	391.4162	0.04389738	9230.399	428.3851	8.11724E-08	28	508.6938	0.03698263	11722.64	454.0234	7.7547E-09	29	517.5613	0.0532961	8139.991	463.8825	8.100665E-08	28	430.2258	0.02898882	9964.368	300.4643	4.985018E-11	32	679.242	HCK	HCK_P46_R	30795228	NM_002110.2	HCK	3055	20	36.1	30103672	-46	Y	GGCGGAGTTAGCCTCGCTCAGGGCGCGGCTAAGGCGCCCAGATGGCCTGCGG	JTK9	non-AUG (CUG) translation initiation codon; tyrosine protein kinase HCK; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	hemopoietic cell kinase isoform p61HCK
HCK_P858_F	5768	0.1701308	2666.335	567.1241	0.06911297	34	115.1743	0.0994004	7948.936	888.3719	9.864263E-08	31	294.1467	0.1104768	10113.73	1268.522	6.640417E-14	18	702.9957	0.06672732	3426.432	252.1335	0.09863282	15	227.9015	0.1024197	7698.942	889.9097	8.408083E-08	32	297.746	0.2176288	6412.744	1811.622	4.02668E-08	23	790.4175	0.1157107	8497.673	1125.02	9.276856E-08	20	490.3582	0.1329027	9313.142	1442.781	6.186592E-07	24	366.6062	0.1484448	6667.153	1179.664	1.668394E-06	26	470.414	0.1023468	9097.68	1048.683	9.022341E-11	35	396.2418	HCK	HCK_P858_F	30795228	NM_002110.2	HCK	3055	20	36.1	30102860	-858	Y	TGGTGTCTGAATGGAGCAGGCCTGCGGAAGAGAAACCGCTGACCACAGACC	JTK9	non-AUG (CUG) translation initiation codon; tyrosine protein kinase HCK; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	hemopoietic cell kinase isoform p61HCK
HDAC1_P414_R	5786	0.05234018	2547.804	146.2408	0.1584235	24	112.7486	0.1952292	9150.253	2244.017	7.401759E-13	26	581.0534	0.2502311	11113.95	3742.593	2.664909E-24	35	695.2897	0.07349075	1435.26	121.7769	0.5406422	29	48.66953	0.2359969	8543.407	2669.907	2.247516E-13	30	433.9786	0.170553	10424.57	2164.088	1.490641E-19	19	482.7208	0.2124013	9070.083	2473.008	3.338055E-11	29	798.6094	0.3119324	10768.31	4927.101	9.850368E-15	37	600.8415	0.2058394	6269.071	1650.807	1.264334E-06	36	452.5779	0.2947562	10923.15	4607.12	5.337326E-26	27	747.0611	HDAC1	HDAC1_P414_R	13128859	NM_004964.2	HDAC1	3065	1	36.1	32529881	-414	Y	CCTCCTTTGCGGCCACAAACTCGCTTTCTAACCCAGGTTCAGCCCT	HD1, RPD3, GON-10, RPD3L1, DKFZp686H12203	reduced potassium dependency, yeast homolog-like 1; go_component: nucleus; go_component: cytoplasm; go_component: histone deacetylase complex; go_function: hydrolase activity; go_function: protein self binding; go_function: histone deacetylase activity; go_function: transcription factor binding; go_function: transcription factor activity; go_process: transcription; go_process: anti-apoptosis; go_process: histone deacetylation; go_process: chromatin modification; go_process: regulation of transcription, DNA-dependent	histone deacetylase 1
HDAC11_P556_F	971	0.1660245	1098.849	238.662	0.5831109	34	62.78013	0.06065326	8836.514	577.0273	9.312301E-09	20	458.6691	0.05724044	9277.473	569.3611	2.649035E-10	19	346.4629	0.2736031	488.9507	221.8329	0.7444347	26	35.39847	0.06346866	7712.598	529.4592	3.415877E-07	24	428.2777	0.06018478	9091.689	588.6262	2.548055E-11	22	445.5023	0.05545722	7811.491	464.5097	8.877182E-06	29	574.6878	0.05250196	10196.91	570.5634	5.985439E-07	29	471.481	0.07763817	5698.915	488.1133	0.000394667	31	460.9732	0.05728455	8622.864	530.049	9.546379E-09	28	300.6038	HDAC11	HDAC11_P556_F	13376227	NM_024827.1	HDAC11	79885	3	36.1	13496268	-556	Y	GTCTTCGCCGGGAGTGCTTGTCCCGGAGCTGCTCGCAGACTGGGC	FLJ22237	go_component: nucleus; go_component: histone deacetylase complex; go_function: hydrolase activity; go_function: histone deacetylase activity; go_function: transcription factor binding; go_process: transcription; go_process: histone deacetylation; go_process: chromatin modification; go_process: regulation of transcription, DNA-dependent	histone deacetylase 11
HDAC5_E298_F	3380	0.5219694	4972.478	5538.721	7.487128E-16	30	308.9174	0.2565281	9559.381	3332.88	1.486585E-16	34	494.3836	0.2236051	13328.12	3867.357	4.578138E-33	25	628.2139	0.298691	5785.744	2506.768	7.967913E-06	27	384.4013	0.2476366	11265.31	3740.835	1.798374E-24	32	628.549	0.2647165	10890.29	3956.721	1.18673E-27	39	789.1771	0.2960039	10277.48	4363.342	2.620212E-18	37	654.0964	0.2683524	15572.17	5748.211	1.059249E-27	32	1120.905	0.2958798	8044.752	3422.523	4.083835E-14	25	671.6064	0.2073709	9953.956	2630.357	8.979161E-17	33	525.9127	HDAC5	HDAC5_E298_F	62750346	NM_005474.4	HDAC5	10014	17	36.1	39556242	298	Y	GGCTGCCGATGCTCCCGGGGGGCGCCGGCTGGCTCCCAGGGCCGGGA	HD5, NY-CO-9	isoform 1 is encoded by transcript variant 1; antigen NY-CO-9; go_component: nucleus; go_component: cytoplasm; go_component: histone deacetylase complex; go_function: catalytic activity; go_function: hydrolase activity; go_function: histone deacetylase activity; go_function: transcription factor binding; go_function: specific transcriptional repressor activity; go_process: transcription; go_process: chromatin silencing; go_process: chromatin remodeling; go_process: inflammatory response; go_process: B cell differentiation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: negative regulation of striated muscle development	histone deacetylase 5 isoform 1
HDAC6_E102_F	3381	0.07640047	2698.479	231.4911	0.1128441	29	87.31199	0.03042043	5846.96	186.5851	0.0008270001	26	156.3027	0.0282412	6576.604	194.0351	6.70056E-05	33	193.8582	0.3666591	1855.891	1132.321	0.2014076	29	94.96928	0.7427531	2539.125	7619.99	6.252037E-11	34	491.0173	0.7015015	3099.794	7519.836	1.039159E-13	33	454.0554	0.7412816	2419.211	7218.059	8.790413E-08	17	649.5568	0.71075	3564.853	9005.337	2.061933E-09	38	468.456	0.7517291	2113.359	6701.735	3.280337E-08	33	255.0237	0.8056186	2563.488	11038.89	1.022728E-19	33	587.6729	HDAC6	HDAC6_E102_F	13128863	NM_006044.2	HDAC6	10013	X	36.1	48545533	102	Y	GATAAGGGGTGGAGTTAAGTGAATCGTTAAGGGTGGAGTCGAAACC	HD6, JM21	go_component: nucleus; go_component: cytoplasm; go_component: microtubule; go_component: histone deacetylase complex; go_function: actin binding; go_function: metal ion binding; go_function: hydrolase activity; go_function: zinc ion binding; go_function: histone deacetylase binding; go_function: tubulin deacetylase activity; go_function: specific transcriptional repressor activity; go_process: cell cycle; go_process: development; go_process: transcription; go_process: chromatin modification; go_process: histone deacetylation; go_process: regulation of transcription, DNA-dependent	histone deacetylase 6
HDAC6_P153_F	976	0.1089758	1574.557	204.8051	0.426799	29	71.19429	0.07015742	5456.767	419.2628	0.001219889	30	291.9417	0.07712602	6370.931	540.7858	4.27146E-05	31	254.901	0.0726523	1438.652	120.5444	0.5400801	21	117.2273	0.6843563	3123.89	6989.81	7.854187E-11	29	521.0573	0.5790609	4335.681	6101.902	3.161013E-13	29	702.8306	0.6686016	3564.79	7393.772	4.458867E-10	30	612.6246	0.6213848	4988.016	8350.472	1.349674E-10	28	662.7834	0.6704319	2629.875	5553.313	4.534873E-07	28	599.2458	0.6294109	3763.612	6561.982	3.665856E-11	24	1066.241	HDAC6	HDAC6_P153_F	13128863	NM_006044.2	HDAC6	10013	X	36.1	48545278	-153	Y	CGGAGTTTGAGAAAGGGGCTGCGTCCAATGAGTGGAGCGGTGAG	HD6, JM21	go_component: nucleus; go_component: cytoplasm; go_component: microtubule; go_component: histone deacetylase complex; go_function: actin binding; go_function: metal ion binding; go_function: hydrolase activity; go_function: zinc ion binding; go_function: histone deacetylase binding; go_function: tubulin deacetylase activity; go_function: specific transcriptional repressor activity; go_process: cell cycle; go_process: development; go_process: transcription; go_process: chromatin modification; go_process: histone deacetylation; go_process: regulation of transcription, DNA-dependent	histone deacetylase 6
HDAC7A_P344_F	978	0.154313	5009.7	932.3702	4.809854E-05	25	243.3018	0.9111657	1300.154	14361.24	9.481225E-25	23	663.3466	0.9288308	1343.663	18841.27	3.678E-38	32	1044.727	0.2597476	4121.75	1481.372	0.005361068	28	234.3672	0.921532	891.2573	11641.37	7.968319E-17	25	894.4738	0.9218249	1365.23	17277.68	3.678E-38	26	1048.633	0.9139143	1393.155	15851.83	9.000479E-26	34	1034.617	0.9355929	1284.384	20109.91	6.690103E-28	19	877.3352	0.9058408	1172.165	12238.63	1.346205E-19	25	893.8026	0.9164848	1369.122	16121.95	2.421912E-33	21	870.58	HDAC7A	HDAC7A_P344_F	13259521	NM_015401.1	HDAC7A	51564	12	36.1	46479534	-344	N	AGCCTCACAGGCCCTCTGGGTCGCCACCCTCCCATGCTCTATCCC	HDAC7, DKFZP586J0917	isoform a is encoded by transcript variant 1; go_component: nucleus; go_component: cytoplasm; go_component: histone deacetylase complex; go_function: hydrolase activity; go_function: histone deacetylase activity; go_function: transcription factor binding; go_function: specific transcriptional repressor activity; go_process: transcription; go_process: inflammatory response; go_process: B cell differentiation; go_process: chromatin modification; go_process: nervous system development; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: negative regulation of striated muscle development	histone deacetylase 7A isoform a
HDAC9_E38_F	3393	0.163938	2540.283	517.7162	0.09245011	27	77.62424	0.2203716	7661.972	2194.018	1.351684E-09	32	436.8968	0.2226751	8883.231	2573.367	4.289805E-14	32	390.4523	0.3173482	526.679	291.3278	0.7213157	27	49.47679	0.23682	7043.892	2216.798	4.579924E-09	37	365.4037	0.2590669	7298.769	2586.976	8.044694E-12	31	470.3294	0.2100822	7635.621	2057.323	7.149629E-08	33	501.0788	0.2196928	8832.253	2514.845	1.079719E-07	30	531.3751	0.2548837	5911.614	2056.407	1.051375E-06	23	326.4462	0.1979243	8751.041	2184.129	1.494446E-12	34	318.9585	HDAC9	HDAC9_E38_F	7662279	NM_014707.1	HDAC9	9734	7	36.1	18501932	38	N	GAGGCACAGACACAGATAGGAGAAGGGCACCGGCTGGAGCCACTTGCAGGACTG	HD7, HDAC, HDRP, MITR, HDAC7, HDAC7B, HDAC9B, HDAC9FL, KIAA0744, DKFZp779K1053	isoform 3 is encoded by transcript variant 3; MEF-2 interacting transcription repressor (MITR) protein; histone deacetylase 7B; histone deacetylase 4/5-related protein; go_component: nucleus; go_component: cytoplasm; go_component: histone deacetylase complex; go_function: hydrolase activity; go_function: histone deacetylase activity; go_function: transcription factor binding; go_function: specific transcriptional repressor activity; go_process: transcription; go_process: chromatin modification; go_process: histone deacetylation; go_process: inflammatory response; go_process: B cell differentiation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: negative regulation of striated muscle development	histone deacetylase 9 isoform 3
HDAC9_P137_R	984	0.3720286	2441.296	1505.538	0.01703775	38	145.1432	0.3850442	6916.885	4393.504	1.151153E-12	29	869.4983	0.3241814	9621.055	4663.064	2.259501E-22	25	691.1962	0.06507877	3605.956	257.9672	0.07912962	29	129.1993	0.3454496	8158.563	4358.591	8.797299E-17	28	522.1686	0.4101955	8016.105	5644.565	3.276124E-23	25	667.1048	0.3208611	8874.134	4239.855	1.447067E-14	35	697.2042	0.3044128	10897.5	4812.88	9.220352E-15	24	509.9667	0.3587521	5949.351	3384.366	3.188095E-09	17	745.531	0.3379845	9911.34	5111.176	2.965029E-24	33	701.5107	HDAC9	HDAC9_P137_R	7662279	NM_014707.1	HDAC9	9734	7	36.1	18501757	-137	N	GCATTAATGCAGGCTCCAATCACTCGGCCATGCTTGACCTATTTTTGGCTCAGGCC	HD7, HDAC, HDRP, MITR, HDAC7, HDAC7B, HDAC9B, HDAC9FL, KIAA0744, DKFZp779K1053	isoform 3 is encoded by transcript variant 3; MEF-2 interacting transcription repressor (MITR) protein; histone deacetylase 7B; histone deacetylase 4/5-related protein; go_component: nucleus; go_component: cytoplasm; go_component: histone deacetylase complex; go_function: hydrolase activity; go_function: histone deacetylase activity; go_function: transcription factor binding; go_function: specific transcriptional repressor activity; go_process: transcription; go_process: chromatin modification; go_process: histone deacetylation; go_process: inflammatory response; go_process: B cell differentiation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: negative regulation of striated muscle development	histone deacetylase 9 isoform 3
HFE_E273_R	3397	0.5340878	3071.704	3635.81	2.290724E-06	28	288.5034	0.04515497	9554.729	456.5757	6.70009E-10	33	489.5925	0.05096167	11189.01	606.2	5.624507E-15	21	649.9318	0.74049	1265.259	3895.651	0.01186113	25	299.096	0.05342164	7531.004	430.6677	1.009497E-06	36	548.0001	0.04762452	8654.947	437.8002	5.899305E-10	32	572.8104	0.04555979	9029.723	435.8034	1.647946E-07	30	480.1636	0.05314919	10364.87	587.4205	3.506396E-07	28	494.9673	0.06226683	6449.178	434.8748	4.824073E-05	30	440.3735	0.0376548	12084.9	476.7728	1.036951E-16	33	554.7177	HFE	HFE_E273_R	21040354	NM_139010.1	HFE	3077	6	36.1	26195700	273	Y	TCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGCGTGAGTCC	HH, HFE1, HLA-H, MGC103790, dJ221C16.10.1	isoform 10 precursor is encoded by transcript variant 10; MHC class I-like protein HFE; hereditary hemochromatosis protein HLA-H; go_component: cytoplasm; go_component: plasma membrane; go_component: MHC class I protein complex; go_component: integral to plasma membrane; go_function: iron ion binding; go_function: MHC class I receptor activity; go_process: ion transport; go_process: antigen presentation; go_process: iron ion transport; go_process: iron ion homeostasis; go_process: protein complex assembly; go_process: receptor mediated endocytosis; go_process: antigen presentation, endogenous antigen; go_process: antigen processing, endogenous antigen via MHC class I	hemochromatosis protein isoform 10 precursor
HGF_E102_R	2755	0.2603981	4716.255	1695.701	7.824997E-06	34	223.5204	0.5650592	5872.097	7758.732	1.443405E-18	26	939.9891	0.6968238	5768.365	13487.92	3.678E-38	21	1131.251	0.02537807	6226.61	164.7379	0.001075404	22	240.1251	0.4275425	7786.384	5889.982	3.605135E-20	29	719.968	0.5681149	7136.245	9518.779	3.241536E-35	22	1333.812	0.6208255	5567.464	9279.384	7.543191E-19	36	955.7035	0.5725708	8304.296	11258.13	3.534672E-23	31	826.674	0.6600101	3894.448	7754.277	1.382734E-14	21	1258.518	0.4910168	9122.991	8897.434	1.72434E-35	31	1336.12	HGF	HGF_E102_R	58533164	NM_001010933.1	HGF	3082	7	36.1	81237286	102	N	ATGCCTGGGTGAAAGAATCCTGTTCGGAGTCAGTGCCTAAAAGAGCCAGTCG	SF, HGFB, HPTA, F-TCF	isoform 4 precursor is encoded by transcript variant 4; hepatopoietin A; fibroblast-derived tumor cytotoxic factor; scatter factor; lung fibroblast-derived mitogen; go_component: cellular component unknown; go_function: calcium ion binding; go_function: growth factor activity; go_function: serine-type endopeptidase activity; go_process: mitosis; go_process: proteolysis; go_process: blood coagulation	hepatocyte growth factor isoform 4 precursor
HGF_P1293_R	1961	0.7937476	425.3048	2021.598	0.2175884	24	81.40638	0.9336984	917.5115	14329.2	2.074403E-23	33	979.4637	0.9465747	897.9394	17681.22	3.678E-38	22	1190.063	0.8609964	299.2786	2473.155	0.2435017	27	146.7271	0.9421775	817.8463	14955.66	3.71225E-27	29	797.6559	0.9277259	1077.641	15116.43	3.391683E-33	25	1325.988	0.9422409	906.4024	16417.74	5.081418E-26	26	980.8885	0.9453723	992.6147	18908.52	5.130428E-24	25	833.9029	0.907577	796.1125	8799.664	9.241716E-10	17	296.8738	0.9491919	911.4535	18895.88	3.678E-38	28	881.9008	HGF	HGF_P1293_R	58533164	NM_001010933.1	HGF	3082	7	36.1	81238681	-1293	N	AGGCCAAATGTGGGAATGACTAGAGCGGTGGGTAGCTGTACAGAAGTGAT	SF, HGFB, HPTA, F-TCF	isoform 4 precursor is encoded by transcript variant 4; hepatopoietin A; fibroblast-derived tumor cytotoxic factor; scatter factor; lung fibroblast-derived mitogen; go_component: cellular component unknown; go_function: calcium ion binding; go_function: growth factor activity; go_function: serine-type endopeptidase activity; go_process: mitosis; go_process: proteolysis; go_process: blood coagulation	hepatocyte growth factor isoform 4 precursor
HHIP_E94_F	2760	0.1054493	3726.767	451.0978	0.01002558	32	201.5534	0.1028955	4388.127	514.7762	0.01024812	33	237.5612	0.07343473	4843.875	391.8258	0.004323481	32	182.3599	0.05692693	4380.371	270.4496	0.02698676	31	216.7084	0.06803514	4350.384	324.8862	0.01267016	27	276.4368	0.09579107	5285.01	570.483	0.0003251441	25	237.3086	0.0915131	5029.189	516.6701	0.007712037	37	158.2224	0.09379545	5412.421	570.5555	0.01615681	27	273.6223	0.07681905	3958.89	337.7454	0.02975808	17	256.8677	0.0645559	5705.57	400.6479	0.0004870476	33	255.0483	HHIP	HHIP_E94_F	88976807	XM_933718.1	LOC646576	646576	4	36.1	145786717	323	Y	GGGGCGCGCTGTGGCAGCACCTCCCCGCGCGCTAGTTAAAAAGAAGAAGAAAAG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_938811
HHIP_P307_R	2209	0.07927827	7281.401	635.5717	7.464969E-09	29	312.41	0.355781	11336.42	6315.956	9.748118E-32	30	928.3002	0.1319475	17084.49	2612.111	3.678E-38	35	1032.326	0.04509179	6496.584	311.4977	0.0004160655	29	330.8848	0.2546653	13803.45	4750.517	3.932329E-38	26	1183.13	0.1433549	12830.68	2163.878	3.112739E-28	38	874.5199	0.2671708	13748.69	5048.878	7.13771E-31	23	1718.794	0.3160453	17956.92	8343.834	3.678E-38	26	963.1456	0.3457061	10058.77	5367.541	2.546918E-26	15	1419.308	0.2846691	16412.49	6571.217	3.678E-38	31	1010.066	HHIP	HHIP_P307_R	20143972	NM_022475.1	HHIP	64399	4	36.1	145786316	-307	Y	GGCCCACTCTTACTTACTTTCTTTCGGAGCCTCAGCTTGGCCGCCTTTAGCC	HIP, FLJ20992, FLJ90230	synonyms: HIP, FLJ20992, FLJ90230	hedgehog-interacting protein
HHIP_P578_R	2230	0.07972892	6570.221	577.8835	3.241049E-07	27	288.128	0.4354428	6267.58	4911.313	2.2833E-12	20	623.4949	0.2517546	11882.75	4031.713	4.341486E-28	32	566.5956	0.06714689	6156.546	450.347	0.0006638198	31	348.7957	0.3178858	8645.632	4075.728	2.355636E-17	30	837.8303	0.3427483	8284.691	4372.509	8.903441E-20	33	888.0051	0.3941769	6951.559	4588.074	3.391202E-11	32	557.4514	0.5968046	5284.922	7970.692	1.827376E-10	37	557.4628	0.2591147	9276.743	3279.39	4.577322E-17	28	865.0522	0.3256473	8767.299	4282.05	4.37257E-18	31	718.89	HHIP	HHIP_P578_R	20143972	NM_022475.1	HHIP	64399	4	36.1	145786045	-578	Y	AAACCATCTCAGCCTACTCAACGGCATCTGGGATGTCCCCCTGCCTCTA	HIP, FLJ20992, FLJ90230	synonyms: HIP, FLJ20992, FLJ90230	hedgehog-interacting protein
HIC1_E151_F	3398	0.1700345	1341.061	295.2292	0.4773418	27	131.6326	0.05396656	6071.53	352.0554	0.0002993454	23	346.1184	0.05191889	6660.869	370.2393	2.892126E-05	36	320.9031	0.2943995	1106.24	503.2824	0.5269594	29	88.98025	0.05987246	5431.932	352.3037	0.001017708	32	308.7391	0.07421342	5586.381	455.8348	0.0001826703	33	344.3562	0.06547123	5562.955	396.7354	0.003408987	53	253.5221	0.05347588	7733.917	442.5937	0.0003551003	22	375.541	0.08222291	4512.187	413.2021	0.008797882	29	423.4465	0.06479887	4616.549	326.8036	0.00794435	27	222.8977	HIC1	HIC1_E151_F	61676185	NM_006497.2	HIC1	3090	17	36.1	1905164	151	Y	GGGGCTGAGACGCGACCAGGACGCGGGGAGGACGGACCAGCAGG	hic-1, ZBTB29	go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: cell cycle; go_process: development; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle	hypermethylated in cancer 1
HIC1_P565_R	1000	0.113246	3100.706	408.7572	0.04192369	33	136.1584	0.03574437	11089.94	414.8041	4.114164E-13	27	710.062	0.04177082	14473.31	635.2753	3.544934E-25	17	660.4525	0.4047137	368.7007	318.6526	0.7493499	26	24.72939	0.03219268	10114.03	339.7547	1.382561E-11	32	762.0143	0.06173521	10324.86	685.927	8.829119E-15	39	645.5064	0.05004095	11504.04	611.2657	2.26748E-12	33	744.1069	0.03706609	12777.81	495.7038	1.711934E-10	31	684.2392	0.06962573	9453.478	714.9465	5.360299E-11	25	792.817	0.05811666	13004.41	808.576	2.336786E-20	25	771.2691	HIC1	HIC1_P565_R	61676185	NM_006497.2	HIC1	3090	17	36.1	1904448	-565	Y	GCTGTCCAGCCACTTCCAGTCGCCCTGATGACTCGTCGTGGGTTCCTTTAGG	hic-1, ZBTB29	go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: cell cycle; go_process: development; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle	hypermethylated in cancer 1
HIC-1_seq_48_S103_R	6059	0.01928648	18265.83	361.1781	3.678E-38	35	817.6248	0.623401	2118.436	3672.274	0.001497991	32	313.2773	0.5726908	2866.286	3975.492	5.347272E-05	32	323.4081	0.0165979	12555.35	213.5975	2.077148E-13	28	828.6135	0.4078555	2517.818	1803.092	0.02471124	30	401.6538	0.5202444	2595.339	2922.811	0.0008707169	27	324.4061	0.4436618	2683.564	2219.802	0.02371957	26	440.8907	0.301727	4299.536	1901.06	0.01178585	23	274.8747	0.4967424	2033.601	2105.979	0.03903044	32	181.8564	0.2367678	2266.884	734.2482	0.1759609	33	184.5464	HIC-1	HIC-1_seq_48_S103_R	.	.	.	.	17	36.1	1907679	.	Y	TAGTCTCCTCTATCGCTGGATGAAGCACGAGCCGGGCCTGGGTAGCTATGGCGACGAGC	.	.	.
HIC2_P498_F	1002	0.1376552	5784.342	939.3114	2.137984E-06	36	271.5779	0.08522876	9196.407	866.1414	5.300468E-10	24	500.429	0.07128443	13919.27	1076.062	8.816918E-25	36	591.3132	0.09800655	7286.447	802.5781	1.445401E-05	24	278.06	0.08959658	8979.767	893.5776	2.575892E-10	22	547.276	0.1029407	8662.459	1005.523	2.728233E-11	19	965.1375	0.07561751	12431.6	1025.126	2.296997E-15	35	953.53	0.08269519	12769.64	1160.201	1.45852E-11	25	447.5476	0.1088562	9282.794	1146.14	1.376282E-11	33	362.2084	0.07691211	11467.75	963.8305	2.358066E-16	28	493.7062	HIC2	HIC2_P498_F	31657120	NM_015094.1	HIC2	23119	22	36.1	20101195	-498	Y	TGAGCCTCGGGCAACCGCAGGGAGCGTCGAGCAGGGGTCGCAAAGG	HRG22, ZBTB30, KIAA1020	HIC1-related gene on chromosome 22; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein C-terminus binding; go_process: transcription; go_process: negative regulation of transcription, DNA-dependent	hypermethylated in cancer 2
HIC2_P528_R	1001	0.0820334	3295.575	303.443	0.03524712	30	209.8367	0.07045968	9169.497	702.6331	1.257349E-09	30	608.7832	0.05728302	10756.74	659.6965	5.433959E-14	17	950.3898	0.09566303	3205.041	349.6155	0.1135017	29	267.9434	0.05078487	10345.62	558.861	1.24883E-12	28	459.6511	0.07592539	11582.85	959.9064	2.101263E-19	34	396.3493	0.06545709	12556.13	886.4586	2.480825E-15	23	926.5266	0.07146364	11754.3	912.351	1.479259E-09	29	351.4951	0.1004004	5828.85	661.6933	0.0001635369	31	602.7235	0.06922843	11818.04	886.4335	4.161625E-17	27	330.9038	HIC2	HIC2_P528_R	31657120	NM_015094.1	HIC2	23119	22	36.1	20101165	-528	Y	CCCGAGCTTGCAGTCACTGCTGGCTGCGCCTTTGAGCCTCGGGCAACCGCAG	HRG22, ZBTB30, KIAA1020	HIC1-related gene on chromosome 22; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein C-terminus binding; go_process: transcription; go_process: negative regulation of transcription, DNA-dependent	hypermethylated in cancer 2
HIF1A_P488_F	4102	0.1476917	1760.656	322.4227	0.324331	34	56.49121	0.143653	6059.006	1033.179	4.382911E-05	41	339.6035	0.2360275	5394.819	1697.611	2.359632E-05	36	323.5632	0.1479642	641.6786	128.7996	0.7316882	32	28.15119	0.2296449	4210.775	1285.054	0.002089903	25	300.9494	0.202857	4826.35	1253.658	0.0001621065	32	244.014	0.257347	4940.305	1746.586	0.0006788618	33	284.9041	0.2037693	5530.375	1440.911	0.003451267	23	341.9776	0.2410776	3947.032	1285.571	0.004484103	28	291.9957	0.2233893	6171.055	1803.847	1.166353E-06	22	332.217	HIF1A	HIF1A_P488_F	31077212	NM_001530.2	HIF1A	3091	14	36.1	61231504	-488	Y	GGCGGCAATCGTGCCCAGCACTGAGGCCGAGGAGAAAGAGAGCAGGAGCATTACAT	MOP1, PASD8, HIF-1alpha, HIF1-ALPHA	HIF1-alpha; ARNT interacting protein; bHLH-PAS member isoform 1 is encoded by transcript variant 1; member of PAS superfamily 1; go_component: nucleus; go_component: nucleus; go_function: heme binding; go_function: iron ion binding; go_function: protein binding; go_function: monooxygenase activity; go_function: signal transducer activity; go_function: transcription factor activity; go_function: histone acetyltransferase binding; go_function: protein heterodimerization activity; go_function: protein heterodimerization activity; go_function: RNA polymerase II transcription factor activity, enhancer binding; go_process: homeostasis; go_process: electron transport; go_process: signal transduction; go_process: response to hypoxia; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	hypoxia-inducible factor 1, alpha subunit isoform 1
HLA-DOA_P191_R	1009	0.176502	3150.302	696.6438	0.02117737	22	251.7571	0.3927064	4118.748	2728.053	9.109246E-05	17	179.0137	0.4048942	3813.732	2662.8	0.000165124	23	426.811	0.3528291	1055.829	630.1427	0.5069764	20	166.6771	0.4130366	3408.721	2469.031	0.0007981181	32	205.6531	0.428195	3491.796	2689.709	0.0001170909	28	315.058	0.4390253	3468.639	2792.859	0.001794209	33	253.7846	0.4463405	4229.422	3490.226	0.0008851215	23	326.4798	0.4338152	3664.483	2884.376	0.0001372397	22	392.6927	0.439842	3657.096	2950.111	0.0001167164	26	245.0432	HLA-DOA	HLA-DOA_P191_R	62912477	NM_002119.3	HLA-DOA	3111	6	36.1	33085558	-191	N	GGAGGGGCTTGGACCAACTATTACCACGTCCTCCAAGAAGGGACCCCCTGA	HLADZ, HLA-DNA, HLA-DZA	major histocompatibility complex, class II, DN alpha; lymphocyte antigen; HLA-D0-alpha; MHC class II antigen; go_component: plasma membrane; go_component: integral to membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DO alpha precursor
HLA-DOA_P594_F	1006	0.3548072	2904.443	1652.216	0.003866734	25	164.4459	0.8909689	1231.774	10882.85	1.431504E-14	36	705.3164	0.8361812	2064.021	11045.82	1.105411E-18	28	555.665	0.06332738	9991.635	682.2841	2.090927E-09	33	798.7354	0.8612861	1433.474	9521.468	9.471676E-13	28	649.0366	0.8567951	1751.485	11077.43	2.41438E-20	21	765.5949	0.8404604	1705.553	9511.717	1.443344E-10	47	593.9955	0.8690743	1891.141	13217.03	1.245954E-13	38	403.7395	0.8339021	1397.349	7517.505	2.120942E-08	28	832.2576	0.892239	1459.09	12908.94	4.225216E-22	27	628.6041	HLA-DOA	HLA-DOA_P594_F	62912477	NM_002119.3	HLA-DOA	3111	6	36.1	33085961	-594	N	CTGTTGGTCCCTCCAGGACCCGGGCACCTCCTCCAGGCTGACACA	HLADZ, HLA-DNA, HLA-DZA	major histocompatibility complex, class II, DN alpha; lymphocyte antigen; HLA-D0-alpha; MHC class II antigen; go_component: plasma membrane; go_component: integral to membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DO alpha precursor
HLA-DOB_E432_R	3429	0.1906484	4474.721	1077.607	0.0001910459	27	298.8153	0.7601114	3452.553	11256.62	9.878723E-22	23	855.4957	0.7390218	4230.759	12263.57	2.739786E-30	30	588.5556	0.04045364	3119.473	135.7302	0.1558374	27	204.9352	0.7471231	3550.919	10786.61	2.975735E-22	24	786.175	0.7672444	3402.77	11546.36	4.707E-28	23	1077.064	0.7321942	4123.833	11548.17	4.227426E-21	28	712.6791	0.7286701	4384.544	12043.47	3.56491E-16	26	913.0502	0.7243135	3138.019	8507.273	1.411618E-14	33	563.4184	0.7655792	3332.593	11210.27	1.1507E-22	26	672.2377	HLA-DOB	HLA-DOB_E432_R	18641377	NM_002120.2	HLA-DOB	3112	6	36.1	32892330	432	N	AGGCTCGAACCCAAGCCAAGGCCTTCAACACGCCCAGGCACTGACTGAGGTTGAT	DOB	HLA class II histocompatibility antigen, DO beta chain; class II beta chain; go_component: membrane; go_component: integral to membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DO beta precursor
HLA-DOB_P1114_R	1011	0.6091895	1549.622	2571.406	0.01146323	26	113.8645	0.9434205	628.282	12143.55	3.079589E-16	24	678.5359	0.9370556	723.4847	12259.26	2.638842E-18	22	592.3626	0.04737093	4123.361	210.013	0.04282114	21	205.4904	0.9471551	620.8469	12919.94	9.344044E-20	23	741.6337	0.935994	783.8149	12924.49	2.213056E-23	32	564.6209	0.9321514	759.6965	11811.11	2.39396E-13	39	482.3319	0.9510068	771.9861	16926.13	7.545406E-19	18	816.6987	0.9329211	717.0664	11363.61	9.699998E-16	23	667.7986	0.9406794	642.9075	11780.7	2.479129E-16	22	489.4546	HLA-DOB	HLA-DOB_P1114_R	18641377	NM_002120.2	HLA-DOB	3112	6	36.1	32893876	-1114	N	AAAAAGTTGACCTCATCGAAGTAAAGAGTACGTTAGGAGTTACCAGAGGCTGGG	DOB	HLA class II histocompatibility antigen, DO beta chain; class II beta chain; go_component: membrane; go_component: integral to membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DO beta precursor
HLA-DOB_P357_R	1015	0.6097373	424.2869	819.1336	0.6155605	29	37.74045	0.9519982	477.3286	11449.89	4.102302E-14	21	1054.354	0.9533879	495.1899	12173.81	2.169305E-17	30	373.9754	0.6634622	340.7528	868.9154	0.6292539	26	49.9672	0.9231331	464.686	6781.595	1.311073E-05	24	410.5142	0.9577958	498.7006	13587.09	9.363082E-25	22	466.183	0.9516499	508.7126	11980.98	3.597783E-13	25	700.0508	0.95412	533.728	13179.01	3.343789E-11	31	468.1591	0.9313753	450.3143	7468.875	1.267656E-06	32	739.004	0.9563417	491.3517	12953.64	3.031596E-19	20	419.4649	HLA-DOB	HLA-DOB_P357_R	18641377	NM_002120.2	HLA-DOB	3112	6	36.1	32893119	-357	N	CCTTCTTATTGGGTGTTGACATTGCCGACAGGCAGTGTGTAAATTAAGAAGGAA	DOB	HLA class II histocompatibility antigen, DO beta chain; class II beta chain; go_component: membrane; go_component: integral to membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DO beta precursor
HLA-DPA1_E35_R	3435	0.2789116	3315.998	1321.283	0.00311476	27	187.5308	0.7137417	3430.036	8801.61	7.348041E-15	25	464.3065	0.7143993	3750.956	9632.75	1.640739E-19	30	562.8882	0.3974085	2549.991	1747.666	0.04499774	18	214.1434	0.7141228	2951.373	7622.346	7.374996E-12	26	448.5979	0.6403542	4341.742	7908.58	1.811379E-18	24	372.9705	0.7079005	3739.329	9304.576	2.0943E-14	16	816.7194	0.6662008	4157.884	8497.941	1.535636E-09	34	464.3042	0.7038997	3260.121	7987.794	1.473264E-13	38	430.5361	0.7343009	3148.842	8978.682	1.549113E-15	34	518.1517	HLA-DPA1	HLA-DPA1_E35_R	24797073	NM_033554.2	HLA-DPA1	3113	6	36.1	33149321	35	N	CTCTGATATGGAACATTCTGTCTTCAGGGCGCATGTTGTGGGGTCTATAATTGA	HLADP, HLASB, HLA-DP1A	HLA class II histocompatibility antigen, DP alpha chain; MHC class II HLA-DPA1 antigen; MHC class II antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DP alpha 1 precursor
HLA-DPA1_P205_R	1022	0.210755	4668.94	1273.468	4.803865E-05	28	254.2893	0.1982602	9170.357	2292.443	5.145668E-13	21	481.9515	0.2093472	10489.65	2803.902	3.089803E-19	21	734.9637	0.07715613	5107.681	435.3982	0.00599826	30	155.1398	0.2022331	9134.129	2340.842	5.035442E-14	31	466.283	0.2203359	9449.313	2698.671	3.797409E-18	29	693.5896	0.2324392	8995.818	2754.472	1.282687E-11	33	593.2061	0.2047574	11623.82	3018.623	8.626203E-13	27	348.9324	0.2383878	8332.83	2639.511	7.089967E-13	21	701.5891	0.2445128	10444.35	3412.671	1.710586E-20	27	608.3187	HLA-DPA1	HLA-DPA1_P205_R	24797073	NM_033554.2	HLA-DPA1	3113	6	36.1	33149561	-205	N	GAAGAGATGGGAGAATTTTAGGTACCAGCGTGGTCAAGAGAGCTCCAGTTCACAGTT	HLADP, HLASB, HLA-DP1A	HLA class II histocompatibility antigen, DP alpha chain; MHC class II HLA-DPA1 antigen; MHC class II antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DP alpha 1 precursor
HLA-DPA1_P28_R	1020	0.07533079	3059.176	257.3712	0.05978363	33	124.4107	0.3000815	7096.248	3085.303	3.059664E-10	35	447.2664	0.2956748	8229.503	3496.714	8.556087E-15	29	489.9757	0.2648961	275.55	135.3302	0.8033849	30	15.05658	0.33624	6666.145	3427.517	8.68263E-11	19	567.7662	0.3167301	7206.917	3387.124	1.21668E-13	37	709.5549	0.2611673	7514.228	2691.525	9.978114E-09	27	515.3718	0.2940874	8643.523	3642.603	5.390905E-09	30	448.2671	0.3007721	5522.505	2418.514	1.166157E-06	23	345.1995	0.3681795	7699.59	4545.04	7.549883E-16	26	522.0495	HLA-DPA1	HLA-DPA1_P28_R	24797073	NM_033554.2	HLA-DPA1	3113	6	36.1	33149384	-28	N	GGAACAGTGATGAGGAACTGAGGCCGAGTGGAGGCAGATGAGACTGA	HLADP, HLASB, HLA-DP1A	HLA class II histocompatibility antigen, DP alpha chain; MHC class II HLA-DPA1 antigen; MHC class II antigen; go_component: membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DP alpha 1 precursor
HLA-DPB1_E2_R	3440	0.2400443	1161.579	398.4901	0.5044711	18	84.84441	0.3827249	3839.701	2442.706	0.0004362776	25	519.722	0.3306712	4541.815	2293.215	5.463614E-05	35	291.1931	0.1362325	912.5661	159.7009	0.6627552	31	50.81609	0.3473467	3744.184	2045.901	0.001002494	22	328.5272	0.3065908	4349.868	1967.509	7.496822E-05	28	295.7086	0.3093435	4239.093	1943.47	0.002130254	23	283.4797	0.3378456	4407.479	2299.814	0.005360565	35	263.7464	0.2989997	3477.031	1525.721	0.007461053	25	350.8381	0.346278	5254.557	2836.321	7.523031E-07	34	225.0814	HLA-DPB1	HLA-DPB1_E2_R	24797075	NM_002121.4	HLA-DPB1	3115	6	36.1	33151740	2	N	TTCAAACAGGAGCTCCCTTTAGCGAGTCCTTCTTTTCCTGACTGCAGCTCTTT	DPB1, HLA-DP1B, MHC DPB1	HLA-DP histocompatibility type, beta-1 subunit; MHC class II antigen beta chain; MHC class II HLA-DP-beta-1; HLA DP14-beta chain; MHC HLA DPB1; lymphocyte antigen; light chain; MHC class II antigen DPbeta1; MHC class II anitgen; beta1 domain MHC class II HLA DPB; MHC class II HLA-DRB1; major histocompatibility complex class II HLA DPB1 protein; MHC class II antigen DP beta 1 chain; go_component: membrane; go_component: integral to membrane; go_function: MHC class I receptor activity; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: pathogenesis; go_process: antigen presentation, exogenous antigen; go_process: antigen presentation, endogenous antigen; go_process: detection of pest, pathogen or parasite; go_process: antigen processing, endogenous antigen via MHC class I; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DP beta 1 precursor
HLA-DPB1_P540_F	1030	0.7085106	947.4561	2546.006	0.0432181	47	91.81369	0.955	637.283	15646.78	7.763714E-27	22	1215.578	0.958509	679.8945	18016.84	3.678E-38	25	964.6099	0.8595612	406.0727	3097.438	0.1200835	20	160.4389	0.9558103	571.7264	14529.26	8.532012E-25	39	1056.522	0.9385527	881.3806	14989.71	8.09664E-32	30	952.6657	0.9568096	675.3585	17176.76	1.041371E-27	28	1279.585	0.9610394	706.0834	19883.6	9.061444E-26	24	1089.896	0.9360503	661.3866	11144.64	5.322479E-15	24	594.5229	0.962216	585.5551	17458.48	1.377841E-35	30	982.36	HLA-DPB1	HLA-DPB1_P540_F	24797075	NM_002121.4	HLA-DPB1	3115	6	36.1	33151198	-540	N	GTGGAAGAACCTGGTAACTCCTGCACATCGCAGGACTCACAGACCTCTGGGAGA	DPB1, HLA-DP1B, MHC DPB1	HLA-DP histocompatibility type, beta-1 subunit; MHC class II antigen beta chain; MHC class II HLA-DP-beta-1; HLA DP14-beta chain; MHC HLA DPB1; lymphocyte antigen; light chain; MHC class II antigen DPbeta1; MHC class II anitgen; beta1 domain MHC class II HLA DPB; MHC class II HLA-DRB1; major histocompatibility complex class II HLA DPB1 protein; MHC class II antigen DP beta 1 chain; go_component: membrane; go_component: integral to membrane; go_function: MHC class I receptor activity; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: pathogenesis; go_process: antigen presentation, exogenous antigen; go_process: antigen presentation, endogenous antigen; go_process: detection of pest, pathogen or parasite; go_process: antigen processing, endogenous antigen via MHC class I; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DP beta 1 precursor
HLA-DQA2_E93_F	3450	0.2154461	3240.956	917.4591	0.01049875	17	190.2598	0.8827665	1210.699	9869.542	3.794024E-12	28	686.9022	0.9178262	927.4438	11475.86	1.233586E-16	33	570.8119	0.1895524	1230	311.0685	0.5447962	21	67.2785	0.8632001	1332.365	9038.15	2.128456E-11	29	653.252	0.8766233	1465.262	11121.6	1.510858E-19	22	940.9967	0.8756432	1402.22	10577.7	4.342916E-12	34	488.1323	0.8118675	2895.559	12927.04	5.604092E-15	31	413.5847	0.7505723	1976.781	6249.404	3.820995E-07	22	429.8844	0.9246868	807.8475	11146.45	4.42146E-15	29	414.4358	HLA-DQA2	HLA-DQA2_E93_F	56710315	NM_020056.2	HLA-DQA2	3118	6	36.1	32817234	93	N	AGCTCTGCTGCTGGGGGCCCTCGCCCTGACTGCCGTGATGAGCCC	HLA-DXA, DQ alpha	go_component: membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DQ alpha 2
HLA-DQA2_P282_R	1039	0.2156836	734.0162	229.3508	0.7067147	34	30.96569	0.8851531	394.641	3812.319	0.03539656	39	180.9311	0.8976051	526.9215	5495.665	0.0006030208	26	230.9945	0.2894511	305.4034	165.1462	0.7923605	25	19.44596	0.5617862	1039.37	1460.662	0.2839556	30	113.5519	0.8730254	518.5999	4253.242	0.005956218	22	270.8885	0.9038193	453.0409	5196.98	0.006323046	31	415.3381	0.870752	610.3967	4785.988	0.03533953	31	269.8483	0.8144409	586.0913	3011.336	0.09014944	29	202.9094	0.6614048	1071.552	2288.485	0.1142043	30	137.4148	HLA-DQA2	HLA-DQA2_P282_R	56710315	NM_020056.2	HLA-DQA2	3118	6	36.1	32816859	-282	N	TATTATTGATGACCTTACCTATCCAAGCGGCTGCTCAGAAATTCCCGCCCC	HLA-DXA, DQ alpha	go_component: membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DQ alpha 2
HLA-DRA_P132_R	1044	0.07600281	1744.266	151.6989	0.3864412	36	69.16814	0.3240402	4806.208	2351.927	3.581729E-05	21	437.0356	0.2709414	4892.859	1855.506	7.186684E-05	31	276.9577	0.7660643	340.2694	1441.741	0.4818541	27	85.16948	0.2836747	3910.74	1588.309	0.002073695	35	208.2494	0.246664	4233.254	1418.833	0.0005940243	31	232.9176	0.3310948	4689.833	2370.872	0.0002706725	34	298.5068	0.3022403	4506.987	1995.554	0.007436948	38	280.8268	0.2953704	4182.117	1795.001	0.000703899	38	189.0293	0.2819527	5161.599	2066.051	1.642918E-05	34	265.533	HLA-DRA	HLA-DRA_P132_R	52426773	NM_019111.3	HLA-DRA	3122	6	36.1	32515493	-132	N	AAGAACTTTACTTCTTTATCCAATGAACGGAGTATCTTGTGTCCTGGACCCTTTGCAAG	HLA-DRA1	HLA class II histocompatibility antigen, DR alpha chain; MHC cell surface glycoprotein; histocompatibility antigen HLA-DR alpha; go_component: membrane; go_component: lysosome; go_component: plasma membrane; go_component: integral to plasma membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: immune response; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DR alpha precursor
HLA-DRA_P77_R	1046	0.1248387	3942.388	576.6326	0.004270563	31	188.5764	0.1086187	8998.828	1108.732	4.30953E-10	35	561.9662	0.106704	10111.92	1219.811	8.919805E-14	26	408.2106	0.2962002	1211.713	552.0455	0.4866262	21	84.37802	0.139782	7246.089	1193.711	1.548776E-07	18	807.0549	0.1428522	8569.103	1444.792	3.863345E-12	29	386.7257	0.1260727	8961.896	1307.269	7.756761E-09	34	467.9786	0.1206649	9349.549	1296.695	8.451105E-07	31	464.2212	0.1355513	6929.374	1102.253	8.222967E-07	25	646.406	0.142235	9398.641	1575.069	1.21207E-12	27	387.5082	HLA-DRA	HLA-DRA_P77_R	52426773	NM_019111.3	HLA-DRA	3122	6	36.1	32515548	-77	N	CCTTCCCCTAGCAACAGATGCGTCATCTCAAAATATTTTTCTGATTGGCCAA	HLA-DRA1	HLA class II histocompatibility antigen, DR alpha chain; MHC cell surface glycoprotein; histocompatibility antigen HLA-DR alpha; go_component: membrane; go_component: lysosome; go_component: plasma membrane; go_component: integral to plasma membrane; go_component: integral to plasma membrane; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: immune response; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DR alpha precursor
HLA-DRB1_P556_R	1047	0.1353668	4218.014	676.0275	0.00151528	37	179.7563	0.7167999	3529.808	9187.307	4.276489E-16	36	615.8713	0.7255377	4139.138	11206.11	5.152064E-26	30	885.7073	0.6375323	785.812	1558.025	0.3394437	28	120.4904	0.9251376	1369.589	18160.95	3.678E-38	24	1598.156	0.931812	1698.193	24572.93	3.678E-38	22	1295.138	0.9330089	1597.086	23635.91	3.678E-38	24	1547.252	0.9743205	721.103	31153.99	3.678E-38	23	989.5823	0.9428677	647.1416	12330.26	2.732471E-18	28	1083.794	0.974786	608.0572	27373.9	3.678E-38	29	1323.736	HLA-DRB1	HLA-DRB1_P556_R	4504410	NM_002124.1	HLA-DRB1	3123	6	36.1	32666115	-556	N	TCTGTGGATGCCTCAAGGAGCAGCAGCTCCGGGTATCTGATGATATGACAGAATG	DRB1, HLA DRB1, HLA-DR1B	HLA class II histocompatibility antigen, DR-1 beta chain; MHC class II antigen; human leucocyte antigen DRB1; lymphocyte antigen DRB1; MHC class II HLA-DR-beta-1; MHC class II HLA-DR4/Dw14; class II HLA histocompatibility antigen; MHC class II HLA-DR beta 1 chain; HLA class II antigen beta chain; MHC class II HLA-DR-beta cell surface glycoprotein; class II HLADR-beta 1 chain; MHC HLA-DR-beta cell surface glycoprotein; HLA class II beta chain; go_component: membrane; go_component: membrane; go_component: integral to membrane; go_function: MHC class I receptor activity; go_function: MHC class II receptor activity; go_function: MHC class II receptor activity; go_process: immune response; go_process: immune response; go_process: antigen presentation, exogenous antigen; go_process: antigen presentation, endogenous antigen; go_process: antigen processing, endogenous antigen via MHC class I; go_process: antigen processing, exogenous antigen via MHC class II	major histocompatibility complex, class II, DR beta 1 precursor
HLA-F_E402_F	3465	0.1713125	2318.367	499.9427	0.133096	29	105.4604	0.02479012	8350.416	214.8121	2.830881E-07	25	598.2811	0.03055278	10174.55	323.8095	9.314597E-12	28	462.4185	0.06388796	2779.178	196.4987	0.2037269	35	140.7569	0.03476602	8250.188	300.759	9.832882E-08	31	334.8387	0.02693386	9034.958	252.8499	2.132387E-10	23	484.6802	0.03696875	8743.358	339.4779	6.371242E-07	32	511.7464	0.02557728	9928.051	263.2228	2.96156E-06	36	409.9366	0.03208638	6887.31	231.6296	2.230849E-05	28	363.6289	0.02851699	10578.78	313.4659	1.885132E-12	26	471.2234	HLA-F	HLA-F_E402_F	9665231	NM_018950.1	HLA-F	3134	6	36.1	29799622	402	Y	GAGTGGACCACAGGGTACGCCAAGGCCAACGCACAGACTGACCGAGTGGCCCTGA	HLAF, HLA-5.4, HLA-CDA12	HLA class I molecule; MHC class Ib antigen; corresponding to 1136-1371 nucleotides in HLA-F; go_component: integral to membrane; go_component: MHC class I protein complex; go_function: MHC class I receptor activity; go_function: MHC class I receptor activity; go_process: antigen presentation; go_process: antigen presentation, endogenous antigen; go_process: antigen processing, endogenous antigen via MHC class I	major histocompatibility complex, class I, F precursor
HLF_E192_F	678	0.1428245	8319.335	1402.849	1.756088E-13	27	516.3961	0.0792896	14352.69	1244.635	1.53643E-24	22	1294.529	0.06940664	18947.2	1420.601	3.678E-38	25	1114.67	0.2117826	6301.214	1719.914	1.756486E-05	31	366.8429	0.07694544	14746.42	1237.591	6.412857E-28	30	1370.571	0.08914837	16071.89	1582.802	3.678E-38	24	1014.557	0.08556487	19368.04	1821.65	3.678E-38	21	1062.231	0.09367484	19872.46	2064.289	2.175476E-29	36	821.9283	0.100849	10824.36	1225.28	1.178392E-15	32	986.8329	0.0848743	19040.88	1775.241	3.678E-38	34	961.7717	HLF	HLF_E192_F	31542934	NM_002126.3	HLF	3131	17	36.1	50697562	192	Y	TGAACATTTTGCAAAACGAGGGGTTCGAGGCAGGTGAGAGCATCCTGCACGT	.	go_component: nucleus; go_function: double-stranded DNA binding; go_process: transcription; go_process: development; go_process: rhythmic process; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	hepatic leukemia factor
HOXA11_E35_F	3468	0.05778025	8143.633	505.5287	1.344657E-10	28	301.9539	0.1279106	11129.59	1647.059	2.991572E-16	30	950.5282	0.1440505	14561.93	2467.504	2.137539E-32	20	1299.003	0.04390146	6774.184	315.6439	0.0002104261	33	317.942	0.1252312	11407.43	1647.394	2.601107E-18	30	747.7656	0.1201708	13569.88	1867.09	5.152311E-30	27	821.7836	0.1098593	13846.42	1721.237	8.286416E-21	20	1218.934	0.1341287	16218.22	2527.791	3.187371E-21	29	687.7766	0.1008538	10279.05	1164.179	4.707078E-14	20	580.2892	0.09531715	13657.69	1449.506	1.533028E-24	38	760.132	HOXA11	HOXA11_E35_F	24497552	NM_005523.4	HOXA11	3207	7	36.1	27191320	35	Y	ACCTTGGGCTCTCCGCAGTAGCCGAGCTTAACATGATTCTCCACTGCAGCTGCC	HOX1, HOX1I	homeobox protein HOXA11; homeo box 1I; go_component: nucleus; go_function: transcription factor activity; go_process: morphogenesis; go_process: regulation of transcription, DNA-dependent	homeobox protein A11
HOXA11_P698_F	1066	0.2028142	4037.371	1052.6	0.0008461963	30	196.1282	0.1918096	8944.521	2146.556	3.589095E-12	26	217.2458	0.1455569	9585.891	1650.02	1.554433E-13	25	452.0773	0.4516704	2429.246	2083.392	0.0331478	27	191.4929	0.134621	8654.905	1361.94	1.272589E-10	29	522.0729	0.2026408	8547.713	2197.729	4.754928E-14	24	504.7827	0.1455112	8989.508	1547.855	2.620024E-09	42	401.6774	0.2169556	9015.122	2525.497	5.954604E-08	28	384.9083	0.1486711	7827.243	1384.368	5.598758E-09	34	443.2788	0.1193581	8502.367	1165.925	9.117601E-10	27	478.5761	HOXA11	HOXA11_P698_F	24497552	NM_005523.4	HOXA11	3207	7	36.1	27192053	-698	Y	TCATTCATGGTCACTTCCGAAGCGCTTTAGTGCCTTCCGTCCCTAAACC	HOX1, HOX1I	homeobox protein HOXA11; homeo box 1I; go_component: nucleus; go_function: transcription factor activity; go_process: morphogenesis; go_process: regulation of transcription, DNA-dependent	homeobox protein A11
HOXA11_P92_R	1063	0.1456	4740.26	824.8385	0.000182936	31	207.6546	0.1090914	9512.54	1177.052	2.694866E-11	27	674.4728	0.105585	12068.61	1436.495	6.943501E-20	36	551.5311	0.07461482	3472.445	288.0501	0.08961726	26	156.5313	0.1236351	10745.32	1530.028	4.05914E-16	36	696.6387	0.1307427	11398.21	1729.414	2.378796E-21	30	694.3484	0.1131711	9929.283	1279.869	1.496035E-10	32	728.7205	0.1293362	12638.98	1892.363	1.354772E-12	24	631.5391	0.1748392	6807.274	1463.547	3.194884E-07	28	429.662	0.1449337	12068.89	2062.627	2.387047E-21	34	439.1055	HOXA11	HOXA11_P92_R	24497552	NM_005523.4	HOXA11	3207	7	36.1	27191447	-92	Y	CAGGGAGGTGCTGGTCATGTGACCCGATGTTGAAATTGACAAGCTGCTAGCT	HOX1, HOX1I	homeobox protein HOXA11; homeo box 1I; go_component: nucleus; go_function: transcription factor activity; go_process: morphogenesis; go_process: regulation of transcription, DNA-dependent	homeobox protein A11
HOXA5_E187_F	3470	0.4338793	2446.5	1951.657	0.005834215	31	154.1897	0.9383454	992.8257	16632.13	1.234236E-31	35	1106.093	0.9707582	509.5576	20235.87	3.678E-38	32	972.4084	0.8406109	379.3809	2528.233	0.2165955	20	137.0036	0.9404918	821.9144	14570.31	8.364184E-26	47	687.5028	0.911792	1364.447	15137.76	1.538984E-34	32	977.4165	0.9313844	1084.503	16078.38	1.623467E-25	16	1299.608	0.9415445	1107.442	19448.31	1.109481E-25	26	1313.253	0.8816998	1226.337	9885.283	3.222719E-13	27	751.4946	0.8221779	2442.848	11757.11	1.451126E-21	25	433.5317	HOXA5	HOXA5_E187_F	24497516	NM_019102.2	HOXA5	3202	7	36.1	27149625	187	Y	CATTGTAGCCGTAGCCGTACCTGCCGGAGTGCATGCTCGCCGAGTCCCTGAATT	HOX1, HOX1C, HOX1.3, MGC9376	homeobox protein HOXA5; homeo box 1C; homeo box A5; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox A5
HOXA5_P1324_F	1072	0.4262649	346.2179	331.5241	0.7877841	26	26.55774	0.6537042	2765.556	5409.323	1.201254E-06	32	493.2944	0.861503	1040.614	7095.042	5.303852E-07	27	427.7857	0.2269629	753.2556	250.5149	0.6790051	26	49.63273	0.6555819	2434.879	4825.009	1.252026E-05	27	268.5508	0.5673176	3363.207	4540.833	1.685522E-07	37	306.6671	0.6327306	2458.097	4407.082	0.000441214	17	493.6802	0.7025361	2621.855	6428.349	5.190641E-05	23	405.8151	0.4916591	2776.689	2782.287	0.002069123	20	343.0834	0.380258	4536.782	2845.012	9.765668E-06	25	265.5135	HOXA5	HOXA5_P1324_F	24497516	NM_019102.2	HOXA5	3202	7	36.1	27151136	-1324	Y	CCGGGCTGTAATGTTCCACCCGCGCCCAGGTTAACTCGCCTCGGCTGAGGC	HOX1, HOX1C, HOX1.3, MGC9376	homeobox protein HOXA5; homeo box 1C; homeo box A5; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox A5
HOXA5_P479_F	1071	0.4505782	2646.335	2252.257	0.001495399	38	173.2478	0.8835303	1438.253	11669.06	3.972566E-17	26	680.4466	0.8841421	1242.135	10242.18	3.641821E-14	32	488.1026	0.5947179	1464.106	2295.197	0.08974385	31	156.5763	0.8597021	1004.342	6767.066	2.053365E-06	24	407.3911	0.8449937	1896.444	10883.31	3.515096E-20	20	853.6524	0.8887624	1242.299	10724.65	4.619831E-12	22	789.6915	0.8936542	1535.305	13741.94	6.068492E-14	34	564.9606	0.8345032	1245.624	6785.192	8.248879E-07	32	242.0053	0.8520972	1526.673	9371.586	1.824913E-12	38	385.5486	HOXA5	HOXA5_P479_F	24497516	NM_019102.2	HOXA5	3202	7	36.1	27150291	-479	Y	TACAACAACTTTATTTCCCCCGTTTTGCAGCCCCTCTTATTTTTGTGTCGA	HOX1, HOX1C, HOX1.3, MGC9376	homeobox protein HOXA5; homeo box 1C; homeo box A5; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox A5
HOXA9_E252_R	631	0.05616571	6273.082	379.2495	2.895916E-06	35	207.2238	0.1753878	6494.023	1402.491	3.208675E-06	30	389.8894	0.1424075	8618.669	1447.778	8.814235E-11	32	574.3408	0.06131072	4851.311	323.3961	0.01158418	47	167.2084	0.1430168	7582.872	1282.148	2.622276E-08	34	328.3195	0.13988	7314.003	1205.728	1.012698E-08	37	562.1269	0.1695415	7572.394	1566.351	5.250766E-07	39	405.4597	0.1703329	9538.978	1978.908	6.389665E-08	36	366.2501	0.1635511	5241.163	1044.359	0.0002982437	31	511.6359	0.1545184	6054.589	1124.799	1.928282E-05	33	318.5482	HOXA9	HOXA9_E252_R	24497558	NM_002142.3	HOXA9	3205	7	36.1	27171422	252	Y	TGGGTTCCACGAGGCGCCAAACACCGTCGCCTTGGACTGGAAGCTGCACG	HOX1, ABD-B, HOX1G, HOX1.7, MGC1934	isoform b is encoded by transcript variant 2; homeobox protein HOXA9; homeodomain protein HOXA9; go_component: nucleus; go_component: nucleus; go_function: transcription factor activity; go_function: transcriptional activator activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox protein A9 isoform b
HOXA9_P1141_R	4107	0.03105219	7652.015	248.4314	8.134213E-09	23	274.1352	0.1928019	12097.63	2913.444	1.14975E-22	26	747.3387	0.1638152	15113.85	2980.514	8.185435E-37	29	1048.086	0.02696532	8777.021	246.0053	8.159703E-07	28	454.251	0.1581537	13077.19	2475.536	2.277273E-26	27	971.1042	0.2566462	10974.26	3823.437	1.850113E-27	45	1012.369	0.1806426	12574.75	2794.385	2.940176E-20	30	910.7285	0.1752756	14529.65	3109.186	1.017329E-18	27	687.8645	0.1835005	10199	2314.602	6.048378E-17	28	760.5762	0.1708907	14372.79	2983.039	8.347591E-33	33	512.5652	HOXA9	HOXA9_P1141_R	24497558	NM_002142.3	HOXA9	3205	7	36.1	27172815	-1141	Y	CTACAAGTGGCATGAATGGAAGGCAAGTTCGGTTTGGGAAAAGGCAGCCTC	HOX1, ABD-B, HOX1G, HOX1.7, MGC1934	isoform b is encoded by transcript variant 2; homeobox protein HOXA9; homeodomain protein HOXA9; go_component: nucleus; go_component: nucleus; go_function: transcription factor activity; go_function: transcriptional activator activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox protein A9 isoform b
HOXA9_P303_F	3908	0.02833305	6042.84	179.1205	1.663993E-05	36	181.4191	0.06581304	13583.32	963.9836	3.068198E-21	27	831.74	0.07330736	16160.9	1286.342	4.288138E-34	30	798.9963	0.02712223	5343.76	151.7631	0.006549674	32	250.8512	0.06327714	13604.45	925.7578	7.01084E-23	25	1061.433	0.09876245	13833.31	1526.886	1.05979E-29	32	897.0327	0.06801043	14354.11	1054.765	2.285123E-20	19	1332.822	0.0814804	15506.14	1384.396	4.017227E-17	35	832.6126	0.1166937	8469.583	1132.129	8.981918E-10	37	501.7265	0.1007192	15630.7	1761.834	5.972401E-33	30	743.762	HOXA9	HOXA9_P303_F	24497558	NM_002142.3	HOXA9	3205	7	36.1	27171977	-303	Y	CCCCATACACACACTTCTTAAGCGGACTATTTTATATCACAATTAATCACGCCA	HOX1, ABD-B, HOX1G, HOX1.7, MGC1934	isoform b is encoded by transcript variant 2; homeobox protein HOXA9; homeodomain protein HOXA9; go_component: nucleus; go_component: nucleus; go_function: transcription factor activity; go_function: transcriptional activator activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox protein A9 isoform b
HOXB13_E21_F	3478	0.05807869	3988.926	252.1224	0.00861447	25	205.6178	0.07400778	11466.39	924.4172	2.932293E-15	29	660.8329	0.06482156	13255.8	925.7526	4.903782E-22	30	860.1401	0.09683143	2447.997	273.1784	0.2541572	30	115.1928	0.0706327	12567.63	962.7504	1.004873E-19	28	630.2475	0.09545176	10805.09	1150.751	1.495566E-17	20	757.0724	0.07739986	10690.26	905.2292	2.625783E-11	30	702.6607	0.0633527	13019.41	887.367	1.594072E-11	29	682.7733	0.08822478	9109.611	891.1362	1.258931E-10	27	408.7706	0.08342388	15420.22	1412.602	9.050092E-31	28	868.8631	HOXB13	HOXB13_E21_F	70167332	NM_006361.4	HOXB13	10481	17	36.1	44161066	21	Y	GCGTTTTAAATCGCTCCCAGCTCGCAAGTCGCCTGCATTCGCTCAGCACG	.	homeobox protein HOX-B13; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: response to wounding; go_process: epidermis development; go_process: regulation of transcription, DNA-dependent	homeo box B13
HOXB13_P17_R	1078	0.1488556	5807.083	1033.083	1.29146E-06	31	236.9032	0.05275816	10521.94	591.6062	3.198079E-12	25	610.0807	0.07692782	12208.36	1025.765	4.676919E-19	27	547.6396	0.06442507	4863.966	341.826	0.0109807	28	151.7559	0.05611519	10750.65	645.0853	7.953948E-14	28	510.9686	0.08847383	10469.81	1025.919	3.601754E-16	27	578.4993	0.07821218	10611.25	908.8321	3.707549E-11	23	734.0348	0.08378831	12409.59	1144.012	6.084939E-11	24	742.687	0.09183258	7813.589	800.2108	7.768288E-08	25	423.276	0.05872222	13269.19	834.0457	2.929902E-21	26	621.0449	HOXB13	HOXB13_P17_R	70167332	NM_006361.4	HOXB13	10481	17	36.1	44161104	-17	Y	CTGCATTCGCTCAGCACGGCCGTCTTGACGCAAGAGACGCAGGGGCCCGG	.	homeobox protein HOX-B13; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: response to wounding; go_process: epidermis development; go_process: regulation of transcription, DNA-dependent	homeo box B13
HOXB2_P488_R	5880	0.2853778	3949.033	1616.944	0.0001823899	26	196.9608	0.8760886	1801.351	13443.08	2.109228E-23	32	1100.445	0.9038415	1954.244	19308.86	3.678E-38	29	795.1107	0.1921228	3597.665	879.3488	0.03491167	27	178.5132	0.9007116	1525.694	14747.76	5.498013E-29	21	699.0105	0.9073686	1617.067	16819.49	3.678E-38	23	1176.324	0.8861175	1970.382	16109.6	1.868737E-28	36	968.0439	0.8697055	2663.194	18444.1	3.945612E-27	29	919.174	0.8767666	1529.733	11595.04	9.94137E-19	43	877.3	0.8910502	1892.323	16294.29	3.531136E-36	43	736.6707	HOXB2	HOXB2_P488_R	24497527	NM_002145.2	HOXB2	3212	17	36.1	43977879	-488	N	AGGAAAAGATGAGTGAGGATCTCCGCGTTGGAGGAAGAGGGAGTC	K8, HOX2, HOX2H, Hox-2.8	homeo box 2H; homeobox protein Hox-B2; K8 home protein; go_component: nucleus; go_component: nucleus; go_function: transcription factor activity; go_function: transcription factor activity; go_process: circulation; go_process: development; go_process: development; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	homeo box B2
HOXB2_P99_F	5879	0.07065327	2081.135	165.82	0.2736223	30	83.91801	0.7979577	2241.117	9246.145	4.516711E-13	24	509.1483	0.779179	2597.752	9519.165	7.662383E-16	30	402.8987	0.1341287	4489.476	710.9373	0.01108313	27	302.3221	0.7597034	2263.775	7473.132	4.981335E-10	31	391.2662	0.7906781	2012.561	7979.845	4.3723E-12	19	370.8852	0.7230074	2345.201	6382.478	2.106287E-06	32	718.8672	0.734595	3069.443	8772.469	2.303283E-08	24	648.781	0.8050029	1598.384	7011.408	7.900874E-08	34	469.8965	0.7411761	2575.17	7660.701	5.767301E-11	19	388.7711	HOXB2	HOXB2_P99_F	24497527	NM_002145.2	HOXB2	3212	17	36.1	43977490	-99	Y	TCTATTAAACCCAGGACTCCAGCGAAATTACAGGGAATTCGTGGTCACGGGACC	K8, HOX2, HOX2H, Hox-2.8	homeo box 2H; homeobox protein Hox-B2; K8 home protein; go_component: nucleus; go_component: nucleus; go_function: transcription factor activity; go_function: transcription factor activity; go_process: circulation; go_process: development; go_process: development; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	homeo box B2
HOXC6_P456_R	1079	0.4029935	5636.443	3872.235	7.071764E-13	32	281.2589	0.2822058	9377.341	3726.083	4.069469E-17	37	563.1945	0.2694156	9894.555	3685.664	4.060458E-20	34	468.8509	0.2144903	6369.128	1766.452	1.263185E-05	23	524.9087	0.2955152	9179.35	3892.474	2.320695E-18	22	509.809	0.3466167	9245.011	4957.484	3.453993E-25	24	692.457	0.3369749	9297.585	4776.214	7.289104E-17	23	473.1734	0.2827953	10902.52	4338.317	7.09056E-14	28	596.4016	0.244491	8718.92	2853.899	2.180367E-14	24	559.4282	0.2417542	11737.49	3774.19	6.199295E-26	27	607.7692	HOXC6	HOXC6_P456_R	24497537	NM_014620.2	HOXC4	3221	12	36.1	52696647	-293	Y	GTCCGCCCTCAGCTCTTTCTGCGCTCGCCTGCAGCAGCCTGGCCCGTG	HOX3, cp19, HOX3E	homeo box 3E; homeo box C4; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox C4
HOXC6_P585_R	1080	0.3193269	5430.275	2594.44	4.243036E-09	36	346.1227	0.2670394	10265.62	3776.503	9.638519E-20	33	826.2948	0.3013858	11797.08	5132.464	5.358452E-32	27	1354.638	0.1659921	7633.472	1539.188	4.978724E-07	29	439.2258	0.3094097	10655.57	4818.891	4.302652E-26	24	831.675	0.2928122	12304.27	5136.009	3.678E-38	28	1077.418	0.2730198	11491.11	4353.081	1.377094E-21	27	888.549	0.321988	12194.24	5838.539	1.367516E-19	25	1071.124	0.2740849	7645.701	2924.557	6.472265E-12	24	891.5306	0.2890797	13307.6	5451.898	3.678E-38	31	701.6506	HOXC6	HOXC6_P585_R	24497537	NM_014620.2	HOXC4	3221	12	36.1	52696518	-422	Y	ACAAATCTTTGCAAAGCTTTGAATTCCGCCTGATCCAACCTTAATGCCCCC	HOX3, cp19, HOX3E	homeo box 3E; homeo box C4; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	homeobox C4
HPN_P374_R	4928	0.2794896	636.184	285.5695	0.7193649	28	27.91287	0.3291301	4679.824	2344.991	5.374311E-05	27	274.7068	0.244967	5854.184	1931.808	2.030572E-06	44	242.0547	0.2444452	341.7289	142.9129	0.7897046	28	17.22445	0.2613104	4722.76	1706.044	0.0001728759	29	253.9469	0.3751394	4101.32	2522.292	2.626517E-05	26	246.5117	0.1668194	5844.274	1190.162	0.0002893204	31	229.5966	0.2367039	7027	2210.137	3.337263E-05	26	330.9558	0.3018426	4243.015	1877.667	0.0004751479	27	485.0651	0.2726925	4968.241	1900.258	5.245498E-05	30	257.9436	HPN	HPN_P374_R	33695154	NM_182983.1	HPN	3249	19	36.1	40222876	-374	N	CTCCTTGCTGATTTGCACACATTGGCCGCTTCAGACACGCACTTCTGGGGCCA	TMPRSS1	go_component: membrane; go_component: integral to plasma membrane; go_function: scavenger receptor activity; go_function: serine-type endopeptidase activity; go_process: proteolysis	hepsin (transmembrane protease, serine 1)
HPN_P823_F	4931	0.172056	2556.05	551.957	0.08527274	30	116.7899	0.7313324	3409.546	9553.233	9.670153E-17	37	684.5087	0.6847237	4371.534	9711.373	1.027102E-21	21	709.9443	0.6858512	441.8224	1182.909	0.5229875	33	62.01247	0.7520229	2653.621	8350.715	7.215818E-13	36	437.3914	0.8266435	1959.566	9820.954	5.111936E-17	33	533.485	0.6297704	4455.775	7749.494	1.465504E-12	30	591.5142	0.6370634	4790.014	8583.455	1.186857E-10	31	541.8687	0.7206665	2708.089	7244.731	1.602002E-10	35	456.1718	0.696974	3860.999	9110.484	7.315661E-18	30	586.3666	HPN	HPN_P823_F	33695154	NM_182983.1	HPN	3249	19	36.1	40222427	-823	N	CCTCTGAAAGCAAAGAGAACTGCACGGGCGTCCAGGTGGCCGAATAGCCCTG	TMPRSS1	go_component: membrane; go_component: integral to plasma membrane; go_function: scavenger receptor activity; go_function: serine-type endopeptidase activity; go_process: proteolysis	hepsin (transmembrane protease, serine 1)
HPSE_P29_F	2252	0.02799585	6557.546	191.7519	1.915169E-06	27	279.3445	0.04290684	12580.47	568.4702	3.068401E-17	16	801.2746	0.03046996	14705.28	465.2936	2.146067E-25	36	753.5667	0.02571202	7645.422	204.4061	2.848209E-05	32	234.309	0.03037959	13243.66	418.076	3.997326E-20	23	789.311	0.03227194	13302.76	446.9572	1.571672E-23	28	892.485	0.03817706	13037.92	521.4754	1.309623E-15	30	601.3842	0.03426312	14331.09	511.9968	3.779627E-13	23	1008.271	0.05691462	10234.53	623.6827	1.341177E-12	29	555.2836	0.0296912	15727.83	484.3275	1.918012E-28	29	747.7251	HPSE	HPSE_P29_F	19923365	NM_006665.2	HPSE	10855	4	36.1	84475358	-29	Y	CGGACCAGGCTTCCTGACGCACGTGTTCTGCGCGCTCTCGTGGGAACCCA	HPA, HPR1, HSE1, HPSE1	heparanase-1; go_component: lysosome; go_component: membrane; go_function: hydrolase activity; go_function: calcium ion binding; go_function: magnesium ion binding; go_function: beta-glucuronidase activity; go_process: inflammatory response; go_process: proteoglycan metabolism	heparanase
HPSE_P93_F	1984	0.04014215	7058.045	299.3561	1.214861E-07	32	275.6758	0.03992157	10803.82	453.3979	1.520121E-12	22	570.7143	0.03657867	13378.97	511.7622	4.264562E-21	25	874.5243	0.3337313	356.2207	228.5191	0.7702729	33	18.06867	0.04331685	10584.61	483.7794	5.060288E-13	33	811.7546	0.06379729	11284.7	775.8071	7.109985E-18	34	979.0112	0.04051259	11932.29	508.0411	4.603167E-13	27	944.2328	0.04582129	15064.41	728.2208	6.403609E-15	21	690.4039	0.06154849	8430.693	559.4868	1.519978E-08	17	382.2483	0.05106578	14445.08	782.7265	5.948217E-25	24	1023.906	HPSE	HPSE_P93_F	19923365	NM_006665.2	HPSE	10855	4	36.1	84475422	-93	Y	CAGATCCCATTCTGATGGCGCCGGGTATCCCTCTGACCCTCGAGTAAAAC	HPA, HPR1, HSE1, HPSE1	heparanase-1; go_component: lysosome; go_component: membrane; go_function: hydrolase activity; go_function: calcium ion binding; go_function: magnesium ion binding; go_function: beta-glucuronidase activity; go_process: inflammatory response; go_process: proteoglycan metabolism	heparanase
HRASLS_E72_R	3481	0.04602805	5561.11	273.142	7.125665E-05	23	388.9389	0.03819655	8539.016	343.0852	8.261938E-08	24	383.0912	0.03537466	10806.11	399.948	1.846042E-13	33	466.7193	0.05554499	3988.951	240.4781	0.04940267	40	135.1535	0.03101017	11632.01	375.4544	2.123356E-15	25	493.6463	0.0491227	11750.75	612.2142	7.954878E-19	30	532.0308	0.04549095	11033.31	530.6027	3.034795E-11	33	503.2865	0.0397456	11717.47	489.1331	7.023377E-09	28	529.2834	0.05027089	8045.51	431.1567	1.378701E-07	28	623.2277	0.03662289	11394.48	436.964	9.206097E-15	38	426.4136	HRASLS	HRASLS_E72_R	38455407	NM_020386.2	HRASLS	57110	3	36.1	194441684	72	Y	GACTGTGCCCCGCCTCCTGGGCGGAGCGGGCGGCTCCCCATGGTCA	A-C1, HSD28, HRASLS1, H-REV107	H-REV107 protein-related protein	HRAS-like suppressor
HRASLS_P353_R	1086	0.2751529	1360.841	554.5372	0.379827	28	63.78374	0.7355527	2614.719	7550.917	3.294388E-10	35	564.844	0.7389586	2965.667	8678.322	1.405393E-14	32	373.3499	0.1763615	499.6064	128.3907	0.761574	35	31.52525	0.7581165	2442.263	7968.02	1.732969E-11	28	485.6888	0.7629744	2979.597	9913.078	1.47971E-20	28	495.7394	0.7232785	3131.13	8445.341	2.865191E-11	29	446.1705	0.7612105	3286.906	10796.74	8.030453E-12	29	387.9185	0.7066735	2828.865	7056.135	2.247769E-10	23	481.2446	0.7080863	3142.738	7865.811	1.002292E-12	22	437.6818	HRASLS	HRASLS_P353_R	38455407	NM_020386.2	HRASLS	57110	3	36.1	194441259	-353	Y	TTAGGGCCAGTCCTTCCTCCGCCACTTTGCTGACTCAAAGACCCAGA	A-C1, HSD28, HRASLS1, H-REV107	H-REV107 protein-related protein	HRAS-like suppressor
HS3ST2_E145_R	3482	0.1074145	3579.141	442.7511	0.01440153	32	155.8576	0.398684	6269.267	4222.945	7.038341E-11	33	512.2591	0.3457842	9485.23	5066.252	2.910322E-23	37	697.2015	0.05673151	3223.273	199.8734	0.1309607	25	139.6814	0.4013441	7594.633	5158.548	1.914226E-17	22	1004.781	0.5332515	6033.338	7007.226	4.703128E-21	34	707.7944	0.3870099	6861.71	4395.259	1.210659E-10	25	776.4832	0.3273752	10161.56	4994.434	1.017505E-13	32	634.4113	0.3493523	6214.846	3390.631	8.820813E-10	29	449.8674	0.3094159	10452.35	4727.975	8.64358E-25	31	590.7293	HS3ST2	HS3ST2_E145_R	5174462	NM_006043.1	HS3ST2	9956	16	36.1	22733506	145	Y	CGCAGGCTGCTCTTCGCCTTCACGCTCTCGCTCTCCTGCACTTACCTGTGTTAC	30ST2, 3OST2	heparin-glucosamine 3-O-sulfotransferase; go_component: Golgi stack; go_component: integral to membrane; go_function: transferase activity; go_function: sulfotransferase activity; go_function: sulfotransferase activity	heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2
HS3ST2_P171_F	1088	0.04840293	11852.79	607.978	1.279579E-22	28	737.8676	0.09620468	9818.026	1055.726	1.080188E-11	22	534.9319	0.08720335	10911.02	1051.929	2.004671E-15	30	530.4147	0.2087854	6029.666	1617.494	4.968156E-05	27	367.4767	0.1219668	9529.832	1337.671	1.527822E-12	25	546.5124	0.152748	10530.39	1916.515	4.284323E-19	15	622.3408	0.09468973	10129.81	1069.974	1.55917E-10	34	480.6107	0.08450536	11772.53	1095.902	7.315114E-10	30	437.638	0.2060849	7697.821	2024.163	5.017289E-10	33	480.8491	0.07477018	9972.216	813.9614	3.331461E-12	31	486.6225	HS3ST2	HS3ST2_P171_F	5174462	NM_006043.1	HS3ST2	9956	16	36.1	22733190	-171	Y	GCCGCCCGGCTGCCCGGAGCCCCATCGCCTAGGACCGGGAGATGCTG	30ST2, 3OST2	heparin-glucosamine 3-O-sulfotransferase; go_component: Golgi stack; go_component: integral to membrane; go_function: transferase activity; go_function: sulfotransferase activity; go_function: sulfotransferase activity	heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2
HS3ST2_P546_F	1087	0.1181234	2038.18	286.3996	0.2510525	20	135.547	0.1363078	6787.72	1087.019	3.459152E-06	29	501.0859	0.09753229	10796.21	1177.585	1.874164E-15	23	312.7491	0.06051336	3129.965	208.0456	0.1432065	43	196.8351	0.1019056	7942.374	912.5573	2.738386E-08	28	683.1154	0.15609	10049.36	1877.231	1.838576E-17	27	494.877	0.1307861	8529.204	1298.391	4.312701E-08	26	603.6671	0.09592321	11301.9	1209.75	2.51878E-09	24	256.8403	0.1287914	5998.967	901.6151	4.573997E-05	33	519.0459	0.08361257	11166.54	1027.976	1.027894E-15	21	291.4468	HS3ST2	HS3ST2_P546_F	5174462	NM_006043.1	HS3ST2	9956	16	36.1	22732815	-546	Y	GCCCCAAAGCTGGCCTGGGGCTCCGTAGGGAGTGGCCTGCATGG	30ST2, 3OST2	heparin-glucosamine 3-O-sulfotransferase; go_component: Golgi stack; go_component: integral to membrane; go_function: transferase activity; go_function: sulfotransferase activity; go_function: sulfotransferase activity	heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2
HSD17B12_E145_R	3484	0.06581014	3226.117	234.3123	0.0459924	23	189.3595	0.03361715	11047.59	387.7866	5.953171E-13	24	632.0294	0.03985164	13593.67	568.3654	5.678942E-22	25	792.059	0.02835249	6190.014	183.5414	0.001118162	33	229.2241	0.03435268	13343.03	478.2326	1.287573E-20	22	797.9812	0.04098258	13132.01	565.4559	2.419968E-23	36	672.2147	0.03454825	12026.83	433.9531	4.156814E-13	36	845.4686	0.03552032	14086.54	522.4686	9.885432E-13	18	914.5641	0.04298026	8187.322	372.188	9.761895E-08	24	548.5762	0.0404659	17105.06	725.5792	1.03433E-34	23	732.1559	HSD17B12	HSD17B12_E145_R	7705854	NM_016142.1	HSD17B12	51144	11	36.1	43659026	145	Y	CACCGTGGCCTACCTAGCCCTGCGTATTTCGTACTCGCTCTTCACGGCCC	KAR	3-ketoacyl-CoA reductase; go_function: oxidoreductase activity; go_process: metabolism	steroid dehydrogenase homolog
HSD17B12_P97_F	1093	0.08554125	6404.99	608.4965	5.984783E-07	27	395.6698	0.08684691	8245.595	793.7214	4.398403E-08	32	499.8113	0.07527425	10538.51	865.9932	5.828367E-14	28	606.679	0.07869082	4858.724	423.5343	0.009611296	36	226.5881	0.09116724	8487.586	861.4418	3.064609E-09	28	411.5411	0.08442609	10232.18	952.7422	2.850317E-15	28	430.6366	0.08893556	9537.854	940.8204	3.33174E-09	31	424.9582	0.09054425	10340.94	1039.487	9.753392E-08	19	563.4188	0.1143829	6309.206	827.7883	2.099671E-05	15	639.3233	0.0651994	11974.71	842.1732	2.011711E-17	23	617.1896	HSD17B12	HSD17B12_P97_F	7705854	NM_016142.1	HSD17B12	51144	11	36.1	43658784	-97	Y	GCTGACGCACTACGCGCAGAGGGAAAGACGGGTCACCAATAGCGACACGGATATGG	KAR	3-ketoacyl-CoA reductase; go_function: oxidoreductase activity; go_process: metabolism	steroid dehydrogenase homolog
HSPA2_P162_R	1098	0.8097628	1081.158	5027.712	2.573484E-05	31	178.3642	0.9612617	680.713	19372.81	3.678E-38	19	1230.186	0.9701731	601.0378	22802.47	3.678E-38	31	1461.77	0.7247412	756.6092	2255.405	0.1970475	35	142.0743	0.9613706	578.461	16884.86	1.356564E-33	27	1500.504	0.9576384	728.731	18734.53	3.678E-38	24	1035.833	0.9582067	681.0631	17907.67	3.698211E-30	39	1204.988	0.9706326	667.5769	25369.46	3.678E-38	24	1245.848	0.9352438	770.8964	12577.95	2.084355E-19	24	695.2569	0.965816	662.649	21547.43	3.678E-38	32	953.9781	HSPA2	HSPA2_P162_R	13676856	NM_021979.2	HSPA2	3306	14	36.1	64072214	-162	N	GGCTGGCCTGTCGGCCTCTGATGCACTCGAACTTCCAGCCCTTGGAGCAGACA	.	Heat-shock 70kD protein-2; heat shock 70kD protein 2; go_component: cell surface; go_function: ATP binding; go_function: nucleotide binding; go_function: unfolded protein binding; go_process: protein folding; go_process: male meiosis; go_process: spermatid development; go_process: response to unfolded protein	heat shock 70kDa protein 2
HTR1B_E232_R	3489	0.1871591	6381.19	1492.314	9.352108E-09	30	312.9486	0.3141485	7690.104	3568.191	1.511603E-12	26	588.4678	0.2931314	9863.202	4131.642	1.977492E-21	24	974.1132	0.24497	1967.819	670.9052	0.2717968	30	137.2025	0.2973475	8583.245	3674.563	4.529299E-16	30	1086.319	0.5094557	8118.986	8535.846	3.247931E-35	31	999.6996	0.2256189	10299.17	3029.837	4.589757E-15	31	866.4557	0.2532683	12415.69	4244.933	1.199268E-16	33	652.4304	0.2529661	7015.616	2409.542	2.079146E-09	27	723.7209	0.2234787	11321.32	3286.996	7.039157E-23	24	667.8671	HTR1B	HTR1B_E232_R	4504532	NM_000863.1	HTR1B	3351	6	36.1	78229607	232	Y	GGTAGTTAGCCGGGGTGTGCAGTTTCCGGGTCCGGTACACTGTGGCAATC	S12, 5-HT1B, HTR1D2, HTR1DB, 5-HT1DB	go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: serotonin receptor activity; go_function: rhodopsin-like receptor activity; go_process: signal transduction; go_process: synaptic transmission; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	5-hydroxytryptamine (serotonin) receptor 1B
HTR1B_P107_F	1102	0.105567	1269.017	161.5805	0.5504392	26	66.93964	0.2700978	3072.296	1173.897	0.03321051	20	204.9302	0.2377971	3512.184	1126.953	0.01531261	27	118.6791	0.06499933	1854.151	135.8486	0.4278256	27	79.25597	0.266803	3159.768	1186.197	0.02362194	23	225.7012	0.3504428	3751.258	2077.793	0.0003521683	23	236.3449	0.2112239	3131.459	865.3424	0.08665552	35	211.3301	0.2095922	3846.328	1046.447	0.06404681	27	140.6947	0.2524671	2908.475	1016.064	0.05540293	30	235.6456	0.1953951	3808.562	949.1788	0.01160479	23	179.9033	HTR1B	HTR1B_P107_F	4504532	NM_000863.1	HTR1B	3351	6	36.1	78229946	-107	Y	GGTTTGTCCCCAGTTGATAGTTCCGTGAGTTCCTCAATTATTCCTCCGC	S12, 5-HT1B, HTR1D2, HTR1DB, 5-HT1DB	go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: serotonin receptor activity; go_function: rhodopsin-like receptor activity; go_process: signal transduction; go_process: synaptic transmission; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	5-hydroxytryptamine (serotonin) receptor 1B
HTR1B_P222_F	1104	0.1522638	4940.659	905.3641	6.829284E-05	28	200.1632	0.1625521	8088.114	1589.346	2.981531E-09	40	377.9235	0.1006292	10944.58	1235.76	5.134811E-16	30	445.0529	0.04825237	4648.164	240.7257	0.01861695	26	202.7198	0.1024086	8244.943	952.0965	6.100705E-09	28	551.8878	0.3084873	9149.204	4126.117	7.396871E-22	34	533.2556	0.09718729	8898.911	968.7278	3.704866E-08	24	525.9437	0.1217808	10883.12	1523.006	3.603168E-09	23	502.2119	0.1007424	7742.473	878.5802	7.533798E-08	33	480.4779	0.09092254	10888.94	1099.073	3.609903E-15	38	511.8209	HTR1B	HTR1B_P222_F	4504532	NM_000863.1	HTR1B	3351	6	36.1	78230061	-222	Y	CTTCCAGAGCGCCTAGCTAAGCCGCCGCGTCTGTGGTTGTTCCTCTCCACAC	S12, 5-HT1B, HTR1D2, HTR1DB, 5-HT1DB	go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: serotonin receptor activity; go_function: rhodopsin-like receptor activity; go_process: signal transduction; go_process: synaptic transmission; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	5-hydroxytryptamine (serotonin) receptor 1B
HTR2A_E10_R	3493	0.2116179	8615.885	2339.521	2.796356E-17	32	485.4767	0.9582931	700.1841	18385.7	2.447072E-37	30	959.9446	0.9674135	656.7025	22464.66	3.678E-38	26	1224.14	0.4307078	4928.317	3804.26	2.073195E-06	28	330.2117	0.959047	647.1232	17496.3	2.17806E-36	25	1309.715	0.9572836	789.3859	19931.33	3.678E-38	33	1429.864	0.9578685	761.1045	19577.38	2.039639E-36	19	1679.222	0.9603	818.8016	22224.81	1.495566E-32	30	953.7842	0.9396576	709.436	12604.61	2.662071E-19	21	922.0915	0.9652248	688.9263	21897.54	3.678E-38	27	879.0661	HTR2A	HTR2A_E10_R	60302916	NM_000621.2	HTR2A	3356	13	36.1	46368166	10	N	TGAGGCTGGTGTACATGCTGTTCTCCCGGGGCTGGATTTTTGTCTT	HTR2, 5-HT2A	5-HT2 receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: serotonin receptor activity; go_function: rhodopsin-like receptor activity; go_process: signal transduction; go_process: synaptic transmission; go_process: serotonin receptor signaling pathway	5-hydroxytryptamine (serotonin) receptor 2A
HTR2A_P853_F	1105	0.1025529	3462.453	407.088	0.02017315	31	116.1673	0.1065699	7514.639	908.2872	4.83873E-07	23	435.9892	0.05929964	8506.987	542.5651	1.133078E-08	32	320.8935	0.05079935	3695.497	203.1275	0.07582755	25	93.56298	0.1217442	6769.113	952.1996	2.467075E-06	22	495.3105	0.1378851	7356.304	1192.548	8.810856E-09	29	433.7662	0.07833454	7656.426	659.2371	7.852545E-06	31	387.0545	0.1768983	7522.339	1638.168	4.004887E-05	24	692.3264	0.1864202	6411.251	1491.961	1.347266E-06	19	440.1783	0.1318378	7944.646	1221.648	8.998758E-09	23	353.023	HTR2A	HTR2A_P853_F	60302916	NM_000621.2	HTR2A	3356	13	36.1	46369029	-853	N	CCTGTTGGCTTCCTCTGGCACGGCTCGGCTGGGTTCCTCCCTCCCTGTGCGG	HTR2, 5-HT2A	5-HT2 receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: serotonin receptor activity; go_function: rhodopsin-like receptor activity; go_process: signal transduction; go_process: synaptic transmission; go_process: serotonin receptor signaling pathway	5-hydroxytryptamine (serotonin) receptor 2A
IAPP_E280_F	5581	0.4499456	1688.782	1463.227	0.07930983	37	111.2327	0.9262857	865.3105	12130	7.923211E-17	30	965.9938	0.9365931	1049.322	16976.81	1.602822E-36	34	851.528	0.68617	753.1317	1865.32	0.2762253	21	96.57165	0.9278188	721.6583	10561.62	1.512417E-13	26	857.3299	0.9039697	1103.089	11325.13	4.918874E-19	39	556.9009	0.9286347	931.8041	13426.26	1.40174E-17	25	735.6026	0.9323072	1118.613	16783.49	2.675488E-19	25	1138.901	0.9108146	870.7399	9913.779	2.015904E-12	27	594.1475	0.9303132	947.7289	13987.1	5.845066E-24	33	634.3103	IAPP	IAPP_E280_F	4557654	NM_000415.1	IAPP	3375	12	36.1	21417365	280	N	GAAGGAAATTGGGAAAGTAAAAATCTCGAAATTACTTGAAAAGTGGACAATATTA	DAP, IAP, AMYLIN	precursor; Islet amyloid polypeptide (diabetes-associated peptide; amylin); go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_process: apoptosis; go_process: cell-cell signaling; go_process: signal transduction	islet amyloid polypeptide precursor
IAPP_P115_F	4939	0.8182734	610.1819	3197.786	0.02300909	29	110.7544	0.9641683	489.2644	15856.08	4.784485E-27	23	886.5333	0.9655032	538.1799	17861.5	3.909885E-38	31	938.3261	0.8393312	332.5894	2259.84	0.2819613	40	63.69299	0.9564906	526.8156	13779.62	3.750134E-22	34	894.088	0.9594725	536.3444	15065.2	1.08329E-30	23	834.1805	0.955354	489.6545	12617.67	1.498971E-14	34	862.631	0.96088	582.4772	16763.24	4.38564E-18	40	661.9944	0.9429818	456.1511	9197.778	6.982729E-10	24	645.8222	0.9684392	477.8767	17732.07	2.822607E-36	34	697.0292	IAPP	IAPP_P115_F	4557654	NM_000415.1	IAPP	3375	12	36.1	21416970	-115	N	ACTGATGAGTTAATGTAATAATGACCCATCCGCTTCTGCTGCCTGTGAGGTACTT	DAP, IAP, AMYLIN	precursor; Islet amyloid polypeptide (diabetes-associated peptide; amylin); go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_process: apoptosis; go_process: cell-cell signaling; go_process: signal transduction	islet amyloid polypeptide precursor
IAPP_P1154_F	4934	0.3769419	1255.324	819.9534	0.326839	37	74.17847	0.9585171	483.6366	13485.7	1.566244E-19	23	936.236	0.9585361	522.921	14400.29	1.568824E-24	31	552.2728	0.5962253	757.014	1265.491	0.4194768	25	79.63664	0.9574153	450.3605	12373.54	1.204515E-17	35	666.2778	0.9567289	516.2694	13625.77	5.796708E-25	26	958.4161	0.9538068	540.9668	13234.81	3.943895E-16	37	633.7927	0.9598129	542.6392	15348.55	4.125615E-15	27	534.6329	0.9354944	474.5309	8332.158	3.402191E-08	20	988.3242	0.9656404	479.1486	16276.36	1.785254E-30	24	476.7777	IAPP	IAPP_P1154_F	4557654	NM_000415.1	IAPP	3375	12	36.1	21415931	-1154	N	TTAGAAATACAAAAAAAGAGGATGGGTGCGGTGGCTGACGCCTGTAATC	DAP, IAP, AMYLIN	precursor; Islet amyloid polypeptide (diabetes-associated peptide; amylin); go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_process: apoptosis; go_process: cell-cell signaling; go_process: signal transduction	islet amyloid polypeptide precursor
ICA1_P61_F	5884	0.07548518	1653.635	143.1815	0.4206977	22	96.70715	0.07822056	2664.538	234.5938	0.1982824	32	184.2258	0.08276796	3348.126	311.1474	0.08074068	22	154.6884	0.1025644	862.6122	110.0132	0.6862844	25	44.34979	0.08600538	2651.975	258.9563	0.1879019	27	133.4705	0.132284	2640.582	417.8037	0.1357737	26	204.0581	0.08968958	2920.162	297.5656	0.2037735	31	98.76893	0.06687413	3362.289	248.1311	0.2136723	35	118.2942	0.1058311	2251.771	278.3484	0.3055004	26	177.6445	0.05805622	3238.032	205.7379	0.1023455	34	92.19945	ICA1	ICA1_P61_F	4826767	NM_004968.1	ICA1	3382	7	36.1	8268743	-61	Y	CTGCTCTCCGGCAGGTGTTCCACGTGGCCATAGCGTTTGCGTCACAATGACC	ICA69, ICAp69	isoform 2 is encoded by variant 2; IS13; gamma transcript isoform 2 is encoded by transcript variant 2; islet cell autoantigen p69; islet cell autoantigen 1 (69kD); go_component: cytosol; go_component: membrane; go_component: Golgi stack; go_component: Golgi membrane; go_component: synaptic vesicle membrane; go_component: secretory granule membrane; go_function: molecular function unknown; go_process: neurotransmitter transport; go_process: regulation of neurotransmitter secretion	islet cell autoantigen 1 isoform 2
ICA1_P72_R	5885	0.06867664	5098.305	383.3278	0.0002423627	30	375.6384	0.1559613	7485.207	1401.594	8.109227E-08	34	611.0901	0.1586107	9252.548	1763.053	5.46038E-13	32	424.6133	0.07550571	5218.11	434.3431	0.004883368	34	296.5163	0.1714858	8233.496	1724.866	1.698679E-10	23	379.0685	0.2853186	7004.41	2836.257	1.03855E-11	29	581.6534	0.1985104	7709.042	1934.118	8.600934E-08	37	414.5971	0.1644943	9331.085	1856.792	1.746439E-07	31	281.9131	0.2049726	6035.919	1581.953	3.898949E-06	32	576.855	0.1705701	9072.835	1886.37	1.311601E-12	30	373.9436	ICA1	ICA1_P72_R	4826767	NM_004968.1	ICA1	3382	7	36.1	8268754	-72	Y	CTCCGGCAGGTGTTCCACGTGGCCATAGCGTTTGCGTCACAATGACCTGGCGG	ICA69, ICAp69	isoform 2 is encoded by variant 2; IS13; gamma transcript isoform 2 is encoded by transcript variant 2; islet cell autoantigen p69; islet cell autoantigen 1 (69kD); go_component: cytosol; go_component: membrane; go_component: Golgi stack; go_component: Golgi membrane; go_component: synaptic vesicle membrane; go_component: secretory granule membrane; go_function: molecular function unknown; go_process: neurotransmitter transport; go_process: regulation of neurotransmitter secretion	islet cell autoantigen 1 isoform 2
ICAM1_E242_F	4104	0.1296192	9135.257	1375.337	7.519898E-16	40	403.6493	0.1166959	9348.003	1248.203	4.255099E-11	34	455.4112	0.1393606	10250.64	1676.047	2.509078E-15	30	567.8162	0.08144206	7393.694	664.413	1.579936E-05	16	236.6642	0.1197937	8130.793	1120.189	4.785358E-09	36	632.8134	0.1437217	9045.986	1535.104	1.31755E-13	34	474.0953	0.1182669	9766.807	1323.435	2.520896E-10	21	604.2635	0.1363131	11186.79	1781.359	5.140884E-10	38	633.5953	0.1328267	8328.364	1290.99	8.250961E-10	27	518.0352	0.1431689	12931.46	2177.442	1.512671E-24	34	684.6249	ICAM1	ICAM1_E242_F	4557877	NM_000201.1	ICAM1	3383	19	36.1	10243021	242	Y	GGGAAGGAGGGGCTAGAGACAGCGATTGAAAGGCAACAGCCAGTAGGTTCG	BB2, CD54, P3.58	cell surface glycoprotein P3.58; 60 bp after segment 1; go_component: membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: cell-cell adhesion	intercellular adhesion molecule 1 precursor
ICAM1_P119_R	2651	0.03957315	5157.58	216.6318	0.0003454252	30	219.5079	0.04430553	8590.639	402.8937	5.291805E-08	26	509.7604	0.03047451	10579.77	335.6906	9.574584E-13	26	603.4338	0.1954498	448.1169	133.1543	0.7709626	32	23.02426	0.04101425	8442.36	365.3428	3.35156E-08	24	350.3646	0.03825302	8831.717	355.2548	3.619911E-10	31	415.0391	0.03789064	8792.624	350.2172	5.176586E-07	34	313.1339	0.03039474	11217.69	354.7817	5.39295E-08	28	435.0179	0.05987096	7291.984	470.7495	2.286821E-06	36	468.0491	0.0371357	11436.31	444.9319	6.845651E-15	34	339.7268	ICAM1	ICAM1_P119_R	4557877	NM_000201.1	ICAM1	3383	19	36.1	10242660	-119	Y	GAGGATGACCCTCTCGGCCCGGGCACCCTGTCAGTCCGGAAATAACT	BB2, CD54, P3.58	cell surface glycoprotein P3.58; 60 bp after segment 1; go_component: membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: cell-cell adhesion	intercellular adhesion molecule 1 precursor
ICAM1_P386_R	2658	0.04132697	3565.861	158.0298	0.02741754	27	152.1404	0.03466369	9762.769	354.1563	4.127354E-10	19	405.8425	0.03375213	10857.29	382.7506	1.517815E-13	36	399.9143	0.0287976	5775.552	174.2189	0.002726536	23	264.3931	0.04539744	7956.051	383.1166	2.322768E-07	29	348.191	0.04626024	8504.577	417.3568	1.408536E-09	26	572.3641	0.04855358	8902.893	459.4297	2.388684E-07	27	402.3226	0.04829997	10449.56	535.4032	3.186665E-07	33	356.2495	0.0509192	8566.958	464.9916	1.261765E-08	24	488.6547	0.04433523	11354.82	531.4125	6.644892E-15	20	609.0868	ICAM1	ICAM1_P386_R	4557877	NM_000201.1	ICAM1	3383	19	36.1	10242393	-386	Y	GACTTGAGTTCGGACCCCCTCGCAGCCTGGAGTCTCAGTTTACCGCTTTGT	BB2, CD54, P3.58	cell surface glycoprotein P3.58; 60 bp after segment 1; go_component: membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: cell-cell adhesion	intercellular adhesion molecule 1 precursor
ID1_P659_R	2256	0.05174354	5351.273	297.4598	0.0001372783	22	261.9397	0.1739454	9077.591	1932.56	5.425441E-12	23	740.6085	0.1665606	10771.91	2172.722	3.419081E-18	32	639.6956	0.7480977	345.643	1323.468	0.5113869	25	88.62305	0.1569762	8284.622	1561.268	2.943965E-10	26	498.1553	0.2178899	7619.075	2150.475	1.549597E-11	28	454.6867	0.1804504	8752.938	1949.261	1.322876E-09	34	524.1573	0.1484695	10166.71	1790.062	1.591656E-08	20	606.8635	0.1638621	6898.099	1371.453	3.211248E-07	36	514.8068	0.1596261	11488.97	2201.285	5.540834E-20	30	425.0142	ID1	ID1_P659_R	31317298	NM_002165.2	ID1	3397	20	36.1	29656094	-659	Y	CGAATGCAGCCTCACTCCACTGCGCTCTATCTAGTTCACTTCCCAGCCA	ID	isoform a is encoded by transcript variant 1; DNA-binding protein inhibitor ID-1; inhibitor of differentiation 1; dJ857M17.1.2 (inhibitor of DNA binding 1, dominant negative helix-loop-helix protein); go_component: nucleus; go_function: transcription regulator activity; go_process: development; go_process: regulation of transcription; go_process: regulation of transcription from RNA polymerase II promoter	inhibitor of DNA binding 1 isoform a
ID1_P880_F	2271	0.1571583	4404.598	839.9384	0.0005237511	27	164.5124	0.07400449	8821.569	713.0015	5.548775E-09	30	394.9131	0.08768626	9080.293	882.356	1.487997E-10	28	502.8371	0.04601519	6471.73	316.9856	0.0004355118	34	266.5955	0.09254257	7792.24	804.8512	8.125917E-08	27	286.3918	0.1201778	7711.459	1066.993	2.882349E-09	27	415.8284	0.1092703	8312.75	1032.034	2.543002E-07	30	321.0353	0.1658245	8963.865	1801.792	6.016587E-07	25	351.7847	0.1097886	7351.957	919.0399	3.192635E-07	27	427.7249	0.06440673	8214.908	572.4026	4.61163E-08	26	322.8981	ID1	ID1_P880_F	31317298	NM_002165.2	ID1	3397	20	36.1	29655873	-880	Y	CTAACGGTCTGAGCCGCTGGTTCAGACGCTGACACAGACCGGCCCGGGA	ID	isoform a is encoded by transcript variant 1; DNA-binding protein inhibitor ID-1; inhibitor of differentiation 1; dJ857M17.1.2 (inhibitor of DNA binding 1, dominant negative helix-loop-helix protein); go_component: nucleus; go_function: transcription regulator activity; go_process: development; go_process: regulation of transcription; go_process: regulation of transcription from RNA polymerase II promoter	inhibitor of DNA binding 1 isoform a
IFNG_E293_F	1629	0.5208536	2051.872	2339.181	0.005940226	26	245.6444	0.6076306	4056.34	6436.587	7.014156E-11	27	565.1804	0.6036191	4543.921	7071.883	1.664446E-14	25	483.3648	0.4971095	1894.165	1971.241	0.07898626	32	205.5025	0.6450403	3626.598	6772.054	1.840532E-11	21	445.3472	0.5002842	5303.791	5409.937	5.796518E-14	29	635.8015	0.6779232	3041.303	6611.97	8.284788E-08	30	583.6344	0.7113188	3099.002	7882.432	3.219776E-07	26	372.9963	0.5282777	3856.482	4430.831	2.989588E-07	27	391.2255	0.7378126	2756.571	8038.581	3.17555E-12	36	298.1901	IFNG	IFNG_E293_F	56786137	NM_000619.2	IFNG	3458	12	36.1	66839495	293	N	AGCCTATCAGAGATGCTACAGCAAGTCGATATTCAGTCATTTTCAACCACAAA	IFG, IFI	go_component: extracellular space; go_function: cytokine activity; go_function: interferon-gamma receptor binding; go_process: immune response; go_process: cell motility; go_process: response to virus; go_process: cell-cell signaling; go_process: regulation of cell growth; go_process: cell surface receptor linked signal transduction	interferon, gamma
IFNG_P188_F	5788	0.4546511	2806.997	2423.531	0.0005474269	30	212.1906	0.8181198	1744.518	8296.874	5.839848E-10	32	484.3621	0.8041596	2085.214	8972.921	4.293901E-13	23	463.5106	0.9309795	717.984	11033.33	2.301602E-11	44	669.2177	0.7910777	1702.088	6823.55	1.091134E-07	27	508.0932	0.7331682	2418.194	6919.191	1.639788E-10	28	403.673	0.8609234	1264.177	8444.638	6.738996E-08	28	490.9334	0.870607	1506	10805.8	4.947487E-09	22	722.6271	0.7802615	1610.784	6074.76	3.04343E-06	32	357.2586	0.8672509	1441.781	10072.47	5.87661E-14	34	499.1993	IFNG	IFNG_P188_F	56786137	NM_000619.2	IFNG	3458	12	36.1	66839976	-188	N	CCTTTAGACTCCTTGGGTCCTTTGACGATGAGACAGACCCATTATGCCCACC	IFG, IFI	go_component: extracellular space; go_function: cytokine activity; go_function: interferon-gamma receptor binding; go_process: immune response; go_process: cell motility; go_process: response to virus; go_process: cell-cell signaling; go_process: regulation of cell growth; go_process: cell surface receptor linked signal transduction	interferon, gamma
IFNG_P459_R	5790	0.2079126	3345.652	904.4388	0.008427472	27	191.8868	0.7471622	3074.15	9379.946	2.027503E-15	31	409.8971	0.7580679	3117.971	10083.16	5.881725E-19	32	474.6016	0.04343122	3996.419	185.9903	0.05263392	30	169.8684	0.7660319	2498.149	8506.565	7.200737E-13	19	635.5575	0.5995284	4343.89	6652.75	9.670059E-15	34	461.0543	0.7812738	2567.647	9528.636	2.485588E-12	20	553.6744	0.8173074	2495.359	11610.79	7.354402E-12	31	384.3571	0.6456015	3577.462	6699.167	3.062311E-11	31	532.9191	0.8380166	1922.746	10464.62	3.110813E-16	32	455.6196	IFNG	IFNG_P459_R	56786137	NM_000619.2	IFNG	3458	12	36.1	66840247	-459	N	TGCAAATGACCAGAAAGCAAGGAAAGAATGCGGTTAAAAGAACAATTTGGTGAGG	IFG, IFI	go_component: extracellular space; go_function: cytokine activity; go_function: interferon-gamma receptor binding; go_process: immune response; go_process: cell motility; go_process: response to virus; go_process: cell-cell signaling; go_process: regulation of cell growth; go_process: cell surface receptor linked signal transduction	interferon, gamma
IFNGR1_P307_F	4119	0.09965046	6832.364	767.2724	3.740932E-08	31	204.8199	0.1954338	10696.17	2622.453	1.060636E-17	39	782.7172	0.186	13012.84	2996.298	1.925042E-28	28	816.1463	0.05231977	4324.47	244.2672	0.03051946	41	187.1931	0.1671174	11539.21	2335.4	8.786257E-21	27	1222.772	0.1810388	12908.12	2875.565	1.887517E-31	25	582.2376	0.1822862	11987.66	2694.604	2.042899E-18	40	955.5508	0.1878371	14677.73	3417.795	9.888928E-20	34	663.7675	0.2037302	9772.135	2525.843	2.443132E-16	34	781.6339	0.1669907	14075.19	2841.654	4.30878E-31	34	875.6945	IFNGR1	IFNGR1_P307_F	4557879	NM_000416.1	IFNGR1	3459	6	36.1	137582507	-307	Y	GCAAGTTTGCATTAGGCCACAGCCGAGCCACAATCCTTATTTTACTAACTCTTGG	CD119, IFNGR	Immune interferon, receptor for; go_component: membrane; go_component: integral to plasma membrane; go_function: cytokine binding; go_function: receptor activity; go_function: interferon-gamma receptor activity; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: response to virus; go_process: signal transduction; go_process: response to pathogenic bacteria	interferon gamma receptor 1
IFNGR2_E164_F	697	0.07565734	6599.402	548.3453	3.246387E-07	34	331.7304	0.09454933	13458.25	1415.785	3.070551E-22	31	954.0119	0.08972689	16467.22	1633.054	7.721106E-37	30	526.8525	0.03826375	8085.162	325.6558	5.591987E-06	35	435.7878	0.09790868	14002.06	1530.57	2.68235E-26	24	551.5292	0.1040813	13905.13	1627.014	2.095485E-30	25	933.3578	0.1144172	17008.45	2210.409	2.429453E-32	27	567.2642	0.1088735	17556.41	2157.176	1.500512E-23	31	483.5533	0.1410247	9764.636	1619.555	6.661663E-14	34	961.8575	0.09678455	15427.67	1663.876	9.08863E-32	22	963.0811	IFNGR2	IFNGR2_E164_F	47419933	NM_005534.2	IFNGR2	3460	21	36.1	33697236	164	Y	ACATTTCGACTAAAGGGGCGAATCCTCGAATTGTGCGATCAAGCACCCGAGAG	AF-1, IFGR2, IFNGT1	interferon gamma receptor accessory factor-1; go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: interferon-gamma receptor activity; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: response to virus; go_process: response to pathogenic bacteria; go_process: cell surface receptor linked signal transduction	interferon-gamma receptor beta chain precursor
IFNGR2_P377_R	4125	0.1296014	2109.758	329.0305	0.2197253	22	121.5084	0.6840736	3072.883	6870.225	9.132507E-10	27	509.5828	0.6846092	3719.983	8291.921	1.478769E-15	31	354.8392	0.2115766	2181.662	612.293	0.2391008	25	118.2454	0.6719658	2982.92	6315.248	3.864276E-09	21	579.0547	0.719037	2979.792	7881.764	2.289232E-14	20	761.5963	0.52707	4476.514	5100.424	1.097871E-07	34	433.1919	0.5958652	4377.054	6601.068	3.251177E-07	26	456.9578	0.6855016	2890.195	6517.629	2.255486E-09	24	518.2523	0.6457739	3537.54	6631.438	8.06125E-11	23	398.7525	IFNGR2	IFNGR2_P377_R	47419933	NM_005534.2	IFNGR2	3460	21	36.1	33696695	-377	Y	CTATGTTGCAAAACCCATTTTTGCTAACGTGTCCAGTGGGCTCCCGGGACGAC	AF-1, IFGR2, IFNGT1	interferon gamma receptor accessory factor-1; go_component: membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: interferon-gamma receptor activity; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: response to virus; go_process: response to pathogenic bacteria; go_process: cell surface receptor linked signal transduction	interferon-gamma receptor beta chain precursor
IGF1_E394_F	648	0.164785	2720.186	556.4131	0.06413798	26	144.3954	0.8142253	2204.779	10101.54	4.783342E-15	30	768.8727	0.855098	2022.162	12523.34	3.048336E-23	27	624.2693	0.2467896	2838.738	962.8781	0.08533013	36	135.7705	0.8314953	1913.583	9936.128	5.517899E-15	37	562.5082	0.8173912	2304.583	10763.37	3.79758E-21	29	695.9775	0.8545548	1713.796	10656.86	6.505525E-13	23	603.7222	0.8146101	2571.604	11739.13	3.282072E-12	24	541.0483	0.7824147	1933.379	7311.828	4.799356E-09	32	490.459	0.8348938	2252.811	11897.48	2.082995E-21	26	590.1559	IGF1	IGF1_E394_F	19923111	NM_000618.2	IGF1	3479	12	36.1	101398060	394	N	TGTGCAAATGCATCCATCTCCCCGAGCTATTTTTCAGATTCCACAGAATTGCA	IGFI	somatomedin C; go_component: extracellular region; go_component: extracellular region; go_function: hormone activity; go_function: growth factor activity; go_function: prothoracicotrophic hormone activity; go_function: insulin-like growth factor receptor binding; go_process: cell motility; go_process: DNA replication; go_process: physiological process; go_process: muscle development; go_process: signal transduction; go_process: glycolate metabolism; go_process: skeletal development; go_process: sensory perception of sound; go_process: Ras protein signal transduction; go_process: positive regulation of cell proliferation	insulin-like growth factor 1 (somatomedin C)
IGF1_P933_F	4132	0.2567137	1787.004	651.7269	0.2197405	25	58.13799	0.5524292	4598.489	5799.266	1.106235E-10	26	506.2778	0.5980848	4314.476	6569.125	1.143313E-12	26	600.1246	0.3493095	324.0782	227.6575	0.7767885	26	20.08734	0.6503102	3398.418	6505.929	2.214108E-10	26	513.6492	0.4529719	5726.555	4824.735	1.581919E-13	30	731.256	0.6482351	3384.421	6421.12	4.687616E-08	16	562.8447	0.6518238	3866.698	7426.09	1.273306E-07	26	467.9586	0.5367877	3792.457	4510.726	2.804076E-07	26	494.5258	0.6452135	3423.172	6407.229	4.222345E-10	41	333.8481	IGF1	IGF1_P933_F	19923111	NM_000618.2	IGF1	3479	12	36.1	101399387	-933	N	ACCAGCTGGCTAGCAATACCCTCTCGAGGGTTATGATGTCATTCAAATCCCTCAA	IGFI	somatomedin C; go_component: extracellular region; go_component: extracellular region; go_function: hormone activity; go_function: growth factor activity; go_function: prothoracicotrophic hormone activity; go_function: insulin-like growth factor receptor binding; go_process: cell motility; go_process: DNA replication; go_process: physiological process; go_process: muscle development; go_process: signal transduction; go_process: glycolate metabolism; go_process: skeletal development; go_process: sensory perception of sound; go_process: Ras protein signal transduction; go_process: positive regulation of cell proliferation	insulin-like growth factor 1 (somatomedin C)
IGF1R_E186_R	649	0.06077501	4434.733	293.4318	0.002426985	30	170.5937	0.08481664	9805.076	917.9749	2.285486E-11	25	402.7305	0.07935549	11191.54	973.2813	5.664359E-16	19	560.7488	0.251675	412.0002	172.1947	0.7703813	34	18.21862	0.07734528	9427.686	798.697	4.449631E-11	32	442.1515	0.1174947	8967.5	1207.226	1.515062E-12	32	420.8224	0.07937578	8595.932	749.7591	2.534794E-07	26	700.6522	0.084836	11930.52	1115.233	3.8983E-10	18	896.8262	0.0879526	7035.213	688.0789	2.64757E-06	23	506.3107	0.09156039	9874.966	1005.363	2.010327E-12	31	492.7805	IGF1R	IGF1R_E186_R	11068002	NM_000875.2	IGF1R	3480	15	36.1	97010474	186	Y	CCACTGCGGGAACTTTTCCTCCGAGGGGCTGCGCCCTGTTTGCGAAACCC	CD221, JTK13	clone 1900 unknown protein; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: phosphoinositide 3-kinase binding; go_function: insulin receptor substrate binding; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_function: epidermal growth factor receptor activity; go_function: insulin-like growth factor receptor activity; go_process: anti-apoptosis; go_process: signal transduction; go_process: protein tetramerization; go_process: insulin receptor signaling pathway; go_process: protein amino acid autophosphorylation; go_process: protein amino acid autophosphorylation; go_process: protein amino acid autophosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of progression through cell cycle; go_process: insulin-like growth factor receptor signaling pathway	insulin-like growth factor 1 receptor precursor
IGF1R_P325_R	4144	0.05998336	4356.782	284.3915	0.003082031	33	137.1351	0.05966938	6855.382	441.359	2.32641E-05	25	315.0016	0.05062858	9654.537	520.1951	5.069768E-11	22	303.3808	0.3615716	320.7901	238.3129	0.7753433	24	24.08465	0.05893172	7574.691	480.6056	7.064967E-07	28	308.3696	0.06077628	7847.941	514.3038	2.129292E-08	37	256.8057	0.05969249	8363.238	537.2623	1.185541E-06	32	229.7658	0.06335977	8692.026	594.7437	2.962612E-05	24	397.4353	0.06033363	7326.424	476.8322	1.965453E-06	18	476.4056	0.06703343	7631.563	555.511	5.199365E-07	29	276.7349	IGF1R	IGF1R_P325_R	11068002	NM_000875.2	IGF1R	3480	15	36.1	97009963	-325	Y	CAGGGCCGGGCTTGTTTTTCCTCGCCTAGGCAGATTTGGGCTTTGCCCCCT	CD221, JTK13	clone 1900 unknown protein; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: phosphoinositide 3-kinase binding; go_function: insulin receptor substrate binding; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_function: epidermal growth factor receptor activity; go_function: insulin-like growth factor receptor activity; go_process: anti-apoptosis; go_process: signal transduction; go_process: protein tetramerization; go_process: insulin receptor signaling pathway; go_process: protein amino acid autophosphorylation; go_process: protein amino acid autophosphorylation; go_process: protein amino acid autophosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of progression through cell cycle; go_process: insulin-like growth factor receptor signaling pathway	insulin-like growth factor 1 receptor precursor
IGF2_E134_R	4106	0.1313583	1182.497	193.9425	0.5695041	34	42.56001	0.1045656	5798.962	688.8597	0.0002513557	23	380.3602	0.1252013	6797.499	987.1708	2.040636E-06	22	261.104	0.2758763	1650.027	666.7245	0.3459722	33	106.715	0.08973981	5703.173	572.1173	0.0002692189	26	186.8805	0.2378994	5953.47	1889.668	2.195954E-07	20	333.424	0.1383179	5426.56	887.1279	0.001599308	30	267.5896	0.1373432	6506.441	1051.808	0.001203944	18	261.4111	0.140137	5455.177	905.3604	0.0002400494	21	335.7907	0.1102555	6861.584	862.6671	2.932541E-06	29	244.0406	IGF2	IGF2_E134_R	6453816	NM_000612.2	IGF2	3481	11	36.1	2116444	134	Y	GGCAGGCGCACAGCGGGAGAGAACAGCACGGAGAGAAACAGAAAGCGTGTAATTAA	FLJ44734	somatomedin A; insulin-like growth factor II (78 AA); go_component: extracellular region; go_function: hormone activity; go_function: growth factor activity; go_function: prothoracicotrophic hormone activity; go_function: insulin-like growth factor receptor binding; go_process: imprinting; go_process: development; go_process: cell proliferation; go_process: physiological process; go_process: skeletal development; go_process: insulin receptor signaling pathway; go_process: regulation of progression through cell cycle	insulin-like growth factor 2
IGF2_P1036_R	2661	0.04390588	6414.976	299.1815	2.22663E-06	32	348.9147	0.06146343	14150.15	933.2223	6.81971E-23	28	849.7523	0.05374823	22758.71	1298.402	3.678E-38	28	970.3452	0.02619798	9029.541	245.61	3.530429E-07	22	405.2221	0.04880783	16020.52	827.1805	3.639874E-31	30	1263.98	0.07504672	14507.09	1185.156	4.55053E-31	32	1317.462	0.06787123	17718.13	1297.394	1.254651E-31	29	1332.63	0.05046244	24387.11	1301.348	3.678E-38	31	1253.524	0.08423008	12804.64	1186.934	1.99717E-21	36	1120.817	0.06576297	17648.48	1249.354	3.678E-38	23	839.8297	IGF2	IGF2_P1036_R	7705972	NM_016412.1	IGF2AS	51214	11	36.1	2117614	-709	Y	CCACCAGGAGGCTGCACTGCGGGTGCGCCCCGTCTGAGTGCAGATGCAGGT	PEG8	PEG8/IGF2AS, imprinting gene; insulin-like growth factor 2, antisense	insulin-like growth factor 2 antisense
IGF2_P36_R	2680	0.4371824	2373.69	1921.5	0.007547091	21	159.4782	0.1169774	5743.054	774.0518	0.0002319502	26	156.1202	0.1737425	6333.306	1352.773	2.941297E-06	28	235.7787	0.07025804	4906.977	378.3635	0.009559378	28	182.0129	0.1765497	4530.134	992.7118	0.001957422	26	473.8653	0.1972029	5157.95	1291.588	4.803301E-05	30	321.7472	0.2292482	5748.977	1739.688	8.757257E-05	43	191.5878	0.2236921	6075.104	1779.348	0.0006804687	21	275.9084	0.1387228	6410.47	1048.618	6.89983E-06	26	290.774	0.180091	5458.81	1220.979	9.381782E-05	20	254.3581	IGF2	IGF2_P36_R	6453816	NM_000612.2	IGF2	3481	11	36.1	2116614	-36	Y	GGGGCCAGACGCCAAGAGGGGCGCGGGGAGCACAGAGAAGCGGAG	FLJ44734	somatomedin A; insulin-like growth factor II (78 AA); go_component: extracellular region; go_function: hormone activity; go_function: growth factor activity; go_function: prothoracicotrophic hormone activity; go_function: insulin-like growth factor receptor binding; go_process: imprinting; go_process: development; go_process: cell proliferation; go_process: physiological process; go_process: skeletal development; go_process: insulin receptor signaling pathway; go_process: regulation of progression through cell cycle	insulin-like growth factor 2
IGF2AS_E4_F	3495	0.1299668	7630.565	1154.803	6.083192E-11	23	346.8666	0.1519213	11261.45	2035.244	1.217741E-17	28	693.1642	0.1105259	15969.84	1996.836	2.872342E-36	22	1330.027	0.1422326	4188.037	711.0302	0.01831494	25	320.3743	0.1574152	12380.53	2331.665	1.754728E-23	23	921.5126	0.1811955	12468.38	2781.292	2.972193E-29	32	903.3023	0.1497708	13718.75	2434.219	1.78041E-22	30	872.7942	0.1647574	15502.02	3077.608	7.772378E-21	28	875.2802	0.1242552	8946.837	1283.612	3.892139E-11	23	704.9774	0.1304707	14000.59	2115.759	4.298606E-28	28	895.8143	IGF2AS	IGF2AS_E4_F	7705972	NM_016412.1	IGF2AS	51214	11	36.1	2118327	4	Y	CGCCTCCCGGCGGAGTCCTAGGCCCGCGGGCTAGAGGCACTTTACCGCC	PEG8	PEG8/IGF2AS, imprinting gene; insulin-like growth factor 2, antisense	insulin-like growth factor 2 antisense
IGF2AS_P203_F	1110	0.167499	1746.082	371.4313	0.313357	32	68.02274	0.4426817	3026.305	2483.246	0.002872563	37	213.0389	0.3384522	4139.574	2168.994	0.0002703214	29	268.9869	0.2346653	283.6633	117.638	0.805121	27	14.04162	0.4586197	3000	2626.105	0.001518441	27	263.6274	0.5880122	2417.124	3592.58	0.0002022877	26	377.8121	0.4356904	3369.79	2678.944	0.002832452	23	162.2226	0.450103	3816.292	3205.572	0.003164613	24	284.0184	0.4446289	3071.281	2538.921	0.001822706	23	180.6449	0.5537541	2895.186	3716.776	0.0001150688	34	169.7479	IGF2AS	IGF2AS_P203_F	7705972	NM_016412.1	IGF2AS	51214	11	36.1	2118120	-203	Y	GGAAACCATCTCCTGGAGAGTTTGAACGATGTAAGAAAGCACTGTGATTTTTACC	PEG8	PEG8/IGF2AS, imprinting gene; insulin-like growth factor 2, antisense	insulin-like growth factor 2 antisense
IGF2R_P396_R	2692	0.5134831	4360.711	4707.955	1.115666E-11	35	629.5655	0.1400618	9122.813	1502.159	3.698407E-11	26	828.4058	0.08591853	15166.83	1434.996	1.047822E-30	22	586.2391	0.2856105	5600.014	2278.846	2.626405E-05	27	214.0433	0.09246238	13555.31	1391.24	2.865648E-24	24	839.2036	0.1367031	13819.36	2204.133	1.827847E-32	23	898.8164	0.1079413	13991.63	1705.122	3.601139E-21	28	998.3712	0.1404079	14933.63	2455.631	3.536119E-18	28	841.3135	0.1925814	8644.362	2085.661	2.719196E-12	30	702.405	0.1227389	14678.31	2067.656	1.940811E-30	28	802.0718	IGF2R	IGF2R_P396_R	4504610	NM_000876.1	IGF2R	3482	6	36.1	160309725	-396	Y	CACGGATCCGCTGCCACTAGGCTGTGCGAAGGCATTTACCTCCCTGGCACTTTGAT	MPRI, CD222, CIMPR, M6P-R	cation-independent mannose-6 phosphate receptor; insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent); go_component: lysosome; go_component: membrane; go_component: endosome; go_component: integral to plasma membrane; go_component: trans-Golgi network transport vesicle; go_function: transporter activity; go_function: receptor activity; go_function: insulin-like growth factor receptor activity; go_process: transport; go_process: signal transduction; go_process: receptor mediated endocytosis	insulin-like growth factor 2 receptor
IGFBP1_E48_R	4111	0.1487533	4825.218	860.6696	0.0001206347	20	206.8215	0.5655107	4821.813	6406	1.771619E-12	16	371.9947	0.5114762	6251.632	6650.051	4.573298E-18	21	391.061	0.3045088	4040.471	1812.834	0.003306707	28	279.4523	0.5546357	5172.491	6566.111	1.071893E-14	23	253.042	0.6984198	3860.427	9171.827	5.017959E-21	22	582.9241	0.5680373	5188.61	6954.599	1.981201E-12	23	378.2209	0.5583047	5857.898	7530.808	1.122093E-10	28	476.5204	0.6277849	4188.739	7233.467	5.328032E-14	33	333.7964	0.4811294	6367.417	5996.996	3.590337E-16	25	453.4914	IGFBP1	IGFBP1_E48_R	61744448	NM_001013029.1	IGFBP1	3484	7	36.1	45894532	48	Y	ATTTTGAACACTCAGCTCCTAGCGTGCGGCGCTGCCAATCATTAACCTCCTGGTGC	AFBP, IBP1, PP12, IGF-BP25, hIGFBP-1	isoform b precursor is encoded by transcript variant 2; placental protein 12; amniotic fluid binding protein; alpha-pregnancy-associated endometrial globulin; growth hormone independent-binding protein; binding protein-28; binding protein-26; binding protein-25; IGF-binding protein 1; go_component: extracellular region; go_component: extracellular space; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_process: signal transduction; go_process: regulation of cell growth	insulin-like growth factor binding protein 1 isoform b precursor
IGFBP1_P12_R	2698	0.06450886	3717.462	263.2415	0.01580106	35	132.3155	0.6017936	3832.831	5943.534	1.927535E-09	24	283.9344	0.591404	4167.85	6177.309	2.093411E-11	25	302.8718	0.06157716	3669.083	247.3186	0.07417708	30	182.5861	0.613418	3447.561	5629.177	1.042305E-08	25	427.1643	0.6836658	3051.085	6810.167	9.243797E-12	36	468.0255	0.5806558	3979.156	5648.307	9.114878E-08	21	255.1635	0.6411032	3847.103	7050.773	4.108834E-07	24	515.7917	0.682285	2934.162	6515.787	1.850056E-09	29	353.6358	0.592808	3508.729	5253.746	5.118403E-08	27	263.354	IGFBP1	IGFBP1_P12_R	61744448	NM_001013029.1	IGFBP1	3484	7	36.1	45894472	-12	Y	CCTCCCACCAGCGGTTTGCGTAGGGCCTTGGGTGCACTAGCAAAACAAAC	AFBP, IBP1, PP12, IGF-BP25, hIGFBP-1	isoform b precursor is encoded by transcript variant 2; placental protein 12; amniotic fluid binding protein; alpha-pregnancy-associated endometrial globulin; growth hormone independent-binding protein; binding protein-28; binding protein-26; binding protein-25; IGF-binding protein 1; go_component: extracellular region; go_component: extracellular space; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_process: signal transduction; go_process: regulation of cell growth	insulin-like growth factor binding protein 1 isoform b precursor
IGFBP2_P306_F	5664	0.01157333	25553.5	300.3727	3.678E-38	30	524.7948	0.1245206	10085.52	1448.7	3.513541E-13	24	549.1786	0.08229215	11189.02	1012.302	4.495647E-16	26	733.9008	0.0120654	18825.8	231.136	2.845311E-30	22	1943.401	0.07963043	9622.79	841.2164	1.310883E-11	23	613.0522	0.1556465	8807.753	1642.039	2.935802E-13	24	426.5077	0.08246765	9222.499	837.9045	1.764952E-08	27	866.8917	0.09392598	11707.93	1224.041	5.844673E-10	31	300.0178	0.07491682	9654.994	789.9973	1.263974E-11	24	567.6802	0.05641754	10468.1	631.8753	6.066877E-13	26	606.1064	IGFBP2	IGFBP2_P306_F	55925575	NM_000597.2	IGFBP2	3485	2	36.1	217206066	-306	Y	AGGGGAAGCGCGCAAACGAAGTCCTCGCGAACTGAACTGAGAGCAGACAAAAG	IBP2, IGF-BP53	insulin-like growth factor binding protein 2 (36kD); go_component: extracellular space; go_component: extracellular region; go_function: insulin-like growth factor binding; go_process: regulation of cell growth	insulin-like growth factor binding protein 2, 36kDa
IGFBP2_P353_R	5710	0.05140345	6153.25	338.8571	5.64506E-06	33	275.1357	0.2795637	8833.046	3466.448	4.975263E-15	27	600.6631	0.3192754	9276.949	4398.004	2.05416E-20	29	513.769	0.03937551	5458.48	227.8393	0.004577767	21	127.8565	0.3206935	7800.694	3729.834	3.646631E-14	31	526.493	0.3378662	7995.685	4130.975	4.426794E-18	30	420.8224	0.2370485	10367.54	3252.257	9.388512E-16	25	403.4957	0.2577257	10555.58	3699.734	4.089154E-12	36	599.9379	0.2455818	8476.216	2791.77	1.311641E-13	28	604.0214	0.243278	9934.231	3225.897	2.089935E-18	23	394.8412	IGFBP2	IGFBP2_P353_R	55925575	NM_000597.2	IGFBP2	3485	2	36.1	217206019	-353	Y	GCCTTATGTCTTTTGTGTTCCCCAGCGGTTAGCCCAGTGCCGGCCACAGG	IBP2, IGF-BP53	insulin-like growth factor binding protein 2 (36kD); go_component: extracellular space; go_component: extracellular region; go_function: insulin-like growth factor binding; go_process: regulation of cell growth	insulin-like growth factor binding protein 2, 36kDa
IGFBP3_E65_R	4115	0.08035538	4417.213	394.6985	0.001918158	22	122.3019	0.2095552	8221.223	2206.044	9.609739E-11	30	461.3832	0.1783618	10553.23	2312.612	5.824724E-18	27	593.9058	0.04251196	4915.949	222.7055	0.01231996	26	268.0224	0.1823691	9506.915	2142.782	1.81417E-14	29	551.8315	0.1961605	9287.983	2290.944	2.047659E-16	23	670.2704	0.1667421	9586.028	1938.257	3.637211E-11	28	803.4277	0.193183	10527.58	2544.652	3.54554E-10	13	534.0731	0.1955746	6937.676	1711.023	6.701234E-08	27	743.8616	0.1851147	9817.706	2252.971	2.189661E-15	28	343.6707	IGFBP3	IGFBP3_E65_R	62243067	NM_000598.4	IGFBP3	3486	7	36.1	45927331	65	Y	GCAGGGATGGGGCGACAGTACACGGCGCGAAGCTGTGGAATCCAGGCAG	IBP3, BP-53	isoform b precursor is encoded by transcript variant 2; growth hormone-dependent binding protein; acid stable subunit of the 140 K IGF complex; binding protein 53; binding protein 29; IGF-binding protein 3; go_component: extracellular region; go_component: extracellular region; go_function: metal ion binding; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_function: protein tyrosine phosphatase activator activity; go_process: regulation of cell growth; go_process: positive regulation of apoptosis; go_process: negative regulation of signal transduction; go_process: positive regulation of myoblast differentiation	insulin-like growth factor binding protein 3 isoform b precursor
IGFBP3_P1035_F	2706	0.05752733	3627.552	227.525	0.02081123	27	133.1751	0.06949028	9174.119	692.5894	1.288297E-09	32	696.4686	0.05020512	10768.32	574.4874	8.362121E-14	34	432.4589	0.2801251	2144.971	873.5861	0.1958589	33	144.0657	0.07553791	7908.039	654.3378	9.380368E-08	22	861.0582	0.101844	9997.301	1144.956	3.767295E-15	30	641.6709	0.04466778	9656.068	456.1575	1.441796E-08	23	647.9417	0.06689848	10481.99	758.673	1.490392E-07	20	591.1783	0.0776562	6378.556	545.4583	4.240402E-05	33	431.6049	0.0459952	10064.99	490.0823	1.126668E-11	25	591.5681	IGFBP3	IGFBP3_P1035_F	62243067	NM_000598.4	IGFBP3	3486	7	36.1	45928431	-1035	Y	TCCTGTCGGCCTTCTCTGGCACTCGAGTTTCTTCAGTTTTGTCTGCGCACCC	IBP3, BP-53	isoform b precursor is encoded by transcript variant 2; growth hormone-dependent binding protein; acid stable subunit of the 140 K IGF complex; binding protein 53; binding protein 29; IGF-binding protein 3; go_component: extracellular region; go_component: extracellular region; go_function: metal ion binding; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_function: protein tyrosine phosphatase activator activity; go_process: regulation of cell growth; go_process: positive regulation of apoptosis; go_process: negative regulation of signal transduction; go_process: positive regulation of myoblast differentiation	insulin-like growth factor binding protein 3 isoform b precursor
IGFBP3_P423_R	2707	0.04536481	8665.261	416.5302	1.029792E-11	42	278.3989	0.168114	15405.31	3133.434	3.822932E-35	30	1404.156	0.1066301	19959.64	2394.261	3.678E-38	24	881.481	0.06929438	6709.672	507.0045	0.0001531945	26	320.5365	0.1135803	15852.53	2044.059	2.321462E-35	34	884.5272	0.2527411	13440.15	4579.607	3.678E-38	26	1548.75	0.1303212	14935.26	2253.029	1.353121E-25	35	1245.633	0.1295279	19819.4	2964.045	8.580296E-32	25	1379.904	0.2690369	8331.175	3103.162	4.960564E-14	24	740.6682	0.08708927	15449.89	1483.418	3.723684E-31	25	982.5696	IGFBP3	IGFBP3_P423_R	62243067	NM_000598.4	IGFBP3	3486	7	36.1	45927819	-423	Y	GTCGGGGAAACTGGCATACAGCGCTCCGCATTCGTGTGTACCTCGTGGAGCT	IBP3, BP-53	isoform b precursor is encoded by transcript variant 2; growth hormone-dependent binding protein; acid stable subunit of the 140 K IGF complex; binding protein 53; binding protein 29; IGF-binding protein 3; go_component: extracellular region; go_component: extracellular region; go_function: metal ion binding; go_function: insulin-like growth factor binding; go_function: insulin-like growth factor binding; go_function: protein tyrosine phosphatase activator activity; go_process: regulation of cell growth; go_process: positive regulation of apoptosis; go_process: negative regulation of signal transduction; go_process: positive regulation of myoblast differentiation	insulin-like growth factor binding protein 3 isoform b precursor
IGFBP5_E144_F	717	0.1723884	2205.563	480.2401	0.1602084	33	100.9477	0.09883036	7962.797	884.2388	9.492559E-08	33	494.8112	0.09104218	9865.603	998.1654	1.276428E-12	30	610.5575	0.04135828	3792.53	167.9338	0.07020476	35	178.1924	0.09815808	8080.714	890.4034	1.656801E-08	26	559.0984	0.09970755	8846.029	990.7744	1.061467E-11	24	649.6976	0.08441287	8323.064	776.5673	6.012481E-07	23	738.0341	0.1229619	10508.48	1487.323	1.402462E-08	24	459.7955	0.1280442	6227.281	929.143	1.966692E-05	22	335.8309	0.08251319	9222.644	838.4219	1.376199E-10	31	417.7937	IGFBP5	IGFBP5_E144_F	46094066	NM_000599.2	IGFBP5	3488	2	36.1	217268372	144	Y	CCACTTTGCCACCTCCTCTTCGAAATTCGCAGGTTCTACGCGAAGTCC	IBP5	go_component: extracellular region; go_function: insulin-like growth factor binding; go_process: signal transduction; go_process: regulation of cell growth	insulin-like growth factor binding protein 5
IGFBP5_P9_R	4145	0.1179889	3959.925	543.1069	0.004453228	23	211.2589	0.4359545	5958.902	4682.965	3.405377E-11	22	537.9316	0.4193289	6924.16	5072.463	1.626345E-15	34	582.8306	0.1055307	6036.901	724.0402	0.0004648753	30	301.7277	0.3317428	6410.704	3232.108	7.80163E-10	27	431.8467	0.3706663	7239.429	4322.792	2.294399E-16	26	812.1486	0.2676847	8122.422	3005.559	2.137653E-10	50	299.4299	0.3636556	7516.319	4352.544	2.112747E-08	22	637.2753	0.4384809	4340.481	3467.497	1.930953E-06	31	471.1655	0.3491243	7689.589	4178.27	7.414062E-15	28	903.1755	IGFBP5	IGFBP5_P9_R	46094066	NM_000599.2	IGFBP5	3488	2	36.1	217268525	-9	Y	GAAGTTTCCAAAGAGACTACGGGGCTCCGGGAGAGCAGGCGCTTTTAAATAGC	IBP5	go_component: extracellular region; go_function: insulin-like growth factor binding; go_process: signal transduction; go_process: regulation of cell growth	insulin-like growth factor binding protein 5
IGFBP6_E47_F	654	0.143014	7085.479	1199.114	1.046627E-09	37	243.1989	0.5324676	5287.865	6136.181	6.322136E-13	40	598.6261	0.593142	6434.783	9526.8	2.8982E-28	31	695.4991	0.1424604	5406.099	914.7114	0.001254241	33	280.4583	0.5819278	5330.925	7559.475	7.771324E-18	32	449.656	0.5654724	6289.757	8315.307	1.031848E-26	20	624.706	0.5664344	5866.415	7794.858	7.462891E-16	30	776.683	0.6033236	6692.929	10331.68	2.106544E-17	39	423.8441	0.4623809	5068.626	4445.293	1.366557E-09	28	758.0944	0.6056401	6215.413	9698.926	2.316374E-27	24	529.4266	IGFBP6	IGFBP6_E47_F	24475885	NM_003578.2	SOAT2	8435	12	36.1	51777750	-1083	N	CGACTGCTCTGGAAGGAGAGGACGGGGCACAAACCCTGACCATGACCC	ACAT2, ARGP2, ACACT2, MGC116732	go_component: membrane; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: transferase activity; go_function: acyltransferase activity; go_function: sterol O-acyltransferase activity; go_process: lipid metabolism; go_process: steroid metabolism; go_process: cholesterol metabolism	sterol O-acyltransferase 2
IGFBP6_P328_R	4176	0.1275056	3291.441	495.6226	0.02404523	22	159.5157	0.3298696	5515.839	2764.38	8.196347E-07	28	309.2795	0.2708016	6902.113	2600.367	1.404605E-09	28	429.1216	0.444892	1671.788	1420.002	0.1828553	33	186.1759	0.2483271	6108.776	2051.168	4.713247E-07	25	626.5857	0.3647689	5489.762	3209.811	4.24791E-09	33	328.4891	0.2074005	7439.685	1972.919	1.994687E-07	26	313.7665	0.2336456	8554.387	2638.543	1.720198E-07	26	431.3432	0.2767749	6202.118	2411.791	7.764709E-08	25	361.5344	0.1836582	9945.239	2259.948	9.62618E-16	28	409.5578	IGFBP6	IGFBP6_P328_R	49574524	NM_002178.2	IGFBP6	3489	12	36.1	51777375	-328	Y	CGGGTCCCTGCATGCCCCTCGTCGTCCTACACATACACACTAAGTGGATT	IBP6	IGF binding protein 6; go_component: extracellular space; go_function: insulin-like growth factor binding; go_process: signal transduction; go_process: regulation of cell growth; go_process: negative regulation of cell proliferation	insulin-like growth factor binding protein 6
IGFBP7_P297_F	1124	0.122673	6622.461	939.9736	4.495952E-08	28	288.0075	0.1035649	12377.98	1441.578	4.215723E-19	26	498.1214	0.09423234	14439.21	1512.6	3.1519E-28	28	649.7614	0.1343081	3482.925	555.8741	0.06354909	30	219.9842	0.09914328	12196.85	1353.323	8.751062E-20	21	649.8308	0.1109535	13832.18	1738.743	1.449896E-30	40	539.9618	0.1185016	12526.06	1697.347	3.075136E-17	33	560.1871	0.1000158	14819.02	1657.959	2.838399E-16	41	616.6105	0.1425104	10686.39	1792.643	7.579799E-17	12	833.679	0.09437522	14264.56	1496.932	8.155927E-27	35	545.5778	IGFBP7	IGFBP7_P297_F	4504618	NM_001553.1	IGFBP7	3490	4	36.1	57671593	-297	Y	CTCAGGGATCGCACCGCAGTGCGAGCGGCTCTTCCACCCTCTGGTTTC	PSF, FSTL2, MAC25, IGFBP-7	go_component: extracellular region; go_function: insulin-like growth factor binding; go_process: regulation of cell growth; go_process: negative regulation of cell proliferation	insulin-like growth factor binding protein 7
IGFBP7_P371_F	1111	0.06469335	5023.825	354.4051	0.0003409304	24	185.5133	0.04393258	11603.52	537.7925	1.230294E-14	18	527.8431	0.04127703	12244.92	531.5005	1.061519E-17	19	905.3766	0.1397237	1822.484	312.2444	0.3909535	26	88.52322	0.05459799	10150.89	591.9998	2.997157E-12	29	386.2108	0.05910583	10765.32	682.546	4.974173E-16	28	603.8423	0.06197236	10340.55	689.7722	3.271025E-10	26	431.5603	0.06207522	11593.54	773.9204	4.104659E-09	29	751.3674	0.0590602	7536.045	479.2935	8.759056E-07	23	714.6695	0.06185561	11552.06	768.2672	4.724389E-16	22	917.6826	IGFBP7	IGFBP7_P371_F	4504618	NM_001553.1	IGFBP7	3490	4	36.1	57671667	-371	Y	AAACTTCTTAACAACCACGGCTTCGAGACGATCCAGGGTTTCATCTATTAAATC	PSF, FSTL2, MAC25, IGFBP-7	go_component: extracellular region; go_function: insulin-like growth factor binding; go_process: regulation of cell growth; go_process: negative regulation of cell proliferation	insulin-like growth factor binding protein 7
IGSF4_P454_F	1138	0.05886723	3717.865	238.8049	0.0166704	31	201.5648	0.04695933	13265.31	658.5511	2.118175E-19	40	815.9422	0.04583417	15546.87	751.6109	1.550668E-29	21	755.0648	0.06395058	2751.786	194.8331	0.2091642	15	302.4727	0.05622721	13237.42	794.6042	2.8179E-21	29	637.5986	0.06429321	13055.83	903.9485	2.720149E-24	22	905.8314	0.05166753	13140.79	721.3915	2.427534E-16	37	630.0698	0.06300009	16274.1	1100.929	3.794083E-18	22	475.8394	0.05479512	9145.864	535.9984	6.098819E-10	34	702.0696	0.04655142	16924.89	831.2276	2.078133E-34	24	723.9062	IGSF4	IGSF4_P454_F	22095346	NM_014333.2	IGSF4	23705	11	36.1	114880779	-454	Y	GCACACCGAGTGCATCTGGCCTAGCGAACCAGACGTTGCAAATTTCCGTCA	BL2, ST17, NECL2, TSLC1, IGSF4A, SYNCAM, sTSLC-1, synCAM1, DKFZp686F1789	nectin-like protein 2; tumor suppressor in lung cancer 1	immunoglobulin superfamily, member 4
IGSF4_P86_R	1125	0.3238888	4395.499	2153.553	4.462922E-06	16	330.8198	0.156229	9667.848	1808.572	4.785568E-13	18	694.8929	0.1685309	10814.27	2212.218	1.958089E-18	26	573.589	0.5728274	2432.452	3395.952	0.003473466	28	171.7635	0.2087612	9230.885	2461.869	1.406854E-14	30	530.4633	0.1491434	10609.22	1877.177	3.196927E-19	36	501.0662	0.1682453	9777.122	1997.921	1.142689E-11	32	542.6837	0.1765497	11514.19	2490.111	1.093567E-11	34	372.0895	0.1411821	9241.14	1535.6	2.104115E-12	25	500.2957	0.1489888	12265.12	2164.793	2.671704E-22	29	487.6503	IGSF4	IGSF4_P86_R	22095346	NM_014333.2	IGSF4	23705	11	36.1	114880411	-86	Y	TGAGATGCTAATGACATGCGCTGGAGGCGGAGTCCGGGCAGACCAATCACAGCG	BL2, ST17, NECL2, TSLC1, IGSF4A, SYNCAM, sTSLC-1, synCAM1, DKFZp686F1789	nectin-like protein 2; tumor suppressor in lung cancer 1	immunoglobulin superfamily, member 4
IGSF4C_E65_F	3500	0.3215027	5556.128	2680.13	1.363254E-09	26	314.5056	0.2418131	7569.736	2446.155	6.561401E-10	37	368.8622	0.2056924	10365.03	2710.004	1.40422E-18	38	541.2215	0.1441341	5393.9	925.2134	0.00125886	24	240.7337	0.285513	6564.123	2663.021	5.328557E-09	29	399.968	0.4475695	5528.329	4559.974	2.510826E-12	20	550.7885	0.5078778	5911.588	6204.054	2.263837E-12	33	406.329	0.3922876	8399.872	5486.795	1.722211E-11	23	780.2168	0.5017783	5119.771	5257.034	1.812443E-11	32	295.6871	0.2126822	6104.519	1676.059	2.391068E-06	30	279.7466	IGSF4C	IGSF4C_E65_F	21686976	NM_145296.1	IGSF4C	199731	19	36.1	48835766	65	Y	CAGCAGCAGCGGCCACTGGAAGCGCCGGGCCCGGCCCATGGTGCCG	TSLL2, synCAM4	TSLC1-like 2; go_component: membrane; go_component: integral to membrane; go_function: receptor activity	immunoglobulin superfamily, member 4C
IGSF4C_P533_R	1145	0.09546924	5719.704	614.2441	1.070197E-05	23	239.8546	0.09773809	10227.46	1118.729	9.53829E-13	34	351.5988	0.08753727	14174.57	1369.434	9.936634E-27	23	833.6203	0.07415275	5023.813	410.3753	0.007326777	28	311.1278	0.09895719	10528.94	1167.325	1.377906E-14	20	536.8	0.09217259	9384.049	962.9246	5.453898E-13	16	508.4267	0.09722669	10966.73	1191.862	1.838838E-12	26	646.1718	0.09844627	12929.8	1422.805	2.777943E-12	24	744.5812	0.1550194	9176.028	1701.772	1.20287E-12	21	713.095	0.09062801	11374.42	1143.54	1.368155E-16	24	510.7932	IGSF4C	IGSF4C_P533_R	21686976	NM_145296.1	IGSF4C	199731	19	36.1	48836364	-533	Y	GCAGGTGGGTGTCTGGAGTCTAGCGAGAGGCTGTGAGCTGAGCCACCG	TSLL2, synCAM4	TSLC1-like 2; go_component: membrane; go_component: integral to membrane; go_function: receptor activity	immunoglobulin superfamily, member 4C
IHH_E186_F	5583	0.06402031	2138.758	153.1294	0.2604364	30	92.66627	0.09472907	6551.588	696.0333	2.713875E-05	30	342.7907	0.07623266	8449.914	705.5703	7.028982E-09	18	453.8891	0.03985159	3122.291	133.7433	0.1557072	19	96.60357	0.07752253	7183.259	612.0656	1.880149E-06	26	383.2195	0.2032266	6174.619	1600.417	2.943296E-07	24	401.3839	0.1518455	6403.895	1164.396	7.035452E-05	23	269.9514	0.1003415	8837.809	996.8599	7.566996E-06	30	361.3467	0.08079296	6932.496	618.1155	4.974294E-06	36	239.9961	0.08083428	7286.955	649.6317	1.345944E-06	35	265.1716	IHH	IHH_E186_F	51467740	NM_002181.1	IHH	3549	2	36.1	219633247	186	Y	TCTTGCCTTCATAGCGTCCGCTGGCGCCCAGGGTCTTCTCGGGCACATTGGG	BDA1, HHG2	Brachydactyly, type A1; go_component: extracellular region; go_function: patched binding; go_function: peptidase activity; go_function: cholesterol binding; go_process: development; go_process: proteolysis; go_process: cell-cell signaling; go_process: intein-mediated protein splicing	Indian hedgehog homolog
IHH_P246_R	4944	0.1604323	4018.058	786.9161	0.001956297	31	156.5784	0.08618367	7275.882	695.6328	2.472143E-06	29	474.0137	0.07211402	9940.984	780.3715	2.795712E-12	26	469.3795	0.1979325	2021.056	523.4295	0.2926774	27	97.75554	0.08513894	9556.884	898.6904	1.369743E-11	22	567.6088	0.1416872	7268.452	1216.358	1.195821E-08	17	607.7258	0.1354638	8121.333	1288.197	2.01686E-07	30	376.6912	0.1079529	10289.1	1257.259	5.849354E-08	37	516.8167	0.1460916	5629.147	980.1758	0.0001141951	36	365.0678	0.09434388	6347.311	671.6283	3.253693E-05	25	318.3209	IHH	IHH_P246_R	51467740	NM_002181.1	IHH	3549	2	36.1	219633679	-246	Y	CGACTCTGAGCTGCCGGGCTCGCCGGCCGCCAATAAATAGGCCGGCCC	BDA1, HHG2	Brachydactyly, type A1; go_component: extracellular region; go_function: patched binding; go_function: peptidase activity; go_function: cholesterol binding; go_process: development; go_process: proteolysis; go_process: cell-cell signaling; go_process: intein-mediated protein splicing	Indian hedgehog homolog
IHH_P529_F	4947	0.1818426	3402.812	778.5302	0.009942952	31	201.6883	0.1162356	7963.038	1060.477	4.688838E-08	25	444.4944	0.1222481	10026.85	1410.408	4.807741E-14	41	534.0792	0.0319618	5747.428	193.065	0.00277804	23	193.8875	0.1394578	7416.472	1218.105	6.953682E-08	26	471.7007	0.1350089	8425.497	1330.67	1.670164E-11	24	526.5886	0.1457691	8648.677	1492.906	1.285028E-08	27	660.6434	0.1289005	11363.43	1696.295	3.708169E-10	19	676.0756	0.167411	6558.574	1338.858	1.377227E-06	27	399.0808	0.1536508	7945.148	1460.559	3.074007E-09	31	334.7919	IHH	IHH_P529_F	51467740	NM_002181.1	IHH	3549	2	36.1	219633962	-529	Y	ACCCATGTCCCTGCCTCCTGTGCGCTCGACAGCGAACCTGCAGCAAGGG	BDA1, HHG2	Brachydactyly, type A1; go_component: extracellular region; go_function: patched binding; go_function: peptidase activity; go_function: cholesterol binding; go_process: development; go_process: proteolysis; go_process: cell-cell signaling; go_process: intein-mediated protein splicing	Indian hedgehog homolog
IL10_P348_F	1164	0.6204215	2173.463	3715.977	5.833514E-05	23	214.287	0.8611149	1681.827	11047.68	3.970592E-16	25	777.7743	0.8840576	1925.861	15447.13	8.656047E-34	31	761.8848	0.1471185	4355.707	768.5909	0.01262405	23	250.6768	0.8278717	2032.612	10257.05	3.711251E-16	23	494.4099	0.8914682	1754.585	15233.36	1.030749E-36	24	917.472	0.8196732	2588.133	12218.88	9.611565E-19	19	695.1131	0.8390539	2709.214	14645.16	4.202171E-18	39	631.0497	0.8923808	1168.799	10520.91	1.079775E-14	22	1039.994	0.8737414	2232.757	16143.27	5.682426E-37	26	755.3434	IL10	IL10_P348_F	24430216	NM_000572.2	IL10	3586	1	36.1	205012810	-348	N	ATTCGCGTGTTCCTAGGTCACAGTGACGTGGACAAATTGCCCATTCCAGAATAC	CSIF, TGIF, IL-10, IL10A, MGC126450, MGC126451	cytokine synthesis inhibitory factor; go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-10 receptor binding; go_process: hemopoiesis; go_process: anti-apoptosis; go_process: cell-cell signaling; go_process: B cell proliferation; go_process: B cell differentiation; go_process: immune cell chemotaxis; go_process: T-helper 2 type immune response; go_process: regulation of isotype switching; go_process: cytoplasmic sequestering of NF-kappaB; go_process: negative regulation of T cell proliferation; go_process: negative regulation of MHC class II biosynthesis; go_process: negative regulation of nitric oxide biosynthesis; go_process: negative regulation of interferon-alpha biosynthesis; go_process: negative regulation of interferon-gamma biosynthesis	interleukin 10 precursor
IL10_P85_F	1170	0.1019478	4622.707	536.1263	0.0006848619	23	279.6481	0.5021476	7489.316	7654.791	4.388329E-23	31	864.8564	0.5529891	7650.665	9588.207	3.052284E-33	38	855.9191	0.2107483	4830.852	1316.651	0.001814934	33	237.3011	0.4092988	7870.072	5522.489	2.614936E-19	29	1007.396	0.5100857	8007.488	8441.3	2.643044E-34	33	872.944	0.409416	8923.676	6255.567	9.706746E-20	25	1058.223	0.4906038	9158.824	8917.253	1.093548E-19	49	536.4671	0.509789	5382.579	5701.542	3.769014E-13	24	744.1638	0.548026	7330.914	9010.106	6.424233E-29	32	566.4233	IL10	IL10_P85_F	24430216	NM_000572.2	IL10	3586	1	36.1	205012547	-85	N	AGCCACAATCAAGGTTTCCCGGCACAGGATTTTTTCTGCTTAGAGCTCCT	CSIF, TGIF, IL-10, IL10A, MGC126450, MGC126451	cytokine synthesis inhibitory factor; go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-10 receptor binding; go_process: hemopoiesis; go_process: anti-apoptosis; go_process: cell-cell signaling; go_process: B cell proliferation; go_process: B cell differentiation; go_process: immune cell chemotaxis; go_process: T-helper 2 type immune response; go_process: regulation of isotype switching; go_process: cytoplasmic sequestering of NF-kappaB; go_process: negative regulation of T cell proliferation; go_process: negative regulation of MHC class II biosynthesis; go_process: negative regulation of nitric oxide biosynthesis; go_process: negative regulation of interferon-alpha biosynthesis; go_process: negative regulation of interferon-gamma biosynthesis	interleukin 10 precursor
IL11_E232_F	721	0.2512317	1022.143	376.5087	0.561702	28	95.16567	0.1665396	2120.593	443.7125	0.2735057	23	134.8651	0.1587078	2614.646	512.1116	0.1620421	26	97.01488	0.200772	821.3101	231.4399	0.6674181	28	71.37615	0.1522859	2147.738	403.7902	0.2707495	30	197.4404	0.1841517	2515.581	590.3837	0.1273924	24	147.633	0.1693396	2535.51	537.2787	0.2330068	17	129.4651	0.1957464	3023.956	760.3364	0.1860782	31	143.8031	0.1743613	2217.579	489.4346	0.2590083	29	103.4722	0.1677098	2123.386	448.0209	0.2731614	30	73.22752	IL11	IL11_E232_F	24430217	NM_000641.2	IL11	3589	19	36.1	60573394	232	Y	CCTGTCTCCGGGTCCCTCTCTGTGCGACTCAGCGGGGTCTGCTCCCACC	AGIF, IL-11	adipogenesis inhibitory factor; oprelvekin; go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-11 receptor binding; go_process: platelet activation; go_process: cell-cell signaling; go_process: B cell differentiation; go_process: fat cell differentiation; go_process: megakaryocyte differentiation; go_process: positive regulation of cell proliferation	interleukin 11 precursor
IL11_P11_R	4188	0.1674421	1361.242	293.8815	0.4706498	34	50.06161	0.06049186	6426.947	420.2488	9.098747E-05	29	252.1127	0.1152284	7650.285	1009.36	6.206937E-08	31	410.5168	0.2063149	340.3463	114.466	0.795303	39	12.57799	0.1002411	6619.517	748.6133	8.645536E-06	23	433.806	0.1073498	7347.075	895.5827	3.702982E-08	28	342.645	0.1248698	6717.784	972.8101	4.998847E-05	19	436.8297	0.1312332	8371.16	1279.627	1.208745E-05	30	389.1582	0.1320969	5519.375	855.2825	0.0002303561	22	416.0151	0.1394058	6694.067	1100.556	2.271775E-06	25	371.9096	IL11	IL11_P11_R	24430217	NM_000641.2	IL11	3589	19	36.1	60573637	-11	Y	GAGGCATGTGCCCTGAGCAGCAGGGCCGCGGCAGTGAGGGAGTGTGGAC	AGIF, IL-11	adipogenesis inhibitory factor; oprelvekin; go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-11 receptor binding; go_process: platelet activation; go_process: cell-cell signaling; go_process: B cell differentiation; go_process: fat cell differentiation; go_process: megakaryocyte differentiation; go_process: positive regulation of cell proliferation	interleukin 11 precursor
IL12A_E287_R	657	0.05618295	8108.144	488.6093	1.817552E-10	27	292.8753	0.08623984	15600.62	1481.811	1.210856E-29	28	1283.184	0.06885436	19102.69	1419.959	3.678E-38	34	1515.038	0.02215614	9364.678	214.4522	1.241348E-07	28	497.9981	0.08265582	15935.49	1444.852	2.92017E-33	23	883.1102	0.07019745	17311.45	1314.515	3.678E-38	23	1217.45	0.06468393	14978.23	1042.77	4.291113E-22	33	827.7882	0.0782523	19757.73	1685.834	4.920137E-28	31	745.4984	0.08793702	10631.36	1034.67	1.245748E-14	26	799.5648	0.0834319	19852.36	1816.192	3.678E-38	36	1196.865	IL12A	IL12A_E287_R	24430218	NM_000882.2	IL12A	3592	3	36.1	161189610	287	Y	CACAGGTCTGCATCCAGCGGCTCGCCCTGTGTCCCTGCAGTGCCGGCTCAG	CLMF, NFSK, NKSF1, IL-12A	natural killer cell stimulatory factor 1, 35 kD subunit; cytotoxic lymphocyte maturation factor 1, p35; interleukin 12, p35; IL-12, subunit p35; NF cell stimulatory factor chain 1; interleukin-12 alpha chain precursor	interleukin 12A precursor
IL12B_E25_F	731	0.6630937	952.5259	2071.565	0.09756505	27	115.0963	0.9259517	953.2033	13170	5.593505E-20	25	584.8855	0.9320776	1081.838	16217.98	1.723829E-33	24	801.8478	0.2258405	451.8485	160.9872	0.7646433	32	25.94781	0.917366	988.532	12084.4	2.303477E-18	22	393.3015	0.9332433	955.1095	14750.18	4.015094E-31	35	633.8003	0.9288462	1000.411	14364.83	3.013529E-20	28	900.8681	0.9355088	1079.377	17108.04	6.137244E-20	37	592.3053	0.9195288	758.3412	9808.103	6.606408E-12	31	639.018	0.9287528	926.566	13381.95	6.552161E-22	33	644.9708	IL12B	IL12B_E25_F	24497437	NM_002187.2	IL12B	3593	5	36.1	158690034	25	N	GAAGTGCTTACCTTGCTCTGGGCAGGACGGAGAGTCCAATGGCCCTGAAACAGAT	CLMF, NKSF, CLMF2, NKSF2, IL-12B	natural killer cell stimulatory factor-2; cytotoxic lymphocyte maturation factor 2, p40; interleukin 12, p40; natural killer cell stimulatory factor, 40 kD subunit; interleukin-12 beta chain; IL12, subunit p40; go_component: membrane; go_component: extracellular space; go_function: cytokine activity; go_function: signal transducer activity; go_function: interleukin-12 receptor binding; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: T-helper cell differentiation; go_process: interferon-gamma biosynthesis; go_process: natural killer cell activation; go_process: regulation of cytokine biosynthesis; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: positive regulation of interferon-gamma biosynthesis; go_process: positive regulation of activated T cell proliferation	interleukin 12B precursor
IL12B_P1453_F	4190	0.4302277	7484.795	5727.18	1.420643E-25	37	454.0887	0.8365234	2353.647	12555.51	2.38945E-22	30	663.8325	0.8609055	2814.718	18040.23	3.678E-38	40	881.6504	0.5400005	3887.606	4681.112	3.454728E-06	47	335.7286	0.8281229	2527.421	12659.2	4.332038E-25	18	756.1944	0.8427877	2887.151	16013.6	3.678E-38	28	931.3873	0.8368197	3008.083	15938.84	2.173658E-31	30	814.6469	0.8320147	3443.683	17551.51	7.835285E-27	27	870.2643	0.8609476	1670.887	10964.51	2.715338E-17	40	1022.542	0.8306713	2967.305	15047.19	1.824131E-35	31	733.3745	IL12B	IL12B_P1453_F	24497437	NM_002187.2	IL12B	3593	5	36.1	158691512	-1453	Y	AGACCTTACATCCAGCTCAGAGCGCCTCCTCCCATCCCCTGTGTC	CLMF, NKSF, CLMF2, NKSF2, IL-12B	natural killer cell stimulatory factor-2; cytotoxic lymphocyte maturation factor 2, p40; interleukin 12, p40; natural killer cell stimulatory factor, 40 kD subunit; interleukin-12 beta chain; IL12, subunit p40; go_component: membrane; go_component: extracellular space; go_function: cytokine activity; go_function: signal transducer activity; go_function: interleukin-12 receptor binding; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: T-helper cell differentiation; go_process: interferon-gamma biosynthesis; go_process: natural killer cell activation; go_process: regulation of cytokine biosynthesis; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: positive regulation of interferon-gamma biosynthesis; go_process: positive regulation of activated T cell proliferation	interleukin 12B precursor
IL12B_P392_R	3938	0.008634173	34534.95	301.6487	3.678E-38	19	558.824	0.8701393	1501.865	10733.39	7.19775E-15	30	497.5326	0.8599227	1910.265	12340.85	2.901397E-22	38	572.1804	0.008170538	24234.14	200.4609	3.678E-38	34	1840.464	0.870829	1352.742	9793.921	3.269324E-13	25	716.8943	0.7547015	3640.544	11508.4	7.552647E-29	18	913.3677	0.8398631	2082.31	11445.46	1.557867E-15	25	681.2183	0.7835796	3260.825	12168.32	3.155147E-14	29	639.2976	0.8563179	1496.222	9513.174	5.754851E-13	24	490.5532	0.8453264	2329.337	13276.88	2.889524E-26	27	541.6268	IL12B	IL12B_P392_R	24497437	NM_002187.2	IL12B	3593	5	36.1	158690451	-392	N	GTCAGACGGGAGGCTGAGTTCATGTCGGGATGGAACAACTGTATGCCCAA	CLMF, NKSF, CLMF2, NKSF2, IL-12B	natural killer cell stimulatory factor-2; cytotoxic lymphocyte maturation factor 2, p40; interleukin 12, p40; natural killer cell stimulatory factor, 40 kD subunit; interleukin-12 beta chain; IL12, subunit p40; go_component: membrane; go_component: extracellular space; go_function: cytokine activity; go_function: signal transducer activity; go_function: interleukin-12 receptor binding; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: T-helper cell differentiation; go_process: interferon-gamma biosynthesis; go_process: natural killer cell activation; go_process: regulation of cytokine biosynthesis; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: positive regulation of interferon-gamma biosynthesis; go_process: positive regulation of activated T cell proliferation	interleukin 12B precursor
IL13_E75_R	4116	0.2619878	7334.398	2639.146	3.25419E-14	30	523.8306	0.9270386	1383.089	18843.95	3.678E-38	31	1367.971	0.9273112	1525.124	20732.14	3.678E-38	21	1295.093	0.06836416	7553.398	561.6122	1.340825E-05	25	389.4433	0.9282627	1307.455	18212.09	3.678E-38	24	800.4191	0.8897936	2037.641	17259.06	3.678E-38	33	1268.267	0.9239877	1376.727	17950.73	1.00286E-32	34	1091.073	0.9373724	1672.415	26528.47	3.678E-38	27	807.7245	0.892758	1340.708	11993.47	2.310996E-19	31	1233.741	0.9350752	1228.16	19128.75	3.678E-38	31	851.5818	IL13	IL13_E75_R	26787977	NM_002188.2	IL13	3596	5	36.1	132021839	75	N	GGCCTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTT	ALRH, P600, IL-13, MGC116786, MGC116788, MGC116789	go_component: extracellular space; go_component: soluble fraction; go_function: signal transducer activity; go_function: interleukin-13 receptor binding; go_process: cell motility; go_process: cell-cell signaling; go_process: signal transduction; go_process: inflammatory response; go_process: antimicrobial humoral response (sensu Vertebrata)	interleukin 13 precursor
IL16_P226_F	1171	0.2098189	1376.81	392.1413	0.4304467	31	109.5166	0.2310746	2671.409	832.8535	0.09826279	25	265.2811	0.4152994	2454.233	1814.213	0.03048507	28	116.8769	0.2057883	692.3702	205.3111	0.7035018	35	37.0003	0.3727845	1937.325	1210.881	0.1429233	25	105.419	0.3722727	2227.575	1380.365	0.06016271	20	168.4185	0.3040738	2031.524	931.3354	0.2566484	25	215.0778	0.2757158	2544.167	1006.565	0.2236684	27	142.2196	0.4095156	1828.751	1337.637	0.1576522	32	198.882	0.4301595	2478.505	1946.454	0.0218853	28	101.1485	IL16	IL16_P226_F	27262654	NM_004513.3	IL16	3603	15	36.1	79262029	-226	N	TCAAGGAGGGCAGGAGTTGGAAGCGACCGTTGTGAAACGTTAAAGATTT	LCF, IL-16, prIL-16, FLJ44234, HsT19289	isoform 1 precursor is encoded by transcript variant 1; lymphocyte chemoattractant factor; go_component: extracellular space; go_function: protein binding; go_function: cytokine activity; go_process: chemotaxis; go_process: sensory perception; go_process: immune response	interleukin 16 isoform 1 precursor
IL16_P93_R	1173	0.1597596	7747.792	1492.145	3.881732E-12	39	309.419	0.4321324	7254.525	5596.601	1.908102E-16	31	693.8064	0.7220476	4559.421	12103.96	6.024251E-31	23	649.1083	0.1074954	4648.876	571.9662	0.01069848	25	219.6781	0.746756	2986.113	9100.207	1.310265E-15	23	759.705	0.6366504	5063.963	9048.145	7.483721E-25	33	575.2905	0.4762591	6323.412	5841.073	1.786995E-12	31	654.1765	0.4877148	7845.334	7564.259	3.43372E-14	30	545.5826	0.6903058	2925.273	6743.309	6.50456E-10	39	469.6116	0.7289359	4352.188	11972.67	7.372882E-29	27	780.3875	IL16	IL16_P93_R	27262654	NM_004513.3	IL16	3603	15	36.1	79262162	-93	N	CTCATATTCAAATACTCCCAGCCGAGAAGCTGCCATCGATCCTCCCATG	LCF, IL-16, prIL-16, FLJ44234, HsT19289	isoform 1 precursor is encoded by transcript variant 1; lymphocyte chemoattractant factor; go_component: extracellular space; go_function: protein binding; go_function: cytokine activity; go_process: chemotaxis; go_process: sensory perception; go_process: immune response	interleukin 16 isoform 1 precursor
IL17RB_E164_R	3510	0.2686236	2056.787	792.1556	0.1273062	31	76.21448	0.2103764	6947.684	1877.688	1.033956E-07	27	539.5693	0.2087011	8429.497	2249.612	3.519635E-12	23	467.9321	0.1668244	1433.52	307.0525	0.4926906	43	47.64447	0.2330363	6894.491	2125.225	1.339684E-08	23	497.255	0.4578469	5040.474	4341.117	1.295601E-10	26	591.7536	0.2028306	8082.607	2081.971	1.173917E-08	26	402.6703	0.1945165	8778.476	2144.067	3.82434E-07	29	502.3838	0.2151894	6069.61	1691.662	2.299308E-06	24	524.3403	0.1455348	7932.461	1368.11	4.946366E-09	34	293.9434	IL17RB	IL17RB_E164_R	27501455	NM_018397.1	CHDH	55349	3	36.1	53855776	-560	Y	TCGAGCCCAGATCCTGACGTCGTCTGATCCGCCAGTCCAGGCTGCC	.	go_component: mitochondrion; go_function: FAD binding; go_function: choline dehydrogenase activity; go_process: electron transport	choline dehydrogenase
IL17RB_P788_R	1182	0.06336538	2328.303	164.28	0.2057839	38	88.18697	0.08721816	7552.774	731.2381	8.083437E-07	25	345.888	0.08484866	8857.814	830.5277	5.758404E-10	28	371.5118	0.05720353	2421.664	153.0002	0.2859101	29	100.216	0.07362341	6791.284	547.6821	9.558798E-06	26	419.7676	0.1585237	7063.098	1349.439	1.682452E-08	32	560.7813	0.0758848	8182.495	680.1267	1.346247E-06	22	309.8621	0.04112707	9589.376	415.5875	4.858474E-06	33	319.306	0.1012355	6619.159	756.8364	9.247466E-06	28	361.4022	0.06043964	7461.121	486.3886	1.292205E-06	29	350.3618	IL17RB	IL17RB_P788_R	27501455	NM_018397.1	CHDH	55349	3	36.1	53854824	392	Y	CAGCTCCAAATCGCCAGTGCTGACGGCTTCCGCTTTGGGAGCCCCAG	.	go_component: mitochondrion; go_function: FAD binding; go_function: choline dehydrogenase activity; go_process: electron transport	choline dehydrogenase
IL18BP_E285_F	4211	0.1202892	2051.204	294.1496	0.2451842	19	147.0242	0.7990978	2736.61	11282.75	1.122232E-19	21	818.8345	0.8643041	2183.129	14542.2	3.443059E-31	40	794.7204	0.1425536	4161.989	708.5709	0.01917153	26	222.0493	0.8561334	1998.426	12487.49	9.793388E-23	23	715.6582	0.8317719	2482.961	12770.97	2.856868E-29	28	1027.924	0.8747351	1671.465	12370.28	8.757776E-17	34	710.9825	0.8567859	2298.616	14349.85	1.27006E-16	32	821.0014	0.8291993	1890.115	9661.563	2.473715E-14	27	624.2601	0.8717595	1779.524	12776.73	1.040866E-22	31	706.5074	IL18BP	IL18BP_E285_F	27502394	NM_005699.2	IL18BP	10068	11	36.1	71387872	285	N	TGGGAAAGGCCAGGATGTGGACGGACTGGTATGGCATTGAGCCTG	IL18BPa	isoform C precursor is encoded by transcript variant C; MC51L-53L-54L homolog gene product; go_component: extracellular region; go_function: interleukin-18 binding; go_function: receptor antagonist activity; go_process: T-helper 1 type immune response	interleukin 18 binding protein isoform C precursor
IL18BP_P51_R	4209	0.1138527	4222.792	555.3949	0.002110098	32	171.0256	0.1447887	9142.751	1564.814	2.466784E-11	26	491.8683	0.1735474	9796.831	2078.243	3.448825E-15	30	609.6405	0.336463	3288.457	1718.202	0.01536969	30	199.2949	0.168566	7125.901	1464.988	8.337439E-08	28	468.846	0.1485277	9061.04	1598.018	8.142717E-14	35	690.1914	0.1557848	9072.558	1692.631	1.015505E-09	36	432.7304	0.211843	10680.98	2897.741	5.539181E-11	31	563.6835	0.1476724	8034.992	1409.451	1.898713E-09	27	544.5936	0.1822444	9915.583	2232.066	1.369878E-15	34	370.894	IL18BP	IL18BP_P51_R	27502394	NM_005699.2	IL18BP	10068	11	36.1	71387536	-51	N	CTTCCCTCCTGTTAGGGTTGGCTCTCGAGCTTGTGTGCCAGTTCCTGGGTTGGCCGT	IL18BPa	isoform C precursor is encoded by transcript variant C; MC51L-53L-54L homolog gene product; go_component: extracellular region; go_function: interleukin-18 binding; go_function: receptor antagonist activity; go_process: T-helper 1 type immune response	interleukin 18 binding protein isoform C precursor
IL1A_E113_R	674	0.6869549	1140.603	2722.414	0.02045883	25	130.5785	0.9724312	519.8902	21865.3	3.678E-38	23	1454.279	0.9688865	643.3193	23147.27	3.678E-38	37	916.2841	0.7463846	1022.674	3304.005	0.04322255	21	185.2501	0.9660282	528.1433	17861.96	1.975298E-37	25	1569.741	0.9678053	617.0526	21555.29	3.678E-38	29	1436.286	0.9662473	621.2151	20646.43	3.678E-38	35	1053.27	0.9740575	586.0826	25760.2	3.678E-38	32	768.9642	0.9327717	748.2043	11768.58	5.923804E-17	29	921.902	0.9748526	501.4863	23316.92	3.678E-38	34	1250.778	IL1A	IL1A_E113_R	27894329	NM_000575.3	IL1A	3552	2	36.1	113259329	113	N	TTCTGTAGAAGAAGGTGTGTGCAAGCCCCGGGAGGTATGCGTAAGGCCTCAG	IL1, IL-1A, IL1F1, IL1-ALPHA	preinterleukin 1 alpha; hematopoietin-1; IL1A (IL1F1); pro-interleukin-1-alpha; go_component: cytoplasm; go_component: extracellular space; go_function: interleukin-1 receptor binding; go_function: signal transducer activity; go_function: signal transducer activity; go_process: fever; go_process: chemotaxis; go_process: apoptosis; go_process: anti-apoptosis; go_process: cell-cell signaling; go_process: cell proliferation; go_process: regulation of progression through cell cycle; go_process: negative regulation of cell proliferation	interleukin 1, alpha proprotein
IL1B_P582_R	3947	0.1997366	7279.821	1841.919	8.063331E-12	28	404.0088	0.9362385	1164.47	18566.78	3.678E-38	29	1213.372	0.9344887	1403.201	21442.48	3.678E-38	23	1390.173	0.2078716	2546.025	694.3739	0.1581709	28	96.94981	0.9334731	1182.435	17994.5	3.678E-38	22	895.784	0.934991	1145.137	17908.16	3.678E-38	25	1067.3	0.9326224	1218.004	18243.46	3.340651E-33	26	1503.172	0.9296325	1489.951	21005.01	5.804968E-31	23	1187.393	0.9135911	1007.726	11711.86	1.552887E-17	20	692.9456	0.9367301	1184.351	19015.21	3.678E-38	30	736.1959	IL1B	IL1B_P582_R	27894305	NM_000576.2	IL1B	3553	2	36.1	113311409	-582	N	TTCTTGGCTGGGGCAGAGAACATACGGTATGCAGGGTTCAGGCTCCTG	IL-1, IL1F2, IL1-BETA	preinterleukin 1 beta; catabolin; pro-interleukin-1-beta; go_component: extracellular space; go_function: signal transducer activity; go_function: interleukin-1 receptor binding; go_process: fever; go_process: apoptosis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: regulation of progression through cell cycle; go_process: negative regulation of cell proliferation; go_process: antimicrobial humoral response (sensu Vertebrata)	interleukin 1, beta proprotein
IL1B_P829_F	3958	0.2767338	2407.612	959.4547	0.05461262	31	137.9438	0.741591	1924.573	5810.19	5.575411E-06	22	371.1861	0.7857886	1768.436	6853.957	7.268061E-08	25	381.6431	0.1468164	1101.859	206.8166	0.6044732	37	41.84342	0.7773331	1599.981	5934.654	4.828749E-06	22	367.6393	0.6917068	2297.608	5379.43	4.462311E-07	25	365.3324	0.7767002	1865.826	6837.701	2.279998E-06	31	287.1051	0.7646347	1998.099	6816.126	8.92785E-05	38	246.5033	0.7486833	1627.178	5145.336	6.880575E-05	30	356.9078	0.8058407	1574.853	6951.328	1.356363E-07	20	323.1646	IL1B	IL1B_P829_F	27894305	NM_000576.2	IL1B	3553	2	36.1	113311656	-829	N	CAAGAGTTATCAGTTTCTCTTTAACCGAGACACCAGCAAAGTGCCTGCTCCA	IL-1, IL1F2, IL1-BETA	preinterleukin 1 beta; catabolin; pro-interleukin-1-beta; go_component: extracellular space; go_function: signal transducer activity; go_function: interleukin-1 receptor binding; go_process: fever; go_process: apoptosis; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: regulation of progression through cell cycle; go_process: negative regulation of cell proliferation; go_process: antimicrobial humoral response (sensu Vertebrata)	interleukin 1, beta proprotein
IL1RN_E42_F	745	0.4713403	2307.942	2146.863	0.005047195	37	180.6686	0.9224072	1228.682	15795.08	1.969713E-29	34	981.8687	0.937458	1185.423	19267.55	3.678E-38	31	843.0234	0.4486152	1194.751	1053.429	0.3627028	35	91.98947	0.9396741	1188.891	20076.61	3.678E-38	23	974.1786	0.9412882	1322.819	22811.12	3.678E-38	17	1095.812	0.9370567	1165.421	18838.71	3.575323E-35	26	1226.065	0.9395479	1317.962	22037.99	1.78459E-33	23	615.9141	0.9123453	1103.235	12523.75	2.875172E-20	32	1403.054	0.9484712	1210.342	24118.96	3.678E-38	26	628.6249	IL1RN	IL1RN_E42_F	27894320	NM_173843.1	IL1RN	3557	2	36.1	113591983	42	N	GAGGGACTGTGGCCCAGGTACTGCCCGGGTGCTACTTTATGGGCAGCAGCT	IRAP, IL1F3, IL1RA, IL-1ra3, ICIL-1RA, MGC10430	isoform 4 is encoded by transcript variant 4; intracellular IL-1 receptor antagonist type II; IL1RN (IL1F3); intracellular interleukin-1 receptor antagonist (icIL-1ra); type II interleukin-1 receptor antagonist; go_component: intracellular; go_component: extracellular space; go_function: interleukin-1 receptor antagonist activity; go_process: inflammatory response	interleukin 1 receptor antagonist isoform 4
IL1RN_P93_R	4198	0.2310688	5232.282	1602.385	1.322865E-06	29	261.5858	0.8954351	1323.985	12194.21	2.981794E-18	31	666.9153	0.9187981	1302.802	15872.68	5.516614E-33	18	1204.463	0.6968516	1399.677	3447.33	0.01990471	27	224.7152	0.8935714	1237.743	11231.66	1.19307E-16	26	825.524	0.901906	1403.262	13821.45	3.747197E-29	25	792.0057	0.9036453	1231.224	12484.65	5.510132E-16	29	758.9385	0.8837362	1751.263	14071.69	5.595407E-15	25	751.1952	0.8557789	1668.898	10496.29	5.693058E-16	35	533.7352	0.9167097	1193.394	14235.34	1.206098E-25	31	440.5052	IL1RN	IL1RN_P93_R	27894320	NM_173843.1	IL1RN	3557	2	36.1	113591848	-93	N	CATCAAGTCAGCCATCAGCCGGCCCATCTCCTCATGCTGGCCAAC	IRAP, IL1F3, IL1RA, IL-1ra3, ICIL-1RA, MGC10430	isoform 4 is encoded by transcript variant 4; intracellular IL-1 receptor antagonist type II; IL1RN (IL1F3); intracellular interleukin-1 receptor antagonist (icIL-1ra); type II interleukin-1 receptor antagonist; go_component: intracellular; go_component: extracellular space; go_function: interleukin-1 receptor antagonist activity; go_process: inflammatory response	interleukin 1 receptor antagonist isoform 4
IL2_P607_R	4205	0.387511	1850.446	1234.013	0.08859868	42	87.71922	0.8647611	1191.13	8255.901	8.075467E-09	38	248.3894	0.8727716	1211.78	8998.652	4.218326E-11	27	325.6943	0.7707596	380.775	1616.477	0.4259599	27	78.68691	0.8725362	1054.249	7901.25	1.773372E-08	32	290.6613	0.8540571	1301.7	8202.737	6.685903E-11	32	385.1841	0.8900482	979.9229	8741.862	6.420411E-08	30	365.959	0.8895628	1090.952	9593.024	7.594406E-07	25	383.9513	0.8552032	1164.916	7470.887	7.077868E-08	31	422.4053	0.8875	1094.542	9423.607	1.364954E-11	29	344.4984	IL2	IL2_P607_R	28178860	NM_000586.2	IL2	3558	4	36.1	123597937	-607	N	CACCTGGGACACTATGAATGTAACAATAATCGTTATGAAATATGATCTTGTTTTTAGTC	IL-2, TCGF, lymphokine	T cell growth factor; aldesleukin; interleukin-2; involved in regulation of T-cell clonal expansion; go_component: extracellular space; go_function: cytokine activity; go_function: kinase activator activity; go_function: kinase activator activity; go_function: interleukin-2 receptor binding; go_function: interleukin-2 receptor binding; go_process: cell adhesion; go_process: anti-apoptosis; go_process: immune response; go_process: anti-apoptosis; go_process: cell-cell signaling; go_process: immune response; go_process: T cell differentiation; go_process: cell-cell signaling; go_process: T cell differentiation; go_process: natural killer cell activation; go_process: natural killer cell activation; go_process: positive regulation of cell growth; go_process: positive regulation of cell growth; go_process: positive regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: antimicrobial humoral response (sensu Vertebrata)	interleukin 2 precursor
IL3_E43_F	691	0.6042245	881.6994	1498.746	0.2354407	32	99.26112	0.9413773	747.653	13611.82	1.123085E-20	26	963.5715	0.9419233	804.3951	14668.03	1.802282E-26	43	642.491	0.8184504	535.7299	2865.957	0.133977	25	139.871	0.9392748	707.2917	12486.89	1.016138E-18	41	789.6461	0.9418879	773.5626	14158.81	5.480987E-28	29	691.0212	0.931948	899.0306	13681.38	3.761065E-18	23	1009.299	0.9397218	933.3713	16109.98	1.923883E-17	25	486.8028	0.9152299	897.9784	10774.78	1.196199E-14	26	706.5043	0.9357667	783.5741	12872.13	7.054843E-20	30	523.3077	IL3	IL3_E43_F	28416914	NM_000588.3	IL3	3562	5	36.1	131424289	43	N	AGGACCAGAACAAGACAGAGTGCCTCCTGCCGATCCAAACATGAGCCGCCTGCCCGT	IL-3, MCGF, MGC79398, MGC79399, MULTI-CSF	multilineage-colony-stimulating factor; hematopoietic growth factor; P-cell stimulating factor; mast-cell growth factor; go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-3 receptor binding; go_process: immune response; go_process: cell-cell signaling; go_process: nervous system development; go_process: positive regulation of cell proliferation; go_process: positive regulation of survival gene product activity; go_process: positive regulation of peptidyl-tyrosine phosphorylation	interleukin 3 precursor
IL3_P556_F	4217	0.5628613	1837.656	2494.933	0.00687954	31	189.5265	0.9574449	516.8836	13879.23	8.731859E-21	34	762.4698	0.9607837	627.4091	17821.2	3.678E-38	37	849.9743	0.2860078	380.8284	192.6081	0.7725163	31	21.17332	0.9573992	498.5152	13450.89	5.127742E-21	24	631.4095	0.9555395	596.458	14968.19	1.539133E-30	33	717.2059	0.953144	532.291	12862.05	3.224159E-15	30	1068.913	0.9598278	586.6506	16406.03	2.457844E-17	30	707.594	0.946211	530.7908	11096.34	1.574564E-14	31	493.2277	0.954483	525.3635	13113.75	7.91982E-20	34	355.5364	IL3	IL3_P556_F	28416914	NM_000588.3	IL3	3562	5	36.1	131423690	-556	N	CCAGAAACAAAGTGTCAAGGAGAAGCTGCCCGAAGCCCATGGGACAAACCACTGG	IL-3, MCGF, MGC79398, MGC79399, MULTI-CSF	multilineage-colony-stimulating factor; hematopoietic growth factor; P-cell stimulating factor; mast-cell growth factor; go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-3 receptor binding; go_process: immune response; go_process: cell-cell signaling; go_process: nervous system development; go_process: positive regulation of cell proliferation; go_process: positive regulation of survival gene product activity; go_process: positive regulation of peptidyl-tyrosine phosphorylation	interleukin 3 precursor
IL4_P262_R	3975	0.2840171	5665.662	2287.131	6.192865E-09	31	208.5014	0.8185698	2723.297	12738.04	4.24921E-24	37	487.3749	0.826618	2741.293	13546.18	1.708253E-29	29	538.4675	0.6897067	1026.836	2504.683	0.1164466	26	226.2971	0.8178872	2322.003	10877.47	9.803275E-19	20	692.625	0.8309979	2623.753	13392.93	1.954263E-32	25	449.2758	0.8101451	2784.99	12310.77	1.632334E-19	25	513.8392	0.819382	3010.973	14113.07	1.300293E-17	22	704.9987	0.7788495	2225.994	8191.706	1.460601E-11	19	854.3328	0.8348484	2577.229	13533.51	4.505951E-28	24	698.4949	IL4	IL4_P262_R	27477090	NM_000589.2	IL4	3565	5	36.1	132037010	-262	N	CCCAAACTAGGCCTCACCTGATACGACCTGTCCTTCTCAAAACACCTAAA	BSF1, IL-4, MGC79402	isoform 1 precursor is encoded by transcript variant 1; B_cell stimulatory factor 1; lymphocyte stimulatory factor 1; go_component: extracellular space; go_function: protein binding; go_function: interleukin-4 receptor binding; go_process: chemotaxis; go_process: cell proliferation; go_process: B cell differentiation; go_process: cholesterol metabolism; go_process: cellular defense response; go_process: T-helper 2 type immune response; go_process: regulation of isotype switching; go_process: connective tissue growth factor biosynthesis	interleukin 4 isoform 1 precursor
IL6_E168_F	4118	0.1910611	6615.391	1586.09	1.646938E-09	27	486.5428	0.247435	8756.768	2912.006	1.699792E-13	20	608.0416	0.3074737	8781.238	3943.167	1.501748E-17	29	589.0541	0.1049846	4214.565	506.0949	0.02425608	25	247.5664	0.2890915	7084.506	2921.585	1.342194E-10	38	534.2542	0.3078603	8017.786	3610.75	1.458988E-16	22	420.6927	0.2062621	9381.938	2463.993	8.194146E-12	31	732.3704	0.233838	10185.66	3139.255	1.41856E-10	25	559.9617	0.2575168	5755.841	2030.992	2.090105E-06	38	448.9407	0.2029161	10019.25	2576.089	8.370092E-17	26	750.1678	IL6	IL6_E168_F	10834983	NM_000600.1	IL6	3569	7	36.1	22733513	168	N	GTGTGGCCCAGGGAGGGCTGGCGGGCGGCCAGCAGCAGAGGCAGGC	HGF, HSF, BSF2, IL-6, IFNB2	go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-6 receptor binding; go_process: acute-phase response; go_process: neutrophil apoptosis; go_process: cell-cell signaling; go_process: humoral immune response; go_process: negative regulation of cell proliferation; go_process: negative regulation of chemokine biosynthesis; go_process: positive regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	interleukin 6 (interferon, beta 2)
IL6_P213_R	2717	0.04741766	4273.731	217.7157	0.004589908	23	174.8122	0.1110174	8465.53	1069.675	5.53362E-09	33	451.5944	0.1813052	10181.06	2276.807	8.662403E-17	20	687.1617	0.05002219	2976.548	161.9992	0.1748418	23	122.8878	0.1659415	7689.086	1549.69	5.056407E-09	30	427.9932	0.1695688	8260.32	1707.124	5.04635E-12	34	400.7931	0.1101624	8592.77	1076.169	7.817103E-08	26	503.3907	0.1072701	11143.93	1351.067	2.665763E-09	30	555.4764	0.1608562	6636.155	1291.259	1.228456E-06	27	405.53	0.1219119	10896.92	1526.789	2.477587E-16	16	676.7152	IL6	IL6_P213_R	10834983	NM_000600.1	IL6	3569	7	36.1	22733132	-213	N	TCTGCTTCTTAGCGCTAGCCTCAATGACGACCTAAGCTGCACTTTTCCCCCTAG	HGF, HSF, BSF2, IL-6, IFNB2	go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-6 receptor binding; go_process: acute-phase response; go_process: neutrophil apoptosis; go_process: cell-cell signaling; go_process: humoral immune response; go_process: negative regulation of cell proliferation; go_process: negative regulation of chemokine biosynthesis; go_process: positive regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	interleukin 6 (interferon, beta 2)
IL6_P611_F	2721	0.0454856	5020.469	244.0064	0.0004916823	35	145.5946	0.1123514	11108.74	1418.712	1.318417E-15	30	1013.627	0.1404931	13530.25	2227.972	1.642036E-27	28	863.3115	0.06159576	6579.03	438.4037	0.0002514804	32	382.976	0.1112619	10764.5	1360.135	1.034973E-15	41	790.2104	0.141378	11920.42	1979.244	4.507509E-24	28	1124.969	0.1339499	12588.29	1962.468	4.488096E-18	32	989.1321	0.128253	13578.01	2012.335	1.563526E-14	26	610.0008	0.1262985	8910.012	1302.449	4.271717E-11	33	481.9782	0.1313031	13248.69	2017.649	4.387928E-25	27	650.6228	IL6	IL6_P611_F	10834983	NM_000600.1	IL6	3569	7	36.1	22732734	-611	N	ACCTGGAGACGCCTTGAAGTAACTGCACGAAATTTGAGGATGGCCAGGCAG	HGF, HSF, BSF2, IL-6, IFNB2	go_component: extracellular space; go_function: cytokine activity; go_function: interleukin-6 receptor binding; go_process: acute-phase response; go_process: neutrophil apoptosis; go_process: cell-cell signaling; go_process: humoral immune response; go_process: negative regulation of cell proliferation; go_process: negative regulation of chemokine biosynthesis; go_process: positive regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	interleukin 6 (interferon, beta 2)
IL8_E118_R	754	0.1059418	3810.833	463.4156	0.007945288	29	104.4763	0.3522075	6006.309	3320.027	1.3459E-08	34	342.4822	0.3436041	5813.473	3095.531	2.113356E-08	22	391.9568	0.04140168	3768.191	167.0664	0.07245668	33	131.366	0.3809018	4939.719	3100.701	7.479676E-07	30	345.39	0.375043	5554.788	3393.495	1.233142E-09	27	393.9624	0.3509674	5475.524	3014.991	4.53452E-06	20	435.0769	0.3106669	5948.223	2725.798	0.0001222316	26	459.7935	0.3449389	5677.33	3042.198	4.954068E-08	36	333.291	0.4736783	3006.954	2796.193	0.001081522	26	159.5525	IL8	IL8_E118_R	28610153	NM_000584.2	IL8	3576	4	36.1	74825257	118	N	GTGTAAACATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCT	K60, NAF, GCP1, IL-8, LECT, LUCT, NAP1, 3-10C, CXCL8, GCP-1, LYNAP, MDNCF, MONAP, NAP-1, SCYB8, TSG-1, AMCF-I, b-ENAP	monocyte derived neutrophil-activating protein; monocyte-derived neutrophil chemotactic factor; neutrophil-activating factor; neutrophil-activating peptide 1; neutrophil-activating protein 1; lymphocyte-derived neutrophil-activating factor; T cell chemotactic factor; granulocyte chemotactic protein 1; beta-thromboglobulin-like protein; protein 3-10C; emoctakin; CXC chemokine ligand 8; LUCT/interleukin-8; small inducible cytokine subfamily B, member 8; chemokine (C-X-C motif) ligand 8; go_component: extracellular space; go_function: protein binding; go_function: chemokine activity; go_function: interleukin-8 receptor binding; go_process: chemotaxis; go_process: angiogenesis; go_process: cell motility; go_process: sensory perception; go_process: cell cycle arrest; go_process: cell-cell signaling; go_process: neutrophil activation; go_process: neutrophil chemotaxis; go_process: calcium-mediated signaling; go_process: regulation of cell adhesion; go_process: intracellular signaling cascade; go_process: induction of positive chemotaxis; go_process: negative regulation of cell proliferation; go_process: regulation of retroviral genome replication; go_process: G-protein coupled receptor protein signaling pathway	interleukin 8 precursor
IL8_P83_F	4225	0.06475428	2163.551	156.7231	0.2522781	31	103.7423	0.3979859	3204.854	2184.808	0.003746823	25	270.2253	0.4228	3493.465	2632.22	0.0004539787	21	229.0703	0.05424264	2028.504	122.0775	0.3869672	30	106.4857	0.4448113	3371.332	2781.194	0.0003800846	26	206.5783	0.3998815	3269.426	2245.175	0.0008794472	39	207.1582	0.4526592	3255.359	2774.933	0.002944079	24	286.2526	0.3577408	3673.11	2101.636	0.02157222	30	206.7803	0.4006974	3333.602	2295.727	0.00173777	21	197.6157	0.466487	3042.793	2747.959	0.001116206	33	169.9541	IL8	IL8_P83_F	28610153	NM_000584.2	IL8	3576	4	36.1	74825056	-83	N	AGGGGATGGGCCATCAGTTGCAAATCGTGGAATTTCCTCTGACATAATGAAA	K60, NAF, GCP1, IL-8, LECT, LUCT, NAP1, 3-10C, CXCL8, GCP-1, LYNAP, MDNCF, MONAP, NAP-1, SCYB8, TSG-1, AMCF-I, b-ENAP	monocyte derived neutrophil-activating protein; monocyte-derived neutrophil chemotactic factor; neutrophil-activating factor; neutrophil-activating peptide 1; neutrophil-activating protein 1; lymphocyte-derived neutrophil-activating factor; T cell chemotactic factor; granulocyte chemotactic protein 1; beta-thromboglobulin-like protein; protein 3-10C; emoctakin; CXC chemokine ligand 8; LUCT/interleukin-8; small inducible cytokine subfamily B, member 8; chemokine (C-X-C motif) ligand 8; go_component: extracellular space; go_function: protein binding; go_function: chemokine activity; go_function: interleukin-8 receptor binding; go_process: chemotaxis; go_process: angiogenesis; go_process: cell motility; go_process: sensory perception; go_process: cell cycle arrest; go_process: cell-cell signaling; go_process: neutrophil activation; go_process: neutrophil chemotaxis; go_process: calcium-mediated signaling; go_process: regulation of cell adhesion; go_process: intracellular signaling cascade; go_process: induction of positive chemotaxis; go_process: negative regulation of cell proliferation; go_process: regulation of retroviral genome replication; go_process: G-protein coupled receptor protein signaling pathway	interleukin 8 precursor
IMPACT_P186_F	1190	0.09602579	1548.265	175.089	0.4464887	27	67.32049	0.0419737	4990.021	223.0075	0.005470934	38	193.8177	0.04649793	5133.914	255.234	0.003025537	26	206.0936	0.06148125	2077.816	142.6661	0.3695378	21	228.4319	0.05191652	4383.426	245.5099	0.01387833	19	220.4916	0.06648269	4467.951	325.3176	0.005663835	35	225.0491	0.04682107	4527.147	227.2899	0.03002762	25	233.4904	0.05844776	5881.798	371.3259	0.01089938	29	175.5564	0.09259732	3909.146	409.1195	0.02863754	29	258.4811	0.04399201	5176.896	242.8236	0.002763489	20	324.648	IMPACT	IMPACT_P186_F	8923818	NM_018439.1	IMPACT	55364	18	36.1	20260494	-186	Y	CTCCGCCCTACGGGAGACAGTGAAGGCGGGAGCAAGGCCCCAACCGAGAA	MGC33718	imprinted and ancient; go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown	Impact homolog
IMPACT_P234_R	1191	0.06876092	2094.51	162.0385	0.2707793	17	97.60291	0.1131488	6589.856	853.5241	1.458004E-05	28	396.6774	0.1103941	7241.192	910.9921	4.968956E-07	26	332.4674	0.04973915	2493.213	135.7356	0.2739278	29	93.54573	0.07984865	6370.903	561.5303	3.687961E-05	30	379.4163	0.1781213	6236.635	1373.304	5.91177E-07	33	314.5983	0.08985038	6800.968	681.2667	8.912355E-05	33	321.2309	0.1108691	7606.603	960.966	0.0001545383	24	404.389	0.09638505	5844.271	634.052	0.0001696139	24	231.6146	0.08784193	7542.232	735.9562	3.646743E-07	22	441.1596	IMPACT	IMPACT_P234_R	8923818	NM_018439.1	IMPACT	55364	18	36.1	20260446	-234	Y	CGTGAGGGCCTCTGGCTGCAACTCGCGAGGGTCGGCTTTCCCTGGGTCTCCG	MGC33718	imprinted and ancient; go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown	Impact homolog
INHA_P1144_R	5800	0.03109728	12873.04	416.3743	6.869245E-26	22	620.7219	0.04960616	12191.36	641.552	2.130526E-16	41	697.9428	0.0497414	16448.87	866.2526	1.492919E-33	32	820.403	0.05658077	7280.833	442.6592	4.036894E-05	26	397.8509	0.05084177	13581.09	732.829	3.547339E-22	28	884.5536	0.07310624	12744.18	1013.05	1.476895E-23	29	1094.779	0.04486424	13256.1	627.3572	2.153001E-16	29	1025.166	0.0526293	18122.02	1012.288	3.846582E-22	32	537.1389	0.05212165	7317.953	407.8962	2.622618E-06	19	520.573	0.04987723	14497.95	766.3278	4.460028E-25	28	665.4946	INHA	INHA_P1144_R	9257223	NM_002191.2	INHA	3623	2	36.1	220144054	.	Y	CGAGGCCGCCAGCTGCTGCCCGCCCTTCTCCCACACCACTACA	.	A-inhibin subunit precursor; go_component: extracellular region; go_function: protein binding; go_function: protein binding; go_function: hormone activity; go_function: cytokine activity; go_function: growth factor activity; go_function: activin inhibitor activity; go_process: cell cycle arrest; go_process: cell-cell signaling; go_process: cell differentiation; go_process: skeletal development; go_process: induction of apoptosis; go_process: hemoglobin biosynthesis; go_process: nervous system development; go_process: erythrocyte differentiation; go_process: ovarian follicle development; go_process: response to external stimulus; go_process: negative regulation of phosphorylation; go_process: negative regulation of B cell differentiation; go_process: cell surface receptor linked signal transduction; go_process: negative regulation of macrophage differentiation; go_process: negative regulation of interferon-gamma biosynthesis; go_process: negative regulation of follicle-stimulating hormone secretion; go_process: positive regulation of follicle-stimulating hormone secretion	inhibin alpha subunit precursor
INHA_P1189_F	5715	0.08255281	8023.559	730.9659	7.289336E-11	35	346.8878	0.08531081	12629.52	1187.251	4.293709E-19	26	1003.649	0.05320463	20523.13	1158.905	3.678E-38	25	842.4796	0.06682366	7942.593	575.9206	4.03087E-06	30	583.4871	0.0768975	13213.47	1109.056	3.327319E-22	28	1150.166	0.08630676	16886.49	1604.531	3.678E-38	21	748.058	0.09008498	14080.45	1403.917	1.412846E-20	27	934.978	0.07646144	20842.69	1733.883	3.389072E-31	35	1174.184	0.08017562	9762.065	859.6175	4.903993E-12	24	711.0205	0.08095668	14022.65	1244.036	4.375981E-25	36	639.1083	INHA	INHA_P1189_F	9257223	NM_002191.2	INHA	3623	2	36.1	220144009	.	Y	GGTCAGCAGCAGGCCGTGCTCCGCGCCGTCCGCCGGGAAGCTCAGGC	.	A-inhibin subunit precursor; go_component: extracellular region; go_function: protein binding; go_function: protein binding; go_function: hormone activity; go_function: cytokine activity; go_function: growth factor activity; go_function: activin inhibitor activity; go_process: cell cycle arrest; go_process: cell-cell signaling; go_process: cell differentiation; go_process: skeletal development; go_process: induction of apoptosis; go_process: hemoglobin biosynthesis; go_process: nervous system development; go_process: erythrocyte differentiation; go_process: ovarian follicle development; go_process: response to external stimulus; go_process: negative regulation of phosphorylation; go_process: negative regulation of B cell differentiation; go_process: cell surface receptor linked signal transduction; go_process: negative regulation of macrophage differentiation; go_process: negative regulation of interferon-gamma biosynthesis; go_process: negative regulation of follicle-stimulating hormone secretion; go_process: positive regulation of follicle-stimulating hormone secretion	inhibin alpha subunit precursor
INS_P248_F	1219	0.2345389	1906.459	614.7834	0.1985759	37	92.31361	0.8485992	1230.916	7459.765	1.749387E-07	27	293.0939	0.8287426	1892.241	9640.779	2.728266E-14	30	426.6509	0.2348243	606.3573	216.7736	0.7201859	20	43.7955	0.8267686	1444.645	7372.014	3.225894E-08	27	477.4919	0.8246397	1708.957	8506.7	1.190611E-12	21	324.0015	0.8381776	1469.479	8129.295	1.013193E-07	24	278.3038	0.8626242	1598.671	10666.47	5.781793E-09	27	681.511	0.8412746	1190.997	6842.524	8.16268E-07	34	353.3851	0.8086562	1434.437	6484.83	1.43557E-06	36	210.9791	INS	INS_P248_F	4557670	NM_000207.1	INS	3630	11	36.1	2139248	-248	N	CATTAGAGTCTTAACCAGGGGCCCGGTGGCCAGACCTGTCCCTGCTCACA	.	proinsulin; go_component: extracellular region; go_function: protein binding; go_function: hormone activity; go_function: insulin receptor binding; go_function: insulin-like growth factor binding; go_process: cell death; go_process: glucose transport; go_process: glucose transport; go_process: physiological process; go_process: cell-cell signaling; go_process: glucose metabolism; go_process: carbohydrate metabolism; go_process: acute-phase response; go_process: alpha-beta T cell activation; go_process: regulation of protein secretion; go_process: negative regulation of vasodilation; go_process: positive regulation of vasodilation; go_process: negative regulation of protein catabolism; go_process: positive regulation of cytokine secretion; go_process: generation of precursor metabolites and energy; go_process: cell surface receptor linked signal transduction; go_process: positive regulation of nitric oxide biosynthesis; go_process: positive regulation of nitric-oxide synthase activity	proinsulin precursor
INS_P804_R	1203	0.3640546	923.2581	585.7764	0.5226318	35	41.58469	0.9139559	765.2569	9190.708	8.616111E-10	32	682.3462	0.9275898	833.9052	11963.53	9.223068E-18	26	579.219	0.2648144	362.3607	166.5427	0.7812338	23	19.63711	0.9014254	981.9631	9894.114	1.458125E-12	34	395.0637	0.908742	974.7136	10701.94	1.04855E-16	32	585.3937	0.934332	769.0653	12365.15	1.30005E-14	32	596.887	0.9321058	846.3582	12992.37	2.069801E-11	30	705.086	0.8907505	886.0986	8040.02	2.018285E-08	25	402.0568	0.921426	714.589	9552.57	4.926874E-11	21	270.5491	INS	INS_P804_R	4557670	NM_000207.1	INS	3630	11	36.1	2139804	-804	N	CCCCAGTCCCGGATGGCCCAAGATGCCGCCATGGATGGGCCAAGGTG	.	proinsulin; go_component: extracellular region; go_function: protein binding; go_function: hormone activity; go_function: insulin receptor binding; go_function: insulin-like growth factor binding; go_process: cell death; go_process: glucose transport; go_process: glucose transport; go_process: physiological process; go_process: cell-cell signaling; go_process: glucose metabolism; go_process: carbohydrate metabolism; go_process: acute-phase response; go_process: alpha-beta T cell activation; go_process: regulation of protein secretion; go_process: negative regulation of vasodilation; go_process: positive regulation of vasodilation; go_process: negative regulation of protein catabolism; go_process: positive regulation of cytokine secretion; go_process: generation of precursor metabolites and energy; go_process: cell surface receptor linked signal transduction; go_process: positive regulation of nitric oxide biosynthesis; go_process: positive regulation of nitric-oxide synthase activity	proinsulin precursor
INSR_E97_F	2788	0.5374194	3455.192	4130.37	4.010882E-08	34	267.978	0.274009	4281.119	1653.555	0.00105706	24	250.6672	0.2489821	4948.947	1673.858	0.0001060932	27	242.9262	0.4132814	2236.256	1645.646	0.07740544	27	155.1093	0.2740342	4560.476	1759.215	0.000237163	26	158.3321	0.2301833	4474.555	1367.84	0.0003382795	24	289.6011	0.2519517	5130.277	1761.62	0.0004131271	33	190.7047	0.2518335	5710.487	1955.815	0.0009807047	27	290.3334	0.205209	5311.38	1397.177	8.407105E-05	36	263.1448	0.2850783	4061.355	1659.359	0.001332084	31	181.441	INSR	INSR_E97_F	4557883	NM_000208.1	INSR	3643	19	36.1	7244914	97	Y	CCCGGTGGCCATGGCTGCGGGAGCGCGGGGTCTCCTCGGATCAGAGCGCG	CD220	go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: insulin binding; go_function: transferase activity; go_function: receptor activity; go_function: PTB domain binding; go_function: SH2 domain binding; go_function: insulin receptor activity; go_function: phosphoinositide 3-kinase binding; go_function: phosphoinositide 3-kinase binding; go_function: insulin receptor substrate binding; go_function: insulin receptor substrate binding; go_function: epidermal growth factor receptor activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase signaling protein activity; go_process: development; go_process: signal transduction; go_process: carbohydrate metabolism; go_process: protein heterotetramerization; go_process: insulin receptor signaling pathway; go_process: protein amino acid autophosphorylation; go_process: generation of precursor metabolites and energy	insulin receptor
INSR_P1063_R	1994	0.1508358	973.1381	190.62	0.6424245	25	53.43311	0.1921782	5316.871	1288.656	0.0001815039	28	343.6676	0.1472333	6813.134	1193.578	8.773839E-07	28	286.8988	0.04593081	2521.289	126.1941	0.2698945	34	74.49284	0.1921524	5064.939	1228.518	0.0002556438	38	255.5237	0.2987382	4385.787	1910.949	8.028379E-05	34	255.8081	0.1372831	5676.968	919.282	0.0008406139	38	282.921	0.1402987	6814.121	1128.348	0.0005714323	31	281.3517	0.1942356	4108.326	1014.449	0.005740066	23	298.1761	0.1183037	7285.173	990.923	3.67676E-07	31	278.5893	INSR	INSR_P1063_R	4557883	NM_000208.1	INSR	3643	19	36.1	7246074	-1063	Y	GACGCTTCTGAAAGGGCAAAGACGACGCCAAAGAAGACGCCGGAGACCTC	CD220	go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: insulin binding; go_function: transferase activity; go_function: receptor activity; go_function: PTB domain binding; go_function: SH2 domain binding; go_function: insulin receptor activity; go_function: phosphoinositide 3-kinase binding; go_function: phosphoinositide 3-kinase binding; go_function: insulin receptor substrate binding; go_function: insulin receptor substrate binding; go_function: epidermal growth factor receptor activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase signaling protein activity; go_process: development; go_process: signal transduction; go_process: carbohydrate metabolism; go_process: protein heterotetramerization; go_process: insulin receptor signaling pathway; go_process: protein amino acid autophosphorylation; go_process: generation of precursor metabolites and energy	insulin receptor
IPF1_P234_F	5888	0.08705691	5369.569	521.57	5.797492E-05	22	181.6596	0.5577438	4084.396	5277.081	1.160816E-08	35	409.6141	0.5596776	4683.243	6079.804	2.225112E-12	32	529.2087	0.8333042	647.0227	3734.33	0.04003206	22	180.7525	0.5544435	4146.634	5284.443	2.101749E-09	23	418.2644	0.6168787	4027.943	6646.564	7.398553E-14	35	458.0375	0.5252842	4814.978	5438.54	8.25546E-09	20	575.3376	0.5225976	4886.06	5458.086	1.957216E-06	23	344.8872	0.6118163	3598.753	5829.604	2.048106E-09	34	359.1527	0.4988944	4531.534	4611.096	9.989112E-09	31	340.0748	IPF1	IPF1_P234_F	4557672	NM_000209.1	IPF1	3651	13	36.1	27391943	-234	Y	CCATTTTGGGGAGCACCGCCAGCTGCCCGTTCAGGAGTGTGCAGCAAACTCAGCTG	IUF1, PDX1, IDX-1, MODY4, PDX-1, STF-1	Glucose sensitive factor is similar to homeodomain protein IPF-1; pancreatic-duodenal homeobox factor 1; insulin upstream factor 1; go_component: nucleus; go_function: transcription factor activity; go_function: specific RNA polymerase II transcription factor activity; go_process: development; go_process: organ morphogenesis; go_process: regulation of transcription, DNA-dependent; go_process: generation of precursor metabolites and energy	insulin promoter factor 1, homeodomain transcription factor
IPF1_P750_F	5893	0.0895902	5102.574	511.9668	0.0001544751	26	226.911	0.6493505	3589.801	6832.961	9.818751E-11	20	437.2726	0.5713577	4314.553	5884.368	4.476318E-11	19	410.2333	0.03917849	4507.435	187.8729	0.02521923	28	202.8818	0.6451563	3285.149	6154.683	2.018385E-09	27	371.6866	0.727448	2627.419	7279.55	7.129887E-12	27	729.7162	0.5616372	4582.833	5999.718	2.175107E-09	19	412.7711	0.5781254	4807.922	6725.681	6.085725E-08	29	503.8102	0.5934976	3862.238	5784.907	7.215598E-10	36	340.7535	0.5765238	4302.962	5994.227	4.23345E-11	21	411.3691	IPF1	IPF1_P750_F	4557672	NM_000209.1	IPF1	3651	13	36.1	27391427	-750	Y	CCTCGCTGTATTGGGAAGCTACGTTCCGGGCTGGCCAAATGGGCCC	IUF1, PDX1, IDX-1, MODY4, PDX-1, STF-1	Glucose sensitive factor is similar to homeodomain protein IPF-1; pancreatic-duodenal homeobox factor 1; insulin upstream factor 1; go_component: nucleus; go_function: transcription factor activity; go_function: specific RNA polymerase II transcription factor activity; go_process: development; go_process: organ morphogenesis; go_process: regulation of transcription, DNA-dependent; go_process: generation of precursor metabolites and energy	insulin promoter factor 1, homeodomain transcription factor
IRAK1_P312_F	4951	0.1472798	6601.363	1157.443	1.68317E-08	20	201.6752	0.07382213	7668.128	619.1682	7.986872E-07	33	248.3377	0.05360001	8778.169	502.8212	3.958218E-09	31	346.5125	0.2352794	4773.23	1499.333	0.00139181	30	331.493	0.6753635	3607.615	7713.207	1.221364E-13	26	805.1003	0.6215409	4589.684	7701.838	1.341896E-18	26	549.4078	0.6470269	4101.134	7701.002	1.006578E-11	28	319.3629	0.7123256	4509.318	11413.37	3.582487E-15	34	733.6044	0.5902041	4104.901	6056.064	5.569774E-11	25	534.2111	0.60611	4333.01	6821.426	4.488692E-13	34	347.0588	IRAK1	IRAK1_P312_F	68800242	NM_001569.3	IRAK1	3654	X	36.1	152938848	-312	Y	AAAGCTCCTGGGCGGCCCTGCCGGAACCCTGCTCTCCACTGCGGCCTGC	IRAK, pelle	isoform 1 is encoded by transcript variant 1; Pelle (Drosophila) homolog; go_component: interleukin-1 receptor complex; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: protein kinase binding; go_function: protein kinase activity; go_function: protein homodimerization activity; go_function: NF-kappaB-inducing kinase activity; go_function: transcriptional activator activity; go_function: protein serine/threonine kinase activity; go_process: defense response; go_process: signal transduction; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: positive regulation of transcription; go_process: protein amino acid autophosphorylation; go_process: activation of NF-kappaB-inducing kinase; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	interleukin-1 receptor-associated kinase 1 isoform 1
IRAK1_P455_R	4950	0.06916124	3130.965	240.0604	0.05422281	21	134.1997	0.02921423	10835.61	329.0896	2.457074E-12	24	743.9579	0.02556717	11980.98	316.9808	2.428887E-16	23	626.1899	0.02739858	6835.393	195.3729	0.000243399	20	300.9561	0.4297662	8045.225	6138.785	9.271539E-22	24	617.5313	0.3325168	9829.911	4946.735	2.235076E-27	31	873.75	0.4700828	8288.214	7441.077	2.91526E-21	33	844.9443	0.4595787	11564.91	9919.937	3.801045E-28	29	971.3601	0.448884	5046.019	4191.434	4.973389E-09	27	800.2172	0.3874027	9281.726	5932.945	6.597019E-25	39	616.7722	IRAK1	IRAK1_P455_R	68800242	NM_001569.3	IRAK1	3654	X	36.1	152938991	-455	Y	GTCCTGAAATATGCCGAGAACGCTGCCCGCCACAGCCGTGAGTGTATGCGTTGCT	IRAK, pelle	isoform 1 is encoded by transcript variant 1; Pelle (Drosophila) homolog; go_component: interleukin-1 receptor complex; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: protein kinase binding; go_function: protein kinase activity; go_function: protein homodimerization activity; go_function: NF-kappaB-inducing kinase activity; go_function: transcriptional activator activity; go_function: protein serine/threonine kinase activity; go_process: defense response; go_process: signal transduction; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: positive regulation of transcription; go_process: protein amino acid autophosphorylation; go_process: activation of NF-kappaB-inducing kinase; go_process: transmembrane receptor protein serine/threonine kinase signaling pathway	interleukin-1 receptor-associated kinase 1 isoform 1
IRAK3_E130_F	5591	0.04038719	5511.302	236.1627	9.715169E-05	21	288.3251	0.04037143	10015.69	425.5656	8.987833E-11	33	526.5457	0.02620525	12827.37	347.8812	7.037625E-19	22	821.0372	0.02618587	6190.104	169.141	0.001153678	23	329.4273	0.03334222	10419.88	362.8544	2.418599E-12	28	702.0357	0.04329435	11921.17	544.0008	3.742253E-19	31	719.0245	0.02888373	10619.31	318.8224	4.867885E-10	35	630.4614	0.03640674	13082.02	498.0467	5.511267E-11	32	676.5751	0.05748992	7352.107	454.5533	1.940522E-06	25	516.9174	0.02798744	12829.21	372.2745	1.583667E-18	25	625.5021	IRAK3	IRAK3_E130_F	6005791	NM_007199.1	IRAK3	11213	12	36.1	64869414	130	Y	GCACACGCTGCTGTTCGACCTGCCGCCCGCGCTGCTCGGAGAGCTCTGCGCT	IRAK-M	interleukin-1 receptor-associated kinase M; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein self binding; go_function: magnesium ion binding; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of protein complex disassembly; go_process: cytokine and chemokine mediated signaling pathway	interleukin-1 receptor-associated kinase 3
IRAK3_P13_F	4952	0.03747324	5624.025	222.8486	6.808319E-05	33	217.9357	0.04493652	8890.654	423.0176	1.419377E-08	29	587.8658	0.0400437	12322.48	518.1925	6.900021E-18	28	661.8425	0.110633	7018.146	885.4633	2.450336E-05	31	243.6446	0.03892533	9647.506	394.7924	1.121592E-10	33	548.506	0.05906735	7234.995	460.4566	4.128677E-07	23	826.6632	0.03692132	9770.795	378.4143	1.247093E-08	23	652.1076	0.05420713	11798.78	681.9659	2.798271E-09	24	676.2772	0.05637908	7095.949	429.9407	5.436559E-06	25	448.1247	0.06484663	11683.17	817.0844	1.530127E-16	27	963.2062	IRAK3	IRAK3_P13_F	6005791	NM_007199.1	IRAK3	11213	12	36.1	64869271	-13	Y	TGCCGTCGTGGAAGCAGGATTTCCGCGGTTGTGTAACGGCCTGTCGCAG	IRAK-M	interleukin-1 receptor-associated kinase M; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein self binding; go_function: magnesium ion binding; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of protein complex disassembly; go_process: cytokine and chemokine mediated signaling pathway	interleukin-1 receptor-associated kinase 3
IRAK3_P185_F	4954	0.0938073	7105.959	745.9469	1.045453E-08	27	294.9131	0.08212676	11672.22	1053.32	4.065967E-16	38	582.7747	0.06499266	15151.29	1060.122	3.32671E-29	31	1253.182	0.1860627	5701.583	1326.218	0.0002451753	32	334.1377	0.08631384	10239.1	976.7111	2.216097E-13	26	847.1564	0.103201	12660.88	1468.484	6.459716E-25	26	716.084	0.1092968	12052.7	1491.239	1.425676E-15	32	694.6379	0.1074697	14353.52	1740.349	1.654476E-15	33	607.6967	0.09748849	8699.553	950.5198	7.114189E-10	28	668.6786	0.07350224	17165.08	1369.698	1.209536E-37	28	930.7604	IRAK3	IRAK3_P185_F	6005791	NM_007199.1	IRAK3	11213	12	36.1	64869099	-185	Y	CCCCACCGCAGAGGTGTGAAGGGGCGCAAAGCCAGCGAAGGGAGAACCCG	IRAK-M	interleukin-1 receptor-associated kinase M; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein self binding; go_function: magnesium ion binding; go_function: protein serine/threonine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: regulation of protein complex disassembly; go_process: cytokine and chemokine mediated signaling pathway	interleukin-1 receptor-associated kinase 3
IRF5_E101_F	3518	0.1301725	5922.493	901.2853	1.387225E-06	29	260.9147	0.0921701	15150.81	1548.383	2.811648E-28	29	830.2443	0.1473077	16280.99	2829.914	3.678E-38	37	1001.689	0.2106234	5897.573	1600.287	7.404989E-05	36	208.8258	0.1230008	14827.39	2093.595	1.892355E-31	20	497.1985	0.196373	12227.73	3012.385	3.247954E-29	33	728.5923	0.2122591	11999.24	3260.176	5.874504E-20	31	940.6665	0.1001163	18344.43	2052.031	2.855876E-25	24	1612.819	0.1746582	9490.163	2029.463	2.993964E-14	26	825.0961	0.1221977	13776.04	1931.666	1.26602E-26	24	1296.073	IRF5	IRF5_E101_F	38683858	NM_032643.3	IRF5	3663	7	36.1	128365331	101	Y	TGCTCCCTGGCGCAGCCACGCAGGCGCACCGCAGACAGGTGGGTCCCGGCC	.	isoform b is encoded by transcript variant 2; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase III transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	interferon regulatory factor 5 isoform b
IRF5_P123_F	1225	0.1327816	7392.48	1147.189	2.517569E-10	24	267.0255	0.1690787	12540.87	2572.207	5.498376E-23	26	845.2299	0.1477933	14857.13	2593.929	4.135907E-34	30	1146.489	0.05685978	7869.87	480.4853	6.706111E-06	34	461.7636	0.1594028	13647.87	2607.015	6.446118E-29	32	791.379	0.1438081	15556.55	2629.712	3.678E-38	32	996.326	0.1535319	15284.08	2790.355	1.949085E-28	29	1350.951	0.1521001	16207.64	2925.339	3.874906E-22	43	754.0146	0.1525643	9212.85	1676.598	1.127353E-12	26	582.6882	0.1407219	15633.72	2576.674	2.810642E-36	30	905.1347	IRF5	IRF5_P123_F	38683858	NM_032643.3	IRF5	3663	7	36.1	128365107	-123	Y	TGGGCCTGGCCCGAGGCTCAGCCCGGATCTGCAGTTGCCAGGTCAGTGCG	.	isoform b is encoded by transcript variant 2; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase III transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent	interferon regulatory factor 5 isoform b
IRF7_E236_R	3520	0.08605284	6679.042	638.2817	1.469829E-07	21	393.5263	0.1326794	6064.241	942.9821	5.666073E-05	27	323.4716	0.117786	7519.582	1017.304	1.040909E-07	27	294.5252	0.02606998	5615.846	153.0007	0.003903358	24	520.4567	0.1773534	5948.207	1303.926	1.28536E-05	31	342.2724	0.1596733	6734.275	1298.603	9.554016E-08	24	403.3152	0.1955808	6170.531	1524.572	4.935622E-05	24	311.8064	0.1964419	7239.85	1794.337	5.388169E-05	31	254.1138	0.1514519	6020.236	1092.362	2.278742E-05	31	277.3829	0.08514407	6290.341	594.738	4.979601E-05	22	245.843	IRF7	IRF7_E236_R	4809283	NM_004029.1	IRF7	3665	11	36.1	605691	236	Y	CGTCAGGGGCGGGTCAGGCTCCCGGGAAAGCGAAACCTAAACAGTGG	IRF7A, IRF-7H	isoform b is encoded by transcript variant b; interferon regulatory factor-7H; go_component: nucleus; go_component: cytoplasm; go_function: transcription factor activity; go_function: specific RNA polymerase II transcription factor activity; go_process: transcription; go_process: response to virus; go_process: inflammatory response; go_process: response to DNA damage stimulus; go_process: regulation of transcription, DNA-dependent; go_process: passive viral induction of host immune response; go_process: transcription initiation from RNA polymerase II promoter; go_process: negative regulation of transcription from RNA polymerase II promoter	interferon regulatory factor 7 isoform b
IRF7_P277_R	1227	0.2173474	6129.845	1730.066	1.003197E-08	27	412.6743	0.0526795	15068.99	843.5318	1.399704E-25	33	1316.412	0.04509765	21116	1001.979	3.678E-38	25	1054.512	0.1294226	5920.836	895.0751	0.0004084345	28	314.9413	0.05299942	15028.73	846.6877	1.591603E-27	22	1261.502	0.05295584	18390.17	1033.914	3.678E-38	25	700.7971	0.0587667	16346.19	1026.832	3.564774E-26	27	1557.309	0.06491619	20639.91	1439.824	8.680882E-30	36	807.087	0.09169636	11923.86	1213.849	9.091599E-19	28	966.2977	0.06533666	17754.78	1248.119	3.678E-38	37	843.6039	IRF7	IRF7_P277_R	4809283	NM_004029.1	IRF7	3665	11	36.1	606204	-277	Y	GTAATGGGAGGTGGACGTGCCTCGAAAAAGGGGCAGCTGCACCGTT	IRF7A, IRF-7H	isoform b is encoded by transcript variant b; interferon regulatory factor-7H; go_component: nucleus; go_component: cytoplasm; go_function: transcription factor activity; go_function: specific RNA polymerase II transcription factor activity; go_process: transcription; go_process: response to virus; go_process: inflammatory response; go_process: response to DNA damage stimulus; go_process: regulation of transcription, DNA-dependent; go_process: passive viral induction of host immune response; go_process: transcription initiation from RNA polymerase II promoter; go_process: negative regulation of transcription from RNA polymerase II promoter	interferon regulatory factor 7 isoform b
ISL1_E87_R	5600	0.1078329	6546.117	803.2913	1.262033E-07	36	272.044	0.1117892	7576.14	966.1099	3.089041E-07	25	221.5029	0.1129707	8512.555	1096.882	8.429211E-10	25	519.7295	0.4294748	3613.679	2795.55	0.001033946	27	379.0043	0.08064251	8125.089	721.4732	2.838471E-08	27	361.8767	0.1689716	7705.507	1587.081	2.079211E-10	28	486.7055	0.1032504	8084.532	942.3546	7.721002E-07	25	323.3727	0.1245865	8758.172	1260.671	4.684312E-06	28	264.1074	0.08356604	7055.845	652.5135	2.797897E-06	30	383.2134	0.04320856	9413.683	429.6365	3.968571E-10	26	397.1424	ISL1	ISL1_E87_R	88983521	XM_930750.1	LOC642366	642366	5	36.1	50715113	132	Y	TGGACTCCTAGATCCGCGAGGGCGCGGCGCAGCCGAGCAGCGGCTCTTT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_935843
ISL1_P379_F	4969	0.04737284	6603.951	333.3783	8.41504E-07	31	262.7007	0.1501224	12869.37	2290.91	3.900817E-23	27	1098.959	0.1000633	14497.94	1623.134	7.308595E-29	35	958.9025	0.1315108	7017.595	1077.78	1.419151E-05	33	351.0019	0.09415611	14140.14	1480.162	1.311008E-26	21	1226.926	0.2391139	12626.19	3999.296	4.385735E-35	33	1169.265	0.1100811	14422.86	1796.447	1.140606E-22	38	1027.978	0.1080539	18723.92	2280.404	7.41047E-27	18	535.5441	0.09783381	7928.735	870.662	3.511449E-08	19	799.3729	0.06812957	16720.68	1229.77	3.345962E-35	35	1289.547	ISL1	ISL1_P379_F	4504736	NM_002202.1	ISL1	3670	5	36.1	50714647	-379	Y	GCGGGGACCCCAGGAGCGCAGGGCGGAGGAGCAGCGCCACAGGAGGC	Isl-1	go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	islet-1
ISL1_P554_F	4974	0.1301352	2876.094	445.2354	0.05927825	27	93.15961	0.1361665	6347.35	1016.299	1.882306E-05	22	246.0214	0.1354938	7404.747	1176.217	8.654283E-08	27	473.0162	0.0655264	2031.108	149.4359	0.3794659	30	75.47209	0.162883	5824.953	1152.854	3.186605E-05	26	327.1725	0.270417	5887.278	2219.161	6.875142E-08	22	454.2128	0.1315933	6111.249	941.2165	0.0002763974	31	312.5029	0.125558	7576.493	1102.24	0.0001209597	22	297.7634	0.1921671	4780.978	1161.086	0.0007734185	20	442.0597	0.1023613	7095.541	820.5362	1.452689E-06	36	275.2807	ISL1	ISL1_P554_F	4504736	NM_002202.1	ISL1	3670	5	36.1	50714472	-554	Y	CAGGCCCCGGGGATGTGCACCACGGCGTGGGGACCAAACCAAGCTGAAC	Isl-1	go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	islet-1
ITGA2_E120_F	2789	0.04957571	8051.09	425.1744	3.604561E-10	23	594.0609	0.04680715	12144.31	601.265	3.605687E-16	39	751.866	0.04005619	16266.28	682.926	4.474249E-32	30	875.3099	0.02244671	8412.008	195.4539	3.064867E-06	37	259.6947	0.04586868	11996.15	581.5074	5.968837E-17	26	1150.827	0.04891615	13781.36	713.9459	2.71676E-26	32	970.7173	0.03289579	15227.87	521.3734	2.560449E-21	28	898.0833	0.05360534	16644.45	948.4328	1.281584E-18	28	1022.533	0.04581157	10589.66	513.2215	3.387335E-13	20	905.692	0.04166225	18122.67	792.2025	3.678E-38	22	1443.876	ITGA2	ITGA2_E120_F	6006008	NM_002203.2	ITGA2	3673	5	36.1	52321134	120	Y	CGCTCAGTCAAGGTAAGCGGGGATTTCGCTCTGCATCGGCTGCAGGAGG	BR, GPIa, CD49B, VLA-2, VLAA2	Integrin, alpha-2 (CD49B; alpha-2 subunit of VLA-2 receptor; platelet antigen Br); integrin alpha 2 subunit; platelet glycoprotein GPIa; adhesion receptor; integrin alpha-2 subunit; platelet glycoprotein Ia; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to membrane; go_component: integrin complex; go_function: receptor activity; go_function: calcium ion binding; go_function: collagen binding; go_function: magnesium ion binding; go_function: protein self binding; go_process: cell adhesion; go_process: cell adhesion; go_process: blood coagulation; go_process: organ morphogenesis; go_process: cell-matrix adhesion; go_process: integrin-mediated signaling pathway	integrin alpha 2 precursor
ITGA2_P26_R	2008	0.09023469	3294.833	336.7151	0.03304905	28	181.2797	0.1005182	7013.399	794.9313	4.343805E-06	26	485.9448	0.1026282	9223.211	1066.252	2.800338E-11	23	406.1252	0.0988284	1467.674	171.9215	0.5191038	26	70.66534	0.08097223	6859.316	613.1603	6.012547E-06	29	312.1541	0.101571	8109.144	928.0765	7.845016E-10	40	420.0595	0.07889813	8135.002	705.3794	1.450135E-06	24	495.3723	0.1229254	8252.523	1170.638	2.127493E-05	23	450.4744	0.09833396	6118.375	678.1639	6.377825E-05	31	339.9406	0.06437016	9666.772	671.9417	3.429514E-11	30	431.3503	ITGA2	ITGA2_P26_R	6006008	NM_002203.2	ITGA2	3673	5	36.1	52320988	-26	Y	GAGTGTGCAGGTTCTCGTATCCCTCGGCCAAGGGTATCCTCTGCAAACCTCT	BR, GPIa, CD49B, VLA-2, VLAA2	Integrin, alpha-2 (CD49B; alpha-2 subunit of VLA-2 receptor; platelet antigen Br); integrin alpha 2 subunit; platelet glycoprotein GPIa; adhesion receptor; integrin alpha-2 subunit; platelet glycoprotein Ia; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to membrane; go_component: integrin complex; go_function: receptor activity; go_function: calcium ion binding; go_function: collagen binding; go_function: magnesium ion binding; go_function: protein self binding; go_process: cell adhesion; go_process: cell adhesion; go_process: blood coagulation; go_process: organ morphogenesis; go_process: cell-matrix adhesion; go_process: integrin-mediated signaling pathway	integrin alpha 2 precursor
ITGA6_P298_R	2281	0.04713499	3534.72	179.7972	0.02795001	25	195.994	0.03868654	7594.01	309.6332	3.130509E-06	36	213.5872	0.04368269	8837.129	408.2304	4.663486E-09	18	416.8709	0.05454753	2703.408	161.7416	0.224857	27	82.51255	0.04736821	7085.1	357.2684	6.681034E-06	26	215.2695	0.05243534	8783.279	491.5736	2.283277E-10	28	369.3499	0.03425266	8665.637	310.8954	9.167513E-07	31	393.1067	0.07375387	9392.158	755.8287	3.325708E-06	20	525.0507	0.05070439	6836.991	370.523	1.654121E-05	25	321.5155	0.1137778	8854.854	1149.671	1.816506E-10	28	402.403	ITGA6	ITGA6_P298_R	4557674	NM_000210.1	ITGA6	3655	2	36.1	173000318	-298	Y	GTAAAGTCTCCCTCGCTCTGTGCTACTCGGCAACCACAATTCTGTCCACAGAG	CD49f	Integrin alpha-6; go_component: integrin complex; go_component: integral to membrane; go_function: protein binding; go_function: receptor activity; go_function: calcium ion binding; go_process: cell adhesion; go_process: cell-matrix adhesion; go_process: integrin-mediated signaling pathway; go_process: cell-substrate junction assembly	integrin alpha chain, alpha 6
ITGA6_P718_R	2277	0.4703765	2002.534	1867.331	0.02015902	26	137.9481	0.9560766	684.2563	17070.82	4.013454E-32	32	1254.01	0.9669939	708.4186	23684.57	3.678E-38	28	784.8972	0.3960015	1177.724	837.7185	0.4212878	32	65.34351	0.9618005	651.7261	18927.2	3.678E-38	36	909.3973	0.9525266	770.1264	17458.59	3.678E-38	31	1175.285	0.9624822	726.0832	21192.36	3.678E-38	32	1017.461	0.9578464	896.3478	22639.79	5.16115E-34	19	1424.987	0.9255605	786.1499	11018.15	5.378799E-15	17	964.9504	0.9614882	715.113	20350.15	3.678E-38	22	1360.017	ITGA6	ITGA6_P718_R	4557674	NM_000210.1	ITGA6	3655	2	36.1	172999898	-718	Y	TTAAACAACCCATCCTTGACTTGCGTGACTTCTTCCACAAGCTCTCCTGGT	CD49f	Integrin alpha-6; go_component: integrin complex; go_component: integral to membrane; go_function: protein binding; go_function: receptor activity; go_function: calcium ion binding; go_process: cell adhesion; go_process: cell-matrix adhesion; go_process: integrin-mediated signaling pathway; go_process: cell-substrate junction assembly	integrin alpha chain, alpha 6
ITGB1_P451_F	4227	0.1450539	4566.745	791.7802	0.0003635068	31	226.0321	0.08581001	8128.63	772.3764	7.663981E-08	31	358.9656	0.06567415	11163.77	791.7349	2.099326E-15	44	427.2468	0.2599919	5092.78	1824.413	0.0003207459	33	313.8504	0.05737548	9157.834	563.504	5.367067E-10	20	431.5012	0.05251872	10157.37	568.5644	5.371361E-14	30	495.4727	0.06961534	8695.78	658.1378	2.46147E-07	33	417.455	0.09015283	10673.6	1067.509	3.174913E-08	20	508.7745	0.0891204	8244.095	816.3857	1.110429E-08	26	443.6607	0.07104752	8861.839	685.4133	1.604321E-09	27	434.6774	ITGB1	ITGB1_P451_F	19743816	NM_033667.1	ITGB1	3688	10	36.1	33287655	-451	Y	CGTTTGTCCACTGATGTCCCGTTTCGAGCCCGGGAGATCCTGCATCTCGG	CD29, FNRB, MDF2, VLAB, GPIIA, MSK12	isoform 1C-1 precursor is encoded by transcript variant 1C-1; integrin VLA-4 beta subunit; fibronectin receptor beta subunit; go_component: membrane; go_component: ruffle; go_component: integrin complex; go_component: integral to membrane; go_component: integrin complex; go_function: protein binding; go_function: receptor activity; go_function: protein self binding; go_function: protein heterodimerization activity; go_process: development; go_process: cell adhesion; go_process: cell migration; go_process: cell-matrix adhesion; go_process: homophilic cell adhesion; go_process: cellular defense response; go_process: integrin-mediated signaling pathway	integrin beta 1 isoform 1C-1 precursor
ITGB4_E144_F	781	0.04854467	7796.819	402.9075	1.662679E-09	30	393.0512	0.03736204	11346.78	444.274	8.713938E-14	20	741.0278	0.04080096	13573.51	581.6232	5.98088E-22	23	928.3615	0.02812728	8742.996	255.9279	8.827907E-07	26	920.621	0.04386392	11821.51	546.9141	2.262268E-16	33	500.4247	0.04890862	11081.5	574.9937	1.20444E-16	38	606.1458	0.05001686	10053.61	534.59	2.124986E-09	30	774.7133	0.041316	14539.82	630.9263	9.557075E-14	29	527.6097	0.06836087	6938.618	516.4725	6.998367E-06	21	778.0636	0.04089353	14984.52	643.1606	2.427965E-26	19	784.2498	ITGB4	ITGB4_E144_F	54607034	NM_000213.3	ITGB4	3691	17	36.1	71229255	144	Y	GCCCCGAGGTAGGTCCAGGACGGGCGCACAGCAGCAGCCGAGGCTGGCCGG	CD104	isoform 1 precursor is encoded by transcript variant 1; integrin beta-4 subunit; GP150; CD104 antigen; go_component: membrane; go_component: integral to membrane; go_component: integrin complex; go_function: receptor activity; go_function: protein binding; go_process: development; go_process: cell adhesion; go_process: cell communication; go_process: cell-matrix adhesion; go_process: integrin-mediated signaling pathway	integrin beta 4 isoform 1 precursor
ITGB4_P517_F	3996	0.1960284	2451.97	622.2339	0.09007698	35	117.9498	0.3575681	5082.273	2884.377	2.514537E-06	38	443.5771	0.3276433	6708.483	3317.814	1.08014E-10	25	523.6262	0.2213561	1783.537	535.4599	0.3454292	28	117.877	0.3961478	5447.696	3639.48	9.953011E-09	29	403.2307	0.4029442	5226.766	3594.956	2.325899E-09	20	566.559	0.3568178	5910.064	3334.199	3.630845E-07	24	464.3563	0.3215445	7210.851	3464.875	7.774292E-07	23	351.0529	0.4695604	3599.848	3275.212	4.965505E-05	33	440.7847	0.377031	6506.408	3998.306	1.463367E-11	29	544.0856	ITGB4	ITGB4_P517_F	54607034	NM_000213.3	ITGB4	3691	17	36.1	71228594	-517	Y	GGTTGGAGGCTGAGAGGACCCCGTGAACTGCAGAGCAGAGCTGGGA	CD104	isoform 1 precursor is encoded by transcript variant 1; integrin beta-4 subunit; GP150; CD104 antigen; go_component: membrane; go_component: integral to membrane; go_component: integrin complex; go_function: receptor activity; go_function: protein binding; go_process: development; go_process: cell adhesion; go_process: cell communication; go_process: cell-matrix adhesion; go_process: integrin-mediated signaling pathway	integrin beta 4 isoform 1 precursor
ITK_E166_R	2794	0.2887344	4023.701	1673.994	0.0001157549	33	175.4965	0.6135826	4941.312	8004.973	1.069595E-16	33	840.5476	0.6616301	4525.809	9045.054	4.341883E-20	24	1012.517	0.03002648	4839.631	152.9111	0.0157313	32	215.1311	0.7558115	3274.528	10444.83	2.659595E-20	31	889.2846	0.5437644	6251.412	7569.931	8.671023E-24	25	597.9503	0.7235709	3778.718	10152.79	1.640533E-16	30	1122.119	0.7922104	3846.315	15045.56	1.448433E-21	28	936.7855	0.5419459	5030.512	6070.157	3.430254E-13	29	877.3699	0.6478679	5381.579	10085.25	8.889338E-26	28	875.6936	ITK	ITK_E166_R	21614549	NM_005546.3	ITK	3702	5	36.1	156540651	166	N	TCTCCCTCGAACTTTAAAGTCCGCTTCTTTGTGTTAACCAAAGCCAGCCT	EMT, LYK, PSCTK2, MGC126257, MGC126258	homolog of mouse T-cell itk/tsk; tyrosine-protein kinase ITK/TSK; tyrosine-protein kinase LYK; go_function: ATP binding; go_function: kinase activity; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: cellular defense response; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	IL2-inducible T-cell kinase
ITK_P114_F	2291	0.2429486	3318.794	1097.14	0.005576251	23	224.3456	0.6229969	5047.995	8507.052	2.353434E-18	35	703.822	0.6476783	5301.771	9930.157	1.302811E-25	27	650.6583	0.7968783	290.0581	1530.26	0.4718482	25	51.92513	0.7294503	3432.467	9524.16	5.010161E-18	30	962.7178	0.5521841	5563.024	6982.851	2.05293E-19	27	772.1141	0.7234505	3499.859	9417.192	4.065732E-14	36	770.0934	0.7595557	3760.562	12195.39	3.085391E-15	36	729.7597	0.5576753	3655.625	4735.027	1.964698E-07	22	470.398	0.5944691	5778.387	8617.148	3.447376E-22	33	629.4054	ITK	ITK_P114_F	21614549	NM_005546.3	ITK	3702	5	36.1	156540371	-114	N	GTGAATTTTGAAAGGATGTGGTTTCGGCCTTTGACATCAGAGGAGAAGCTC	EMT, LYK, PSCTK2, MGC126257, MGC126258	homolog of mouse T-cell itk/tsk; tyrosine-protein kinase ITK/TSK; tyrosine-protein kinase LYK; go_function: ATP binding; go_function: kinase activity; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: cellular defense response; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	IL2-inducible T-cell kinase
ITPR2_P804_F	1248	0.245073	4160.35	1383.043	0.0001969193	20	230.4893	0.1328727	7747.8	1202.544	6.293972E-08	23	360.8162	0.149529	8148.624	1450.265	8.86721E-10	24	370.7827	0.1539842	4632.776	861.4177	0.006565711	31	252.8273	0.1475124	7383.55	1294.935	5.787954E-08	22	421.8425	0.1309344	8152.038	1243.261	1.204001E-10	32	367.7517	0.1413389	7639.16	1273.896	1.136463E-06	21	573.7924	0.1356902	8605.851	1366.754	5.288875E-06	24	391.0746	0.1860941	6748.708	1565.911	2.677326E-07	23	574.7297	0.1446984	8761.187	1499.119	5.100057E-11	21	301.2518	ITPR2	ITPR2_P804_F	4504792	NM_002223.1	ITPR2	3709	12	36.1	26878202	-804	Y	CTGCGCTTCGTTAACTCCAAGCCGAGGTTAACCTTCCACCCCCAT	IP3R2	go_component: plasma membrane; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: calcium ion binding; go_function: calcium channel activity; go_function: calcium ion transporter activity; go_function: inositol-1,4,5-triphosphate receptor activity; go_function: inositol 1,4,5-triphosphate-sensitive calcium-release channel activity; go_process: cation transport; go_process: calcium ion transport; go_process: signal transduction	inositol 1,4,5-triphosphate receptor, type 2
ITPR3_E86_R	3533	0.08074766	2254.83	206.8496	0.2137277	33	98.05074	0.06802984	6427.816	476.5027	7.694975E-05	28	482.2899	0.05011577	11170.2	594.6143	6.768772E-15	36	429.7008	0.03247922	7261.626	247.1264	7.194687E-05	31	360.9631	0.05278852	9588.024	539.9179	7.312791E-11	26	453.7052	0.07154816	9132.235	711.4525	1.02097E-11	32	316.6582	0.04515281	8730.806	417.5911	5.077598E-07	22	439.1385	0.05387322	9809.216	564.2387	1.806313E-06	32	506.0688	0.06565934	6627.145	472.7397	2.377703E-05	34	311.5232	0.0495881	9521.643	502.0128	1.653999E-10	19	476.2088	ITPR3	ITPR3_E86_R	4504794	NM_002224.1	ITPR3	3710	6	36.1	33697408	86	Y	ATCGGGGACATCGTCTCCCTGTACGCCGAGGGCTCCGTCAATGGCTTCATC	IP3R3	go_component: brush border; go_component: plasma membrane; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: calcium ion binding; go_function: calcium channel activity; go_function: calcium ion transporter activity; go_function: inositol-1,4,5-triphosphate receptor activity; go_function: inositol 1,4,5-triphosphate-sensitive calcium-release channel activity; go_process: cation transport; go_process: calcium ion transport; go_process: signal transduction	inositol 1,4,5-triphosphate receptor, type 3
ITPR3_P1112_F	1255	0.07037249	3554.751	276.6635	0.02189188	32	163.1764	0.05906308	9042.363	573.8707	3.895793E-09	28	525.9484	0.04368963	12163.05	560.2452	1.512866E-17	28	596.8868	0.05502803	10274.44	604.1288	9.218318E-10	33	876.1159	0.04571998	9077.515	439.6988	1.408745E-09	37	424.1393	0.06312288	9297.305	633.1513	6.236072E-12	39	565.8415	0.05040248	9186.438	492.903	7.520772E-08	31	494.1686	0.04057384	12066.37	514.5121	1.987684E-09	23	738.6005	0.06240633	7355.581	496.2442	1.637141E-06	29	381.3574	0.05211267	10285.14	570.9514	2.290565E-12	47	725.433	ITPR3	ITPR3_P1112_F	4504794	NM_002224.1	ITPR3	3710	6	36.1	33696210	-1112	Y	AGAACAGAAAGTAAGCGAGCCCGGGACGCGAATTTGAGGGCAGGACTTCG	IP3R3	go_component: brush border; go_component: plasma membrane; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: calcium ion binding; go_function: calcium channel activity; go_function: calcium ion transporter activity; go_function: inositol-1,4,5-triphosphate receptor activity; go_function: inositol 1,4,5-triphosphate-sensitive calcium-release channel activity; go_process: cation transport; go_process: calcium ion transport; go_process: signal transduction	inositol 1,4,5-triphosphate receptor, type 3
JAG1_P66_F	4977	0.03437107	10283.14	369.5826	2.671478E-16	34	432.3398	0.05250742	9012.946	505.0143	5.960109E-09	33	505.1224	0.04794227	11599.05	589.1229	4.886393E-16	28	589.4456	0.039219	7198.487	297.9236	7.433394E-05	31	565.5112	0.06878474	9279.78	692.8427	1.583457E-10	31	631.3019	0.05119242	11832.79	643.8273	3.437705E-19	29	627.8938	0.05415055	11652.22	672.8229	8.148827E-13	16	764.9119	0.06764644	12617.75	922.7296	6.390735E-11	30	667.2505	0.07921883	8438.292	734.5867	6.681392E-09	30	681.8654	0.04253546	12172.89	545.2242	3.81179E-17	30	604.3543	JAG1	JAG1_P66_F	4557678	NM_000214.1	JAG1	182	20	36.1	10602656	-66	Y	GGAGAGCCCGTCTGGCAGCAGCGGCCGGGGCTGGCCACCTCTACCC	AGS, AHD, AWS, HJ1, CD339, JAGL1, MGC104644	jagged1 (Alagille syndrome); go_component: membrane; go_component: extracellular region; go_component: integral to plasma membrane; go_function: Notch binding; go_function: calcium ion binding; go_function: calcium ion binding; go_function: growth factor activity; go_function: structural molecule activity; go_process: development; go_process: hemopoiesis; go_process: angiogenesis; go_process: cell communication; go_process: Notch signaling pathway; go_process: cell fate determination; go_process: myoblast differentiation; go_process: nervous system development; go_process: keratinocyte differentiation; go_process: regulation of cell migration; go_process: endothelial cell differentiation; go_process: regulation of cell proliferation	jagged 1 precursor
JAG2_E54_F	5607	0.06258629	5515.259	374.9019	5.818202E-05	31	187.9842	0.04012457	15029.57	632.4438	9.437475E-25	29	952.7512	0.02946443	20919.43	638.1277	3.678E-38	21	1123.981	0.02658108	7559.637	209.1612	3.564948E-05	25	300.7247	0.03505076	15414.9	563.5623	6.71884E-28	30	1062.735	0.03917908	15521.95	637.0112	4.804774E-33	34	1099.313	0.03944022	15282.81	631.6125	8.680931E-22	30	1178.702	0.02955685	23415.64	716.2174	7.930931E-36	28	1272.973	0.04246605	11034.71	493.8175	2.839632E-14	35	676.3221	0.04372232	13843.06	637.496	1.832948E-22	31	580.5947	JAG2	JAG2_E54_F	21704278	NM_145159.1	JAG2	3714	14	36.1	104706152	54	Y	CGCAGCCAACAAGTTCGGAACGAGACTGACAGCTCGCTCGCCCATTC	HJ2	isoform b precursor is encoded by transcript variant 2; go_component: membrane; go_component: integral to plasma membrane; go_function: Notch binding; go_function: calcium ion binding; go_function: growth factor activity; go_process: cell cycle; go_process: spermatogenesis; go_process: cell-cell signaling; go_process: cell differentiation; go_process: cell differentiation; go_process: T cell differentiation; go_process: Notch signaling pathway; go_process: cell fate determination; go_process: thymic T cell selection; go_process: sensory perception of sound; go_process: embryonic limb morphogenesis; go_process: regulation of cell migration; go_process: regulation of cell proliferation; go_process: regulation of cell proliferation; go_process: auditory receptor cell fate commitment	jagged 2 isoform b precursor
JAG2_P264_F	4985	0.06442942	4049.949	285.7923	0.00682573	35	143.0957	0.08465944	8408.983	786.9921	2.316902E-08	30	250.9408	0.07458937	9402.215	765.8916	5.245317E-11	41	335.6712	0.0320555	5680.01	191.4171	0.003189904	35	242.8801	0.07985308	8417.867	739.2058	7.29553E-09	18	304.8857	0.07236332	8956.138	706.4535	2.810837E-11	32	354.9352	0.0794207	8724.889	761.3455	1.52877E-07	24	437.2774	0.05779461	11404.84	705.7037	9.641743E-09	36	426.8709	0.09368636	8007.166	838.0443	2.877478E-08	38	401.6419	0.07940371	7202.183	629.8314	1.981352E-06	30	196.5472	JAG2	JAG2_P264_F	21704278	NM_145159.1	JAG2	3714	14	36.1	104706470	-264	Y	GGCTCCTGCCGGGTGTCAGAAACCGGGGGTGGGGCGCCCCGAGGTTGCCG	HJ2	isoform b precursor is encoded by transcript variant 2; go_component: membrane; go_component: integral to plasma membrane; go_function: Notch binding; go_function: calcium ion binding; go_function: growth factor activity; go_process: cell cycle; go_process: spermatogenesis; go_process: cell-cell signaling; go_process: cell differentiation; go_process: cell differentiation; go_process: T cell differentiation; go_process: Notch signaling pathway; go_process: cell fate determination; go_process: thymic T cell selection; go_process: sensory perception of sound; go_process: embryonic limb morphogenesis; go_process: regulation of cell migration; go_process: regulation of cell proliferation; go_process: regulation of cell proliferation; go_process: auditory receptor cell fate commitment	jagged 2 isoform b precursor
JAK2_P772_R	4228	0.04353926	5289.134	245.3199	0.0002029631	28	188.8768	0.04299872	8514.954	387.0757	7.632831E-08	28	396.0005	0.04874719	9810.918	507.8875	2.402925E-11	29	366.1355	0.03803443	4283.019	173.2969	0.0359714	40	151.953	0.09435432	8009.956	844.9324	2.738896E-08	24	259.4286	0.07934758	8090	705.8654	2.644365E-09	25	534.9217	0.073154	7821.942	625.2622	5.201856E-06	34	367.141	0.08853218	8753.88	859.9901	1.326254E-05	23	528.4221	0.09745171	6209.211	681.2305	4.72592E-05	24	475.0213	0.05503585	9957.553	585.764	1.197741E-11	28	395.4094	JAK2	JAK2_P772_R	13325062	NM_004972.2	JAK2	3717	9	36.1	4974473	-772	Y	TCGCTAGGCCTTGTTGCCAACCCGCAGGCGGCTGGGCGCTTCATCCCAC	.	tyrosine-protein kinase JAK2; go_component: cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: receptor binding; go_function: transferase activity; go_function: Janus kinase activity; go_function: SH2 domain binding; go_function: protein-tyrosine kinase activity; go_process: cell motility; go_process: JAK-STAT cascade; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	Janus kinase 2
JAK3_E64_F	5615	0.08834822	3932.154	390.7563	0.007047098	31	179.5654	0.05657579	9374.848	568.1929	9.135258E-10	18	526.1128	0.0621125	11055.19	738.7634	5.667832E-15	26	603.4603	0.03599462	5595.667	212.6683	0.003613322	26	350.3339	0.06160845	10142.47	672.4514	2.032471E-12	24	318.0893	0.07283326	8910.387	707.8078	3.590943E-11	27	589.1468	0.05496648	9518.791	559.4628	1.646418E-08	25	760.9664	0.05235182	13004.83	723.9623	3.146462E-11	35	592.8121	0.06674744	8195.572	593.3102	3.675007E-08	34	394.1917	0.04580111	10798.56	523.1259	1.76064E-13	31	843.0572	JAK3	JAK3_E64_F	47157314	NM_000215.2	JAK3	3718	19	36.1	17819736	64	Y	CCAGTGTCTGGGCCGAGCCCTGCGGCATCGCCAGCTCTTACCTAGCGGGC	JAKL, LJAK, JAK-3, L-JAK, JAK3_HUMAN	TYROSINE-PROTEIN KINASE JAK3; LEUKOCYTE JANUS KINASE; go_component: cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: Janus kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	Janus kinase 3
JAK3_P1075_R	4989	0.4701551	631.5904	649.173	0.6027648	33	46.8883	0.8558972	2695.65	16604.73	3.678E-38	23	1500.371	0.8843361	2656.501	21075.49	3.678E-38	31	710.2936	0.2074531	472.8662	149.9505	0.7626252	28	28.77593	0.8553933	2475.263	15233.47	1.372731E-34	37	912.1543	0.853242	2225.986	13523.14	2.634202E-31	25	635.355	0.851896	2602.2	15543.08	1.1371E-28	33	918.345	0.8365234	3716.661	19530.17	3.764007E-33	25	846.5834	0.8401325	1776.28	9860.193	1.488554E-14	30	669.1312	0.8406931	3439.22	18677.14	3.678E-38	23	696.8496	JAK3	JAK3_P1075_R	47157314	NM_000215.2	JAK3	3718	19	36.1	17820875	-1075	N	GGACAGGCACAGACTGGAACTTGGACCCGAGGCAGGACAGGGAGCTGGC	JAKL, LJAK, JAK-3, L-JAK, JAK3_HUMAN	TYROSINE-PROTEIN KINASE JAK3; LEUKOCYTE JANUS KINASE; go_component: cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: Janus kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	Janus kinase 3
JAK3_P156_R	4990	0.4548029	4359.613	3720.205	3.167277E-09	34	425.9539	0.05318939	11656.43	660.446	4.500514E-15	39	603.6803	0.05526701	14485.3	853.2421	5.443973E-26	38	720.9158	0.3628407	4147.618	2418.875	0.000727677	36	217.6042	0.05960943	11056.41	707.1822	9.237414E-15	29	879.0304	0.05032122	12825.83	684.9091	1.114852E-22	26	726.9523	0.04772144	13136.32	663.3102	3.450609E-16	37	563.7051	0.06613691	15458.29	1101.85	1.924022E-16	34	744.4141	0.07996126	11615.43	1018.197	2.747227E-17	21	752.3991	0.04443704	15842.87	741.3997	7.939174E-30	22	835.2886	JAK3	JAK3_P156_R	47157314	NM_000215.2	JAK3	3718	19	36.1	17819956	-156	N	GCAGAAAGTTCCGGAAGCCTCTGCATCAGCCGCCCCGTTCAGACAGGCTGCTGGA	JAKL, LJAK, JAK-3, L-JAK, JAK3_HUMAN	TYROSINE-PROTEIN KINASE JAK3; LEUKOCYTE JANUS KINASE; go_component: cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: Janus kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	Janus kinase 3
JUNB_P1149_R	4230	0.5614865	5158.535	6733.195	1.646401E-20	30	663.7642	0.2617277	11237.61	4019.34	1.924299E-23	37	527.6244	0.2411685	12290.02	3937.742	2.883363E-29	36	657.069	0.499617	4189.307	4282.741	4.645066E-06	30	529.3523	0.2682454	9033.363	3348.094	2.08365E-16	23	1204.689	0.2387588	11233.72	3554.754	2.009886E-27	19	1253.331	0.3085992	10317.49	4649.733	3.611097E-19	40	743.6548	0.2830971	14051.35	5588.212	2.284906E-23	20	861.5682	0.2633005	8785.316	3175.662	2.048282E-15	26	1286.258	0.2681122	12409.53	4582.612	2.207831E-31	21	641.4998	JUNB	JUNB_P1149_R	44921611	NM_002229.2	JUNB	3726	19	36.1	12762161	-1149	Y	GGCTGTTGCCACACTTCCTGCCTCTGCGCTCTTTCCCCAGCCTGTTTCTAAGG	.	go_component: nucleus; go_component: chromatin; go_function: transcription factor activity; go_function: transcription coactivator activity; go_function: transcription corepressor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription from RNA polymerase II promoter	jun B proto-oncogene
KCNK4_E3_F	3534	0.1017374	5131.146	592.4805	0.0001056808	31	181.355	0.6789736	3339.245	7274.03	3.915616E-11	17	602.6158	0.6020353	6990.114	10725.82	3.284465E-35	37	857.4704	0.3466784	3453.725	1885.748	0.008686659	28	123.1393	0.5924685	5245.121	7770.727	3.376305E-18	22	703.853	0.7325633	3727.821	10485.18	3.156097E-25	34	807.3785	0.4737293	6669.724	6093.853	8.982454E-14	33	578.1234	0.5537016	7547.051	9487.339	2.009202E-17	35	901.3187	0.6005848	4328.271	6658.616	6.53305E-13	27	798.8566	0.5279924	6992.276	7933.492	6.26839E-24	28	581.9132	KCNK4	KCNK4_E3_F	15718764	NM_016611.2	KCNK4	50801	11	36.1	63815454	3	Y	GAGATGCCAGATTAGCGTGGTGCCTGTCCGGAGAGACGGGCCAGCTGATG	TRAAK, DKFZP566E164	isoform 1 is encoded by transcript variant 1; potassium inwardly-rectifying channel subfamily K member 4; TWIK-related arachidonic acid-stimulated potassium channel protein; tandem pore domain potassium channel TRAAK; 2P domain potassium channel; two pore K+ channel KT4.1; go_component: membrane; go_component: integral to membrane; go_function: potassium ion binding; go_function: potassium channel activity; go_function: voltage-gated ion channel activity; go_process: ion transport; go_process: potassium ion transport	potassium channel, subfamily K, member 4 isoform 1
KCNK4_P171_R	1262	0.7157439	498.5573	1507.14	0.3495439	21	56.16127	0.6757014	2450.779	5314.748	5.02449E-06	24	259.3403	0.6780227	2657.872	5807.551	1.400741E-07	31	285.8449	0.2858919	339.2123	175.8379	0.7839059	29	17.48314	0.6163537	2602.328	4341.472	3.555793E-05	28	197.2788	0.7084465	2228.784	5658.718	1.811499E-07	21	237.5848	0.6522276	2677.843	5209.689	2.843075E-05	31	269.8741	0.6846861	2639.836	5949.396	0.0001473773	35	251.4531	0.704294	2421.015	6004.396	1.703573E-07	25	242.522	0.5495573	2924.365	3689.842	0.0001142981	26	155.2238	KCNK4	KCNK4_P171_R	15718764	NM_016611.2	KCNK4	50801	11	36.1	63815280	-171	N	AGGTGGGTCCCAACCTCCACGTCGGCCAATTCCAGGTGGCCCC	TRAAK, DKFZP566E164	isoform 1 is encoded by transcript variant 1; potassium inwardly-rectifying channel subfamily K member 4; TWIK-related arachidonic acid-stimulated potassium channel protein; tandem pore domain potassium channel TRAAK; 2P domain potassium channel; two pore K+ channel KT4.1; go_component: membrane; go_component: integral to membrane; go_function: potassium ion binding; go_function: potassium channel activity; go_function: voltage-gated ion channel activity; go_process: ion transport; go_process: potassium ion transport	potassium channel, subfamily K, member 4 isoform 1
KCNQ1_E349_R	3536	0.1182296	5666.949	773.2441	6.97856E-06	37	223.7579	0.07771616	10345.41	880.1818	1.792175E-12	29	536.6094	0.07622577	12235.73	1017.89	4.083217E-19	25	455.8419	0.08544832	6674.092	632.9164	0.000121714	28	394.243	0.0896401	9776.78	972.5336	2.8954E-12	31	744.8635	0.09260598	9725.668	1002.779	5.287852E-14	20	656.8586	0.09238133	10171.35	1045.462	1.446254E-10	25	825.8066	0.08934677	12997.97	1285.078	3.663617E-12	37	558.8295	0.09919435	8398.504	935.8329	3.178921E-09	33	642.2892	0.1067093	9598.036	1158.493	3.901755E-12	19	513.9672	KCNQ1	KCNQ1_E349_R	32479522	NM_181797.1	KCNQ1	3784	11	36.1	2423146	349	Y	AGTTGCCTCCGACCTTGGCCCGCGGCCGCCGGTGAGCCTAGACCC	LQT, RWS, WRS, LQT1, ATFB1, KCNA8, KCNA9, Kv1.9, Kv7.1, KVLQT1	isoform 3 is encoded by transcript variant 3; kidney and cardiac voltage dependend K+ channel; slow delayed rectifier channel subunit; long (electrocardiographic) QT syndrome, Ward-Romano syndrome 1; go_component: membrane; go_component: membrane fraction; go_component: integral to membrane; go_component: voltage-gated potassium channel complex; go_component: voltage-gated potassium channel complex; go_function: potassium ion binding; go_function: voltage-gated potassium channel activity; go_function: delayed rectifier potassium channel activity; go_process: cation transport; go_process: muscle contraction; go_process: potassium ion transport; go_process: potassium ion transport; go_process: sensory perception of sound; go_process: regulation of heart contraction	potassium voltage-gated channel, KQT-like subfamily, member 1 isoform 3
KCNQ1_P546_R	1267	0.4604906	1376.592	1260.324	0.1710645	19	115.7604	0.3696443	3723.406	2242.067	0.0009797693	38	341.1811	0.3597542	4259.515	2449.612	8.124799E-05	24	246.0535	0.1649179	2579.542	529.1749	0.1799282	30	180.0698	0.4162031	3388.413	2486.975	0.0008030847	18	306.2215	0.375751	3962.687	2445.432	5.529171E-05	23	186.0921	0.4226819	3983.345	2989.61	0.0003377413	20	294.4781	0.3893953	4443.004	2897.168	0.001801957	32	286.4382	0.4467548	2868.707	2397.281	0.004154339	24	549.4404	0.3733617	4041.398	2467.515	0.0001561612	30	176.9888	KCNQ1	KCNQ1_P546_R	32479522	NM_181797.1	KCNQ1	3784	11	36.1	2422251	-546	Y	TTACCCCTTCCTCCCTGGCGCAGCTGGGGTCCTCCTCCGGGCC	LQT, RWS, WRS, LQT1, ATFB1, KCNA8, KCNA9, Kv1.9, Kv7.1, KVLQT1	isoform 3 is encoded by transcript variant 3; kidney and cardiac voltage dependend K+ channel; slow delayed rectifier channel subunit; long (electrocardiographic) QT syndrome, Ward-Romano syndrome 1; go_component: membrane; go_component: membrane fraction; go_component: integral to membrane; go_component: voltage-gated potassium channel complex; go_component: voltage-gated potassium channel complex; go_function: potassium ion binding; go_function: voltage-gated potassium channel activity; go_function: delayed rectifier potassium channel activity; go_process: cation transport; go_process: muscle contraction; go_process: potassium ion transport; go_process: potassium ion transport; go_process: sensory perception of sound; go_process: regulation of heart contraction	potassium voltage-gated channel, KQT-like subfamily, member 1 isoform 3
KDR_E79_F	800	0.3214549	4408.937	2136.069	4.538432E-06	35	413.8984	0.1236775	10051.19	1432.661	4.599752E-13	28	693.445	0.09009049	14026.58	1398.678	2.663791E-26	27	724.0571	0.3429464	4259.019	2275.171	0.0007827565	32	492.7031	0.116727	10472.93	1397.243	4.878947E-15	39	504.2255	0.1458403	11320.33	1949.921	7.701162E-22	26	976.6685	0.1247705	11665.97	1677.327	4.249183E-15	31	504.5013	0.130998	13463.68	2044.662	2.236993E-14	32	647.5649	0.11876	9547.95	1300.203	1.418188E-12	32	634.2875	0.1021894	13965.88	1600.989	3.972746E-26	33	566.4706	KDR	KDR_E79_F	11321596	NM_002253.1	KDR	3791	4	36.1	55686440	79	Y	AGGCTGCCAGACGGACTTTCTGCGGCGCGCAAGTGATGCCCGGCGCAGGCAGA	FLK1, CD309, VEGFR, VEGFR2	vascular endothelial growth factor receptor 2; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_process: angiogenesis; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	kinase insert domain receptor (a type III receptor tyrosine kinase)
KDR_P445_R	4232	0.06998352	2964.419	230.5968	0.07379237	24	160.1136	0.06484996	10157.1	711.3	1.109574E-11	24	755.9363	0.05774796	13318.52	822.3832	6.654893E-22	24	688.9386	0.7609754	1612.544	5452.175	0.0002238982	29	352.1587	0.05924756	9421.031	599.6241	1.248782E-10	29	779.3361	0.1153455	12784.19	1679.903	3.572218E-26	24	630.8492	0.06945063	11357.43	855.1142	1.414425E-12	38	608.433	0.06148431	14329.15	945.2866	6.14186E-14	32	568.9951	0.07068788	9303.346	715.263	1.150395E-10	42	631.8029	0.05238635	15637.73	870.0197	1.538218E-29	17	630.3656	KDR	KDR_P445_R	11321596	NM_002253.1	KDR	3791	4	36.1	55686964	-445	Y	TGCAGCAGTTTGGAGCCACAAGGGAGAAGCGGATACTCAGCCAAGTATGCCGGGTC	FLK1, CD309, VEGFR, VEGFR2	vascular endothelial growth factor receptor 2; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_process: angiogenesis; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	kinase insert domain receptor (a type III receptor tyrosine kinase)
KIAA0125_E29_F	2797	0.742018	791.1088	2563.042	0.05589972	24	129.6485	0.9166632	1049.139	12639.96	9.891269E-19	26	1225.856	0.9421395	1079.51	19205.91	3.678E-38	28	998.6161	0.7308011	560.3646	1792.709	0.3372283	31	73.51299	0.9259281	1026.274	14078.86	8.257338E-25	28	917.3421	0.9134122	1421.949	16054.99	3.678E-38	36	899.9924	0.9225466	1260.502	16204.92	1.81852E-26	27	788.7007	0.9093706	1567.449	16731.1	3.434431E-20	35	1001.072	0.8955871	1212.282	11255.92	8.13382E-17	28	682.8404	0.9358867	1043.045	16685.48	2.688523E-34	28	1359.057	KIAA0125	KIAA0125_E29_F	20302136	NM_014792.2	KIAA0125	9834	14	36.1	105461686	29	N	TTTCAAGTATGGCAGACAAAGGATGTTCTGCGTGGGGAAATGTGGTGACA	.	.	hypothetical protein LOC9834
KIAA1804_P689_R	2039	0.03418582	6788.5	243.8244	5.497163E-07	31	265.4901	0.1193319	13694.33	1869.154	1.980805E-24	21	866.6544	0.08871885	16980.31	1662.874	3.678E-38	35	780.2495	0.03985517	3650.307	155.6735	0.08488426	33	140.7706	0.1015066	13905.48	1582.258	3.86348E-26	24	958.9025	0.173632	14166.8	2997.663	1.606488E-37	34	763.3354	0.1061237	14760.07	1764.233	1.434189E-23	27	917.119	0.1126238	18012.94	2298.853	4.705209E-25	30	690.6937	0.1477463	9271.702	1624.674	1.084657E-12	28	962.1855	0.1149885	16431.94	2147.976	7.770397E-38	27	718.0226	KIAA1804	KIAA1804_P689_R	24308329	NM_032435.1	KIAA1804	84451	1	36.1	231529448	-689	Y	GCACTGGCCCAGGTCTGGCACCGCGCTACAATTTCTTCTGTAGCCCGTTCTGA	MLK4, dJ862P8.3	RP5-862P8.2; go_function: ATP binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation	mixed lineage kinase 4
KIT_P367_R	4019	0.06345981	4056.454	281.6407	0.006785798	32	152.3461	0.1180363	8614.962	1166.354	1.88565E-09	22	789.6129	0.1012171	12512.54	1420.371	3.126033E-21	22	809.9602	0.154603	656.8431	138.4086	0.726306	30	35.25436	0.1017701	10721.19	1226.048	3.062692E-15	25	827.1813	0.1777675	9772.531	2134.451	2.110868E-17	22	916.2078	0.1143472	9910.792	1292.5	1.535237E-10	39	768.2928	0.1077763	13349.15	1624.592	2.193349E-13	28	708.9556	0.1159606	7511.772	998.4456	1.199384E-07	25	485.2271	0.114864	13980.96	1827.286	5.5573E-27	42	640.7771	KIT	KIT_P367_R	4557694	NM_000222.1	KIT	3815	4	36.1	55218551	-367	Y	GCGTGGTGCCCAGCTTCACAAAGCGAGCGGGCAGCACCTCCTTGGTCCG	PBT, SCFR, C-Kit, CD117	go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_function: receptor signaling protein tyrosine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: protein amino acid dephosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog precursor
KIT_P405_F	4020	0.0730236	7679.189	612.8143	1.004903E-09	38	351.6649	0.07681634	11574.88	971.4444	1.179704E-15	23	811.5623	0.05353743	14953.12	851.4919	1.107962E-27	32	933.1742	0.03615426	7859.659	298.5702	1.182651E-05	26	312.3513	0.06342291	13437.38	916.721	2.63016E-22	28	1112.974	0.09032869	12111.07	1212.537	5.032881E-22	33	1128.826	0.05706841	13427.41	818.7105	2.694983E-17	39	971.9409	0.05343438	17797.94	1010.353	2.27799E-21	25	595.3962	0.08693784	8817.544	849.0901	6.566227E-10	31	602.0816	0.04419173	15436.29	718.3192	3.11641E-28	32	1087.452	KIT	KIT_P405_F	4557694	NM_000222.1	KIT	3815	4	36.1	55218513	-405	Y	GAGCACCTGGCAGGTGGCGGGCCCGTGCCCTAACGTGTGCGTGGTG	PBT, SCFR, C-Kit, CD117	go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_function: receptor signaling protein tyrosine kinase activity; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: protein amino acid dephosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog precursor
KLF5_E190_R	3539	0.6345403	4738.899	8401.682	2.76441E-25	26	1009.682	0.03517889	12919.27	474.7029	6.585438E-18	29	950.8989	0.03064516	21714.15	689.632	3.678E-38	26	1154.309	0.5883148	3104.675	4579.61	4.492419E-05	32	217.397	0.03994792	14352.68	601.3783	2.702542E-24	40	1181.678	0.04715436	17707.38	881.2504	3.678E-38	26	1523.27	0.0380082	16839.81	669.2902	1.321069E-26	20	926.4644	0.03847431	21552.57	866.4018	9.562763E-31	31	979.3608	0.04896226	13009.74	674.9288	1.895338E-20	35	804.5516	0.05721426	22098.98	1347.176	3.678E-38	26	1274.201	KLF5	KLF5_E190_R	52630441	NM_001730.3	KLF5	688	13	36.1	72531333	190	Y	GCGCCTTCGAAAACTGCCTGCCGCTGTCTGAGGAGTCCACCCGAAACC	CKLF, IKLF, BTEB2	GC box binding protein 2; basic transcription element binding protein 2; intestinal-enriched kruppel-like factor; colon kruppel-like factor; transcription factor BTEB2; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	Kruppel-like factor 5
KLF5_P13_F	1270	0.05489018	5744.768	339.453	2.826428E-05	32	243.7184	0.05845043	11527.37	721.8154	6.644857E-15	32	724.817	0.04726651	14702.86	734.3917	2.412208E-26	33	536.5129	0.04301022	4613.025	211.8186	0.02061622	27	350.3473	0.0634734	13206.92	901.8809	1.609799E-21	32	566.3861	0.06499486	11483.61	805.2098	1.368586E-18	30	710.3527	0.0794301	12052.18	1048.534	1.552262E-14	30	739.2847	0.07265915	13966.68	1102.155	1.471062E-13	31	762.8402	0.08139433	9792.555	876.5435	3.791719E-12	21	949.3059	0.0608332	15539.17	1013.005	1.048174E-29	28	782.8681	KLF5	KLF5_P13_F	52630441	NM_001730.3	KLF5	688	13	36.1	72531130	-13	Y	AGTTGGGTGAAATAGAGGCGGGCGTCAAGTGTCAGTAGTCGCGGGGC	CKLF, IKLF, BTEB2	GC box binding protein 2; basic transcription element binding protein 2; intestinal-enriched kruppel-like factor; colon kruppel-like factor; transcription factor BTEB2; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	Kruppel-like factor 5
KLK10_E77_R	3541	0.03199009	7752.426	259.5013	4.539443E-09	34	223.8693	0.08189738	10253.02	923.5192	2.31123E-12	33	466.3604	0.1061327	12655.18	1514.477	5.362592E-22	30	652.0275	0.1327294	1048.443	175.7608	0.6256462	25	82.22969	0.08421372	10071.74	935.3715	7.105937E-13	21	622.3962	0.1167499	10057.14	1342.592	6.871013E-16	36	685.2811	0.1271674	11355.96	1669.077	2.312532E-14	36	565.8405	0.1246598	14419.03	2067.698	2.712227E-16	33	565.6281	0.1012068	8703.026	991.2466	5.742043E-10	29	717.9225	0.1005455	12505.54	1409.11	1.135359E-20	37	576.3188	KLK10	KLK10_E77_R	22208981	NM_002776.3	KLK10	5655	19	36.1	56215017	77	N	CTGGCTTCCGTGGGGATTCTCCGGGTCCCGGTGCCAAGAAGG	NES1, PRSSL1	protease, serine-like, 1; normal epithelial cell-specific 1; breast normal epithelial cell associated serine protease; go_component: extracellular region; go_function: serine-type endopeptidase activity; go_process: cell cycle; go_process: proteolysis; go_process: negative regulation of progression through cell cycle	kallikrein 10 precursor
KLK10_P268_R	1272	0.1794907	4400.395	984.4847	0.000333611	24	200.8739	0.2010417	8773.013	2232.714	5.548824E-12	31	535.5811	0.1729271	11785.97	2485.157	2.493424E-22	31	539.8118	0.1443705	5415.91	930.7	0.001185892	29	214.0491	0.1655508	10239.51	2051.31	3.684492E-16	31	433.8608	0.1887377	10411.21	2445.4	1.952576E-20	33	496.968	0.2071214	9415.883	2485.806	6.297983E-12	29	669.2403	0.2143108	11495.26	3162.816	8.092554E-13	40	682.2205	0.1821706	7728.344	1743.755	1.66629E-09	27	621.1065	0.1924715	12247.94	2943.088	7.946062E-25	33	416.0945	KLK10	KLK10_P268_R	22208981	NM_002776.3	KLK10	5655	19	36.1	56215362	-268	N	AACAGAAACAAGGAAAAAGGGAAACCCACGCCCACTCTGTGGCCGTGAGTGA	NES1, PRSSL1	protease, serine-like, 1; normal epithelial cell-specific 1; breast normal epithelial cell associated serine protease; go_component: extracellular region; go_function: serine-type endopeptidase activity; go_process: cell cycle; go_process: proteolysis; go_process: negative regulation of progression through cell cycle	kallikrein 10 precursor
KLK11_P103_R	4997	0.169462	3601.238	755.1964	0.006481652	20	129.7104	0.7812085	2323.137	8651.962	6.48179E-12	37	402.8289	0.8213108	2190.793	10529.19	1.546564E-17	37	591.2833	0.04215259	3270.136	148.3117	0.131617	34	146.2779	0.8180738	1836.771	8709.147	8.53774E-12	22	386.5962	0.725616	2889.493	7905.795	3.478138E-14	41	412.4019	0.7816216	2373.154	8851.935	1.394304E-10	37	430.6227	0.8291869	2083.788	10600.87	1.389854E-09	30	325.9965	0.7704882	2048.123	7211.408	4.493359E-09	22	568.5316	0.8237277	2118.742	10368.27	1.663601E-16	29	704.5413	KLK11	KLK11_P103_R	21618356	NM_144947.1	KLK11	11012	19	36.1	56223205	-103	N	TGCAGTTGGCTAGTGGAAAGAATGCTACGTTTTATGGACATTGGATTAAATGG	TLSP, PRSS20, MGC33060	isoform 2 precursor is encoded by transcript variant 2; protease, serine, trypsin-like; protease, serine, 20 trypsin-like; hippostasin; go_function: peptidase activity; go_function: serine-type endopeptidase activity; go_process: proteolysis	kallikrein 11 isoform 2 precursor
KLK11_P1290_F	5003	0.388377	2481.56	1639.276	0.01146837	25	168.1187	0.8782781	1303.105	10124.04	6.219224E-13	38	514.5855	0.9027695	1540.253	15229.49	2.302464E-31	27	861.5636	0.1406978	988.5303	178.2304	0.6398355	28	87.44769	0.9097615	1168.388	12787.57	4.890418E-21	29	637.028	0.8632108	1693.352	11316.98	5.952081E-21	25	538.4399	0.8730204	1759.968	12787.79	4.568959E-18	34	565.3871	0.8876089	1758.862	14680.37	3.383691E-16	33	616.2704	0.8647879	1406.518	9635.37	4.789471E-13	32	711.5945	0.9198781	1245.909	15452.37	2.945107E-30	32	704.053	KLK11	KLK11_P1290_F	21618356	NM_144947.1	KLK11	11012	19	36.1	56224392	-1290	N	GGTCAGTTGTTCCTCATGATCATCCGGATCCAGTCCACATACTTGCAAATATAG	TLSP, PRSS20, MGC33060	isoform 2 precursor is encoded by transcript variant 2; protease, serine, trypsin-like; protease, serine, 20 trypsin-like; hippostasin; go_function: peptidase activity; go_function: serine-type endopeptidase activity; go_process: proteolysis	kallikrein 11 isoform 2 precursor
KRAS_E82_F	3561	0.09616388	3532.475	386.4781	0.01811707	24	193.4114	0.1944699	7895.399	1930.238	1.548095E-09	30	525.9707	0.7271739	6297.849	17052.43	3.678E-38	28	697.8063	0.2840233	3978.885	1618.068	0.005423646	23	291.8829	0.6190823	5938	9813.195	4.464714E-27	23	1145.332	0.6846917	6561.374	14465.17	3.678E-38	22	1457.936	0.2819769	9104.936	3614.897	1.123706E-13	29	695.4238	0.2824791	11570.43	4594.503	1.197228E-15	28	722.4584	0.7319871	2855.473	8071.883	9.123629E-13	28	1057.994	0.7436032	5203.4	15380.95	3.678E-38	26	1090.268	KRAS	KRAS_E82_F	34485724	NM_033360.2	KRAS	3845	12	36.1	25295039	82	Y	TCGCTCCCAGTCCGAAATGGCGGGGGCCGGGAGTACTGGCCGAGCCGC	KRAS1, KRAS2, RASK2, KI-RAS, C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B	isoform a is encoded by transcript variant a; Kirsten rat sarcoma-2 viral (v-Ki-ras2) oncogene homolog; v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog; transforming protein p21; c-Kirsten-ras protein; K-ras p21 protein; oncogene KRAS2; c-K-ras protein; PR310 c-K-ras oncogene; cellular c-Ki-ras2 proto-oncogene; go_component: membrane; go_function: GTP binding; go_function: GTPase activity; go_function: nucleotide binding; go_process: small GTPase mediated signal transduction; go_process: regulation of progression through cell cycle	c-K-ras2 protein isoform a
KRAS_P651_F	1285	0.3261253	7388.675	3624.184	1.807254E-17	20	720.5134	0.1491014	12234.72	2161.391	8.732185E-21	28	835.463	0.1449861	15314.74	2613.903	4.166908E-36	23	924.347	0.2558818	5842.661	2043.518	2.573126E-05	32	451.625	0.2081376	11927.13	3161.28	9.421032E-25	23	720.6176	0.1226792	14264.28	2008.615	1.546893E-33	35	1081.835	0.1593753	11534.95	2205.887	4.794201E-16	40	857.5168	0.2130301	15164.79	4132.129	1.56417E-22	29	729.22	0.2196148	7582.956	2162.126	4.482015E-10	21	1133.842	0.1455242	15619.56	2677.169	1.223915E-36	40	619.7521	KRAS	KRAS_P651_F	34485724	NM_033360.2	KRAS	3845	12	36.1	25295772	-651	Y	CACACCGGGGCTGTCTGATCGCCGCCCCGATTATTATCAGCCTCAGCAC	KRAS1, KRAS2, RASK2, KI-RAS, C-K-RAS, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B	isoform a is encoded by transcript variant a; Kirsten rat sarcoma-2 viral (v-Ki-ras2) oncogene homolog; v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog; transforming protein p21; c-Kirsten-ras protein; K-ras p21 protein; oncogene KRAS2; c-K-ras protein; PR310 c-K-ras oncogene; cellular c-Ki-ras2 proto-oncogene; go_component: membrane; go_function: GTP binding; go_function: GTPase activity; go_function: nucleotide binding; go_process: small GTPase mediated signal transduction; go_process: regulation of progression through cell cycle	c-K-ras2 protein isoform a
KRT1_P798_R	5013	0.4977958	2148.925	2229.183	0.0061378	36	155.9506	0.8093668	2572.763	11347.68	2.16664E-19	36	671.674	0.808567	2929.116	12794.26	2.204864E-27	38	723.5737	0.3716512	2107.162	1305.476	0.1324318	19	213.1518	0.8215805	2314.949	11120.28	1.947032E-19	36	634.3314	0.7731639	2697.785	9536.165	2.040065E-18	38	653.0283	0.8159419	2434.595	11236.03	7.085523E-16	35	584.9456	0.8331373	2912.844	15042.98	2.031741E-19	28	778.7411	0.7905712	2358.538	9280.712	1.463901E-14	24	686.0525	0.7961642	3142.939	12666.63	5.497494E-27	28	498.7745	KRT1	KRT1_P798_R	17318568	NM_006121.2	KRT1	3848	12	36.1	51361244	-798	N	TTGAGTGAAAAAGCCCACAGAGCAGTGAGACGAGTAAATAGAAGCTCTAGGACATTTTG	K1, CK1, EHK1, KRT1A	Keratin-1; cytokeratin 1; hair alpha protein; go_component: membrane; go_component: cytoskeleton; go_component: intermediate filament; go_function: sugar binding; go_function: protein binding; go_function: protein binding; go_function: receptor activity; go_function: structural constituent of cytoskeleton; go_process: fibrinolysis; go_process: epidermis development; go_process: regulation of angiogenesis; go_process: response to oxidative stress; go_process: complement activation, lectin pathway	keratin 1
KRT13_P341_R	2312	0.7272323	1256.271	3615.988	0.001613839	28	177.0813	0.9454814	900.1932	17345.72	5.344948E-34	19	1244.509	0.9450104	903.5297	17245.93	4.747653E-37	29	701.0368	0.4514241	767.145	713.5752	0.5604479	24	76.42232	0.9356153	843.5619	13711.5	5.809169E-23	26	755.5648	0.9431862	900.318	16606.63	3.678E-38	22	1270.554	0.9343634	961.0657	15104.7	3.186842E-22	30	774.9675	0.9419335	1012.453	18045.81	5.842282E-22	32	759.0938	0.9190905	661.3222	8648.233	3.566365E-09	22	511.0358	0.9420355	779.3589	14291.28	2.039037E-24	28	686.0407	KRT13	KRT13_P341_R	24234693	NM_002274.2	KRT13	3860	17	36.1	36915732	-341	N	GCGGAGGCCTGCCAGGAGCTTCTGCGAGGAAAGTGGTGGGTGCA	K13, CK13, MGC3781	isoform b is encoded by transcript variant 2; keratin, type I cytoskeletal 13; cytokeratin 13; go_component: intermediate filament; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton; go_process: epidermis development	keratin 13 isoform b
KRT13_P676_F	2297	0.231995	1896.681	603.1473	0.2039472	29	86.98772	0.7805331	2510.618	9284.655	8.514034E-14	21	719.5461	0.7837237	2506.529	9445.316	2.147445E-15	31	655.5907	0.06419017	3458.737	244.1051	0.09589485	24	185.9738	0.7372181	2208.162	6475.403	5.665982E-08	21	323.553	0.800468	2084.075	8761.911	2.526307E-14	26	633.037	0.7645482	2439.237	8245.297	1.424237E-09	26	740.7073	0.6948993	3579.44	8380.315	1.576342E-08	24	635.1924	0.7639726	2217.409	7500.979	5.106011E-10	26	597.2392	0.7717052	2441.365	8590.579	8.81861E-13	29	485.608	KRT13	KRT13_P676_F	24234693	NM_002274.2	KRT13	3860	17	36.1	36916067	-676	N	GAAGTGGCCCTGTCCATTATCATAGCGAATATTCTCCGAGCCCTCACCATA	K13, CK13, MGC3781	isoform b is encoded by transcript variant 2; keratin, type I cytoskeletal 13; cytokeratin 13; go_component: intermediate filament; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton; go_process: epidermis development	keratin 13 isoform b
KRT5_E196_R	2803	0.7042791	476.9733	1374.101	0.401859	24	69.21128	0.9683591	553.754	20007.9	3.678E-38	18	1751.264	0.9713225	548.9619	21980.74	3.678E-38	25	1139.15	0.9007736	466.2735	5140.613	0.00532321	38	230.8969	0.9692612	476.2079	18169.05	3.678E-38	26	1449.093	0.9714864	496.5555	20325.27	3.678E-38	22	1501.749	0.9635462	585.0579	18107.41	1.637528E-30	27	1476.18	0.9705526	597.0159	22972.88	4.086033E-34	22	1437.454	0.9357151	655.6758	10999.43	1.330594E-14	24	699.2263	0.968376	523.3185	19086.96	3.678E-38	39	811.6565	KRT5	KRT5_E196_R	17318577	NM_000424.2	KRT5	3852	12	36.1	51200314	196	Y	GCGGTGCTGAAGCTACGACTGCCCCCGCTCCGGAAGGACACACTTGACTG	K5, CK5, DDD, EBS2, KRT5A	Keratin-5; 58 kda cytokeratin; keratin, type II cytoskeletal 5; cytokeratin 5; go_component: intermediate filament; go_component: intermediate filament; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton; go_process: epidermis development	keratin 5
KRT5_P308_F	2049	0.3872851	1993.947	1323.543	0.05968383	37	150.7629	0.8536956	1819.478	11200.28	6.818786E-17	31	727.4317	0.8444533	2302.257	13041.71	5.206624E-26	23	896.6569	0.3963779	1302.11	920.7175	0.3689573	25	123.6725	0.8440267	1935.136	11012.84	5.306621E-18	34	656.5784	0.8459721	1906.525	11020.5	1.135375E-20	33	883.4962	0.8625011	1996.566	13151.3	1.180515E-19	28	657.6284	0.8435324	2552.287	14298.74	4.853583E-17	34	627.9138	0.859773	1678.133	10902.25	3.902981E-17	22	1121.039	0.846226	2221.792	12776.94	3.565895E-24	35	534.0209	KRT5	KRT5_P308_F	17318577	NM_000424.2	KRT5	3852	12	36.1	51200818	-308	N	GAGTATTGACAACCATCCCAGTACGGTACATGCTGAGCACCTGCCCTTCCAG	K5, CK5, DDD, EBS2, KRT5A	Keratin-5; 58 kda cytokeratin; keratin, type II cytoskeletal 5; cytokeratin 5; go_component: intermediate filament; go_component: intermediate filament; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton; go_process: epidermis development	keratin 5
L1CAM_P148_R	5806	0.2003698	1698.812	450.743	0.3032914	32	69.42239	0.05598283	7173.457	431.3361	8.606754E-06	30	327.1767	0.03543916	9681.387	359.3803	1.003935E-10	31	330.5696	0.1936918	592.3839	166.3248	0.7342264	25	46.23679	0.1323036	9102.266	1403.132	1.056024E-11	36	491.9459	0.1112677	10434.18	1318.86	6.186579E-17	35	640.4105	0.1158265	8567.273	1135.411	6.894836E-08	22	533.5709	0.1014737	13232.39	1505.674	5.830531E-13	22	391.4594	0.1172861	6931.647	934.2944	1.552043E-06	29	371.818	0.1128786	9626.224	1237.578	2.197519E-12	26	574.9123	L1CAM	L1CAM_P148_R	13435352	NM_024003.1	L1CAM	3897	X	36.1	152794653	-148	Y	AAGAGAGACGAGAGAACGGAAGGACGTTAGTGACTAACATCTGGGTAAGCCCG	S10, HSAS, MASA, MIC5, SPG1, CAML1, CD171, HSAS1, N-CAML1	isoform 2 precursor is encoded by transcript variant 2; neural cell adhesion molecule L1; L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1, MASA (mental retardation, aphasia, shuffling gait and adducted thumbs) syndrome, spastic paraplegia 1); antigen identified by monoclonal antibody R1; go_component: integral to membrane; go_function: protein binding; go_process: cell adhesion; go_process: cell differentiation; go_process: nervous system development	L1 cell adhesion molecule isoform 2 precursor
L1CAM_P19_F	5719	0.1237652	4042.15	585.0648	0.00320084	21	174.1408	0.1493493	7082.94	1261.114	6.483389E-07	32	306.4225	0.1040169	7704.679	906.0643	7.634498E-08	22	237.9831	0.0713053	4385.775	344.4184	0.02390196	19	189.4321	0.5598305	4779.11	6205.507	8.044932E-13	29	497.2404	0.662203	4303.017	8631.486	1.071602E-20	34	599.8593	0.7414459	3646.787	10744.52	1.153097E-17	24	680.6226	0.6016102	6128.705	9405.997	1.994196E-14	22	547.1926	0.6400115	4381.63	7967.741	1.756009E-16	31	559.4106	0.6456261	3974.409	7423.079	1.145973E-13	29	376.9008	L1CAM	L1CAM_P19_F	13435352	NM_024003.1	L1CAM	3897	X	36.1	152794524	-19	Y	CAGCACAGCCAGCCGGGCTCGGTTCAGGCTCCGGCCGGAGGGG	S10, HSAS, MASA, MIC5, SPG1, CAML1, CD171, HSAS1, N-CAML1	isoform 2 precursor is encoded by transcript variant 2; neural cell adhesion molecule L1; L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1, MASA (mental retardation, aphasia, shuffling gait and adducted thumbs) syndrome, spastic paraplegia 1); antigen identified by monoclonal antibody R1; go_component: integral to membrane; go_function: protein binding; go_process: cell adhesion; go_process: cell differentiation; go_process: nervous system development	L1 cell adhesion molecule isoform 2 precursor
LAMB1_E144_R	742	0.05181628	7033.26	389.818	8.866983E-08	33	271.0797	0.07737371	10446.96	884.4938	1.030674E-12	32	464.8896	0.1053384	11726.5	1392.465	1.03808E-18	26	504.9627	0.3071901	4351.13	1973.619	0.001243578	28	210.5226	0.08012634	9570.895	842.3911	1.706221E-11	29	580.9008	0.1025144	9854.837	1137.082	9.96783E-15	28	797.0657	0.1041173	10842.27	1271.684	2.282374E-12	28	832.908	0.1131565	13404.27	1723.073	1.148901E-13	31	472.018	0.1283879	9537.073	1419.535	7.744763E-13	33	509.7062	0.07951428	11759.7	1024.476	2.48737E-17	24	575.7012	LAMB1	LAMB1_E144_R	4504950	NM_002291.1	LAMB1	3912	7	36.1	107430896	144	Y	GAACAGAGGGAGGCGCCTCTGCTCATGCGCATACGGAGAGCCGGGGCTG	CLM	cutis laxa with marfanoid phenotype; go_component: laminin-1; go_component: basement membrane; go_function: protein binding; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: positive regulation of epithelial cell proliferation	laminin, beta 1 precursor
LAMC1_E466_R	5629	0.05947102	4883.651	315.1236	0.000604804	29	233.6983	0.02725472	10791.24	305.1546	3.492565E-12	33	640.2275	0.02197291	12641.21	286.2512	3.841219E-18	29	662.2123	0.06915585	4384.166	333.1452	0.02438152	21	194.5854	0.02563127	13035.73	345.5422	2.826602E-19	28	802.8645	0.05639775	8434.678	510.1054	1.255154E-09	32	443.4261	0.02496608	10610.05	274.2345	6.129335E-10	36	620.8152	0.02770696	10203.94	293.6263	1.282199E-06	26	454.7588	0.04507595	8796.15	419.9312	5.485345E-09	36	503.712	0.02734535	11981.82	339.67	4.690433E-16	36	562.115	LAMC1	LAMC1_E466_R	9845497	NM_002293.2	LAMC1	3915	1	36.1	181259642	466	Y	GCTGCATGCCCGAGTTCGTCAACGCCGCCTTCAACGTGACTGTGGTGGCCACC	LAMB2, MGC87297	formerly LAMB2; go_component: laminin-1; go_component: basement membrane; go_function: protein binding; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: endoderm development; go_process: protein complex assembly; go_process: positive regulation of epithelial cell proliferation	laminin, gamma 1 precursor
LAMC1_P808_F	5022	0.2349218	1580.986	516.1567	0.3198297	25	121.215	0.1207176	5460.32	763.3822	0.0005087462	26	277.9505	0.1047355	5837.794	694.6525	0.0001396353	33	270.4244	0.777797	947.3971	3666.297	0.02853992	35	153.5864	0.1196188	5410.948	748.7816	0.0003725554	26	249.5523	0.1366723	5377.267	867.0995	9.540623E-05	31	273.7891	0.1515868	5723.065	1040.413	0.0005651159	25	348.4711	0.1393367	5668.115	933.8261	0.006353842	26	211.9613	0.1444181	5026.733	865.3679	0.0008834708	26	307.7135	0.1785706	6077.856	1343.005	8.541509E-06	33	279.9443	LAMC1	LAMC1_P808_F	9845497	NM_002293.2	LAMC1	3915	1	36.1	181258368	-808	Y	ACACAGTGGAAGAATTTCGCAGTGGGTCGTGCGTACCCAAGGGAAAAATTCATT	LAMB2, MGC87297	formerly LAMB2; go_component: laminin-1; go_component: basement membrane; go_function: protein binding; go_function: extracellular matrix structural constituent; go_process: cell adhesion; go_process: endoderm development; go_process: protein complex assembly; go_process: positive regulation of epithelial cell proliferation	laminin, gamma 1 precursor
LAT_E46_F	3562	0.1863098	4288.199	1004.761	0.0004490133	22	222.4269	0.2093509	7735.442	2074.697	1.658829E-09	29	339.4037	0.1674553	9610.8	1953.198	2.268742E-14	24	477.6966	0.317378	2106.266	1025.781	0.1759423	33	235.0382	0.1811381	8028.79	1798.146	3.227525E-10	25	484.4579	0.1872154	7143.571	1668.472	2.440482E-09	27	435.5565	0.1639098	9136.316	1810.718	4.68535E-10	19	314.6777	0.2052046	9574.125	2497.718	1.094581E-08	33	498.2632	0.2082546	6997.907	1866.979	2.640639E-08	24	480.1888	0.2118368	7910.056	2152.885	1.363545E-10	34	448.7673	LAT	LAT_E46_F	62739153	NM_014387.3	LAT	27040	16	36.1	28903694	46	N	GGGTCCTGGATATGGAGGCCACGGCTGCCAGCTGGCAGGTGGC	LAT1, pp36	isoform a is encoded by transcript variant 1; 36 kDa phospho-tyrosine adaptor protein; go_component: membrane; go_component: lipid raft; go_component: integral to membrane; go_component: immunological synapse; go_function: protein binding; go_function: protein binding; go_function: SH3/SH2 adaptor activity; go_process: immune response; go_process: signal transduction; go_process: mast cell degranulation; go_process: calcium-mediated signaling; go_process: Ras protein signal transduction; go_process: intracellular signaling cascade; go_process: regulation of T cell activation; go_process: integrin-mediated signaling pathway	linker for activation of T cells isoform a
LCK_E28_F	1646	0.1113744	5769.526	735.6474	5.349939E-06	24	255.4255	0.6658722	4362.068	8892.306	1.588674E-17	28	756.6323	0.7221429	4778.792	12679.85	3.848951E-34	34	668.864	0.3191994	4316.096	2070.525	0.001086615	28	268.7646	0.7662068	2509.417	8551.801	5.265984E-13	44	827.33	0.7106563	4224.982	10622.58	1.1809E-27	24	1563.694	0.7548479	3332.348	10568.55	1.950971E-16	31	810.0043	0.7547377	4730.43	14864.52	2.941425E-23	43	915.1403	0.7355416	3033.885	8716.315	7.481548E-15	39	720.3661	0.6639534	5190.144	10452.15	2.156494E-26	28	564.3556	LCK	LCK_E28_F	20428651	NM_005356.2	LCK	3932	1	36.1	32489548	28	Y	GTGAATGGGGCCAGAGGGCTCCCGGGCTGGGCAGGTAAGGAG	.	oncogene LCK; membrane associated protein tyrosine kinase; protein-tyrosine kinase; put. ptk (135aa); lck tyrosine kinase (AA 1-142); proto-oncogene tyrosine-protein kinase LCK; go_component: lipid raft; go_component: lipid raft; go_component: pericentriolar material; go_component: pericentriolar material; go_function: ATP binding; go_function: ATPase binding; go_function: SH2 domain binding; go_function: nucleotide binding; go_function: transferase activity; go_function: SH2 domain binding; go_function: SH2 domain binding; go_function: CD4 receptor binding; go_function: CD8 receptor binding; go_function: glycoprotein binding; go_function: glycoprotein binding; go_function: glycoprotein binding; go_function: protein kinase binding; go_function: protein C-terminus binding; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: phosphoinositide 3-kinase binding; go_function: protein serine/threonine phosphatase activity; go_function: protein serine/threonine phosphatase activity; go_process: hemopoiesis; go_process: hemopoiesis; go_process: response to drug; go_process: caspase activation; go_process: response to drug; go_process: zinc ion homeostasis; go_process: T cell differentiation; go_process: caspase activation; go_process: induction of apoptosis; go_process: zinc ion homeostasis; go_process: T cell differentiation; go_process: induction of apoptosis; go_process: Ras protein signal transduction; go_process: intracellular signaling cascade; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: Ras protein signal transduction; go_process: intracellular signaling cascade; go_process: regulation of lymphocyte activation; go_process: protein amino acid phosphorylation; go_process: regulation of lymphocyte activation; go_process: positive regulation of T cell activation; go_process: positive regulation of T cell activation; go_process: regulation of progression through cell cycle; go_process: release of sequestered calcium ion into cytosol; go_process: regulation of progression through cell cycle; go_process: positive regulation of T cell receptor signaling pathway; go_process: positive regulation of T cell receptor signaling pathway	lymphocyte-specific protein tyrosine kinase
LCN2_P141_R	5734	0.6202136	2365.722	4026.67	8.467907E-06	25	240.4083	0.9477401	779.2465	15945.24	2.290124E-28	43	1045.49	0.9587572	1014.418	25906.49	3.678E-38	30	1014.651	0.7958316	948.364	4086.437	0.01466999	36	175.7675	0.9466941	901.7219	17790.25	3.678E-38	30	1319.6	0.9385602	1093.61	18233.7	3.678E-38	22	1200.685	0.9514611	856.2402	18744.24	1.058546E-33	23	1480.678	0.952972	1082.858	23969.34	3.678E-38	28	1254.721	0.9275878	779.5332	11266.67	1.20403E-15	19	1042.482	0.9596362	934.2106	24588	3.678E-38	30	1185.877	LCN2	LCN2_P141_R	38455401	NM_005564.2	LCN2	3934	9	36.1	129951398	-141	N	AATGTCCCTCACTCTCCCCGTCCCTCTGTCTTGCCCAATCCTGAC	NGAL	go_component: cytoplasm; go_component: soluble fraction; go_function: binding; go_function: transporter activity; go_process: transport	lipocalin 2 (oncogene 24p3)
LCN2_P86_R	5739	0.6421586	630.8843	1311.597	0.370652	26	54.61789	0.9407668	725.3241	13108.13	3.847605E-19	31	758.7867	0.9516594	779.6351	17317	8.003774E-37	28	1195.888	0.8539573	443.9142	3180.437	0.1049531	33	113.6111	0.9430535	736.6339	13854.93	4.404274E-23	29	800.4125	0.9445675	820.0729	15678.01	1.604726E-34	21	1116.907	0.9477018	806.2888	16422.97	1.007961E-25	20	661.3091	0.9404494	1094.298	18860.9	3.757505E-24	42	780.6561	0.9309911	775.2155	11807.43	3.845312E-17	31	907.3752	0.9378718	1013.573	16810.22	1.102892E-34	22	1177.784	LCN2	LCN2_P86_R	38455401	NM_005564.2	LCN2	3934	9	36.1	129951453	-86	N	GCAGAAATCTTGCCAAGTGTTTCCGCAGGAGTTGCTGGCAATTGCCTCACATTCC	NGAL	go_component: cytoplasm; go_component: soluble fraction; go_function: binding; go_function: transporter activity; go_process: transport	lipocalin 2 (oncogene 24p3)
LEFTY2_P561_F	5906	0.03766848	3627.98	145.9241	0.02471742	20	210.9947	0.7093713	2796.207	7069.11	1.29636E-09	26	327.4048	0.7223848	2836.15	7640.182	1.047398E-11	26	356.0078	0.08791339	3604.121	357.0294	0.07014417	30	123.1936	0.7191939	2366.061	6316.017	5.701435E-08	38	264.1199	0.6174395	3491.799	5797.041	2.120798E-10	25	353.6827	0.7361562	2536.434	7355.969	3.37142E-08	34	289.2408	0.7339928	2672.018	7648.819	2.08578E-06	28	403.4797	0.640424	3180.607	5842.938	1.31004E-08	29	341.5987	0.7589405	2086.095	6882.598	2.131062E-08	24	361.7077	LEFTY2	LEFTY2_P561_F	27436880	NM_003240.2	LEFTY2	7044	1	36.1	224196104	-561	N	CCCATGACATCCTCTGTCTAGACACGGTCAGGACACAAATCTGGCAGCTCTACTGT	EBAF, LEFTA, TGFB4, LEFTYA, MGC46222	endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily); transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A); go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_function: transforming growth factor beta receptor binding; go_process: cell growth; go_process: development; go_process: cell-cell signaling; go_process: oocyte axis determination; go_process: transforming growth factor beta receptor signaling pathway	endometrial bleeding associated factor preproprotein
LEFTY2_P719_F	5899	0.4872929	1268.785	1300.936	0.1867358	38	59.19167	0.9518145	562.2159	13080.83	1.333626E-18	27	1212.751	0.9592738	609.2381	16705.52	1.49801E-33	23	791.2045	0.8576308	386.504	2930.698	0.1463135	27	189.4733	0.954924	470.1083	12077.61	7.233735E-17	28	958.798	0.9421391	655.9574	12309.12	8.458364E-21	36	530.1464	0.9526373	619.5827	14473.44	1.66036E-19	27	838.9871	0.9619206	586.1019	17331.58	2.470513E-19	18	451.9222	0.934802	497.394	8565.368	1.099118E-08	28	772.3947	0.9586503	530.6985	14622.09	1.072898E-24	29	709.2102	LEFTY2	LEFTY2_P719_F	27436880	NM_003240.2	LEFTY2	7044	1	36.1	224196262	-719	N	CTCTCCCCAGTGAGCTGGCTGGCCGGTTCATGCCACCAGCACTCAGCTGG	EBAF, LEFTA, TGFB4, LEFTYA, MGC46222	endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily); transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A); go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_function: transforming growth factor beta receptor binding; go_process: cell growth; go_process: development; go_process: cell-cell signaling; go_process: oocyte axis determination; go_process: transforming growth factor beta receptor signaling pathway	endometrial bleeding associated factor preproprotein
LIF_E208_F	743	0.0473781	5608.196	283.8938	5.777419E-05	29	223.92	0.05334448	9218.046	525.0762	2.233172E-09	24	447.0766	0.04461973	11730.72	552.5377	2.668313E-16	23	405.7397	0.1591707	766.5786	164.045	0.695987	23	71.14949	0.05746371	9516.672	586.3007	8.287587E-11	35	499.014	0.05595759	10907.46	652.4612	2.330556E-16	31	549.6338	0.05838302	9768.603	611.8823	4.963159E-09	26	524.1882	0.05212515	12927.2	716.3865	4.341643E-11	24	632.4219	0.06939307	8737.378	658.9815	2.380038E-09	32	510.4945	0.06095107	8490.452	557.5825	1.511507E-08	21	424.3769	LIF	LIF_E208_F	6006018	NM_002309.2	LIF	3976	22	36.1	28972540	208	Y	CCCAGCGCCTCCGGTGGCTGCGCGGGCGCCCCAAGTGTTCGTGTGTCTGCG	CDF, HILDA, D-FACTOR	cholinergic differentiation factor; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_function: oncostatin-M receptor binding; go_function: leukemia inhibitory factor receptor binding; go_process: development; go_process: immune response; go_process: cell-cell signaling; go_process: positive regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	leukemia inhibitory factor (cholinergic differentiation factor)
LIF_P383_R	4029	0.1281987	30974.99	4569.587	3.678E-38	19	993.8881	0.3949232	4635.439	3090.739	5.73918E-06	24	297.0479	0.3181617	5612.437	2665.557	3.008786E-07	32	276.2274	0.1294157	16896.83	2526.644	1.760262E-31	41	1609.595	0.2804938	5453.835	2165.119	3.573999E-06	23	350.8833	0.3197347	5951.618	2844.35	2.643024E-09	25	389.1722	0.361824	4838.356	2799.88	5.791123E-05	29	344.0374	0.3569184	6265.275	3532.807	8.312973E-06	28	268.5779	0.3772493	4495.904	2784.102	1.290571E-05	32	370.2468	0.3445444	5647.158	3021.03	7.579737E-08	36	204.1108	LIF	LIF_P383_R	6006018	NM_002309.2	LIF	3976	22	36.1	28973131	-383	N	CACCTGGGTTTGGGGAGGTAGCGAGTCTGGACTAGCAGATGGAGACT	CDF, HILDA, D-FACTOR	cholinergic differentiation factor; go_component: extracellular space; go_function: cytokine activity; go_function: growth factor activity; go_function: oncostatin-M receptor binding; go_function: leukemia inhibitory factor receptor binding; go_process: development; go_process: immune response; go_process: cell-cell signaling; go_process: positive regulation of cell proliferation; go_process: cell surface receptor linked signal transduction	leukemia inhibitory factor (cholinergic differentiation factor)
LIG3_P622_R	4038	0.7496304	1166.909	3793.247	0.001248804	27	129.7482	0.8329955	2712.482	14028.28	2.006604E-28	29	1175.107	0.8442713	3311.807	18496.85	3.678E-38	29	1006.385	0.04365781	4900.2	228.2633	0.01253515	25	260.8636	0.8100736	3022.352	13317.44	3.109832E-29	24	1107.138	0.844859	2546.503	14412.19	1.399789E-36	32	942.6895	0.8210835	3176.631	15037.11	6.740689E-29	29	1332.582	0.8437713	3389.949	18848.78	3.10148E-30	30	1120.161	0.7870513	2373.47	9141.862	3.071365E-14	19	712.5029	0.8654415	2790.087	18588.21	3.678E-38	38	829.5082	LIG3	LIG3_P622_R	73747828	NM_013975.2	LIG3	3980	17	36.1	30331029	-622	N	ATCACACAGCACAGAATTCTCTCGGGAACCTGTTCTTTGCTTACCTAACAAGGC	.	isoform alpha precursor is encoded by transcript variant alpha; polydeoxyribonucleotide synthase [ATP]; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: ligase activity; go_function: metal ion binding; go_function: nucleotide binding; go_function: DNA ligase (ATP) activity; go_process: cell cycle; go_process: cell division; go_process: DNA repair; go_process: DNA replication; go_process: spermatogenesis; go_process: meiotic recombination	ligase III, DNA, ATP-dependent isoform alpha precursor
LIG4_P194_F	2723	0.03417492	4949.162	178.6604	0.0007536401	30	115.9699	0.03328723	8656.448	301.5145	6.104761E-08	26	558.2804	0.04357466	11257.74	517.4579	6.354088E-15	32	497.584	0.03678546	3898.526	152.7049	0.06253958	33	171.3288	0.04561328	9005.382	435.1761	2.011625E-09	31	529.3884	0.03798165	10121.54	403.5589	1.856772E-13	30	618.7399	0.03293062	9685.078	333.2013	2.078424E-08	32	477.5822	0.03678016	11549.37	444.8264	1.409827E-08	32	684.3142	0.04550357	7978.539	385.127	2.193659E-07	25	312.8963	0.03835169	11758.14	472.9169	8.209125E-16	23	594.8405	LIG4	LIG4_P194_F	46255050	NM_002312.3	LIG4	3981	13	36.1	107666077	-194	Y	GAGTACACACGGCTCCTATTGGCCTCGGCAGCAGATGCTCTCTGCAAGCAGTTGATC	.	polydeoxyribonucleotide synthase; polynucleotide ligase; Sealase; DNA repair enzyme; DNA joinase; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: ligase activity; go_function: nucleotide binding; go_function: DNA ligase (ATP) activity; go_process: cell cycle; go_process: cell division; go_process: DNA replication; go_process: DNA recombination; go_process: single strand break repair	DNA ligase IV
LIMK1_P709_R	5035	0.5627311	2604.892	3480.986	2.808711E-05	31	262.057	0.9513687	585.7343	13414.93	1.271269E-19	26	703.944	0.9506112	816.4187	17638.77	3.678E-38	41	821.0685	0.5897399	1851.59	2805.367	0.02673696	26	142.9755	0.9458023	693.6576	13850.09	6.328597E-23	34	636.5159	0.9331961	812.0093	12740.02	7.96888E-23	34	617.0743	0.9457117	729.8918	14456.85	9.262726E-20	34	807.2906	0.9534459	875.3446	19975.4	1.885221E-26	28	1145.773	0.9400316	534.4206	9944.822	1.05356E-11	33	510.8689	0.9428504	770.1291	14355.33	1.328932E-24	31	626.4247	LIMK1	LIMK1_P709_R	8051616	NM_002314.2	LIMK1	3984	7	36.1	73135383	-709	N	ACCACCCAATTCCTTTGGACGCTTGACTCAGCCCAAACCCGTGCT	LIMK	isoform 1 is encoded by transcript variant 1; LIM motif-containing protein kinase; go_component: cytoplasm; go_function: ATP binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell motility; go_process: signal transduction; go_process: signal transduction; go_process: nervous system development; go_process: Rho protein signal transduction; go_process: protein amino acid phosphorylation; go_process: actin cytoskeleton organization and biogenesis	LIM domain kinase 1 isoform 1
LMO1_E265_R	813	0.05807564	2783.055	177.7587	0.1076595	36	93.88015	0.1789292	5465.732	1212.894	0.0001477515	25	209.0414	0.1824806	7663.194	1732.842	2.319294E-09	16	280.6046	0.04105526	3374.77	148.7652	0.1174754	26	153.4878	0.1644571	8627.087	1717.723	2.42974E-11	20	389.4186	0.2361752	6229.426	1957.063	4.786375E-08	28	301.6965	0.1784715	6916.199	1524.222	5.314526E-06	37	365.2189	0.2090652	7901.989	2115.14	4.705489E-06	28	358.414	0.1637039	6505.515	1293.021	2.000536E-06	28	299.569	0.1619274	5225.182	1028.9	0.0003240838	16	209.8042	LMO1	LMO1_E265_R	4505004	NM_002315.1	LMO1	4004	11	36.1	8241717	265	Y	TGTGCCTCAGAATTGGAAGGAACTACGAACTGCAATTTAGAGAGAGAGGGA	TTG1, RBTN1, RHOM1	go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: development; go_process: cell proliferation	LIM domain only 1
LMO1_P169_F	4247	0.0370148	4993.301	195.7741	0.0006234097	33	152.0279	0.05361945	9820.125	562.0483	1.191368E-10	21	547.9713	0.04077508	10592.56	454.523	4.57117E-13	30	458.5365	0.310932	3381.809	1571.116	0.01678544	32	182.8459	0.05306659	8449.615	479.1245	1.991828E-08	26	368.0925	0.04374532	9842.296	454.8254	7.345429E-13	30	480.2259	0.05013205	9656.641	514.9351	1.141995E-08	24	532.6836	0.04311986	11313.86	514.3426	2.406461E-08	24	599.7491	0.06027358	8434.494	547.3982	1.576987E-08	27	414.7533	0.04491663	8805.839	418.8329	6.946014E-09	31	319.3022	LMO1	LMO1_P169_F	4505004	NM_002315.1	LMO1	4004	11	36.1	8242151	-169	Y	CCTAGCTCGGTGAGCGTCTTTGCTCCGATCCCAGGGTCGTGGTCTTCAATGATT	TTG1, RBTN1, RHOM1	go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: development; go_process: cell proliferation	LIM domain only 1
LMO2_E148_F	4123	0.2447309	3585.496	1194.216	0.00210106	33	279.5138	0.8698254	2119.966	14833.79	3.511378E-29	30	1286.425	0.8675753	2981.993	20191.56	3.678E-38	21	1417.804	0.7058991	962.7449	2550.794	0.1187723	37	130.2252	0.8155472	2955.699	13510.6	1.041638E-29	18	1463.788	0.8641635	2436.675	16137.8	3.678E-38	29	1524.624	0.7570944	4216.342	13453.29	4.050686E-27	20	632.1765	0.7878449	4061.609	15454.27	4.595143E-23	28	1767.819	0.8448138	1971.106	11274.84	4.287164E-19	24	1081.285	0.8400865	3318.34	17957.84	3.678E-38	28	1197.905	LMO2	LMO2_E148_F	6633806	NM_005574.2	LMO2	4005	11	36.1	33870264	148	N	CGGAGCCTTCACCCTTGCAGCGAGCTCTCTCACACCAGATGTGCTCTGCGT	TTG2, RBTN2, RHOM2, RBTNL1	go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: development	LIM domain only 2
LMO2_P794_R	2729	0.3766716	3392.292	2110.36	0.000225899	20	181.864	0.8713615	1741.147	12471.42	3.058312E-20	37	716.2133	0.6841512	4045.638	8979.749	1.972813E-18	30	607.3291	0.03124964	4595.304	151.4596	0.02329686	28	233.8036	0.7633927	2431.952	8169.119	6.382897E-12	36	851.0886	0.8326515	2401.393	12445.81	1.184646E-27	27	687.525	0.6853651	3596.096	8051.157	2.068951E-11	27	515.5552	0.8593149	2684.187	17006.03	1.713913E-23	30	760.5576	0.8334825	1589.13	8454.73	1.012393E-10	26	528.1626	0.6979941	3919.389	9289.587	1.5059E-18	27	354.4456	LMO2	LMO2_P794_R	6633806	NM_005574.2	LMO2	4005	11	36.1	33871206	-794	N	CTGTCTGCTGGGCAAGGCCCAATTCCGAGGTGACAGCTCACCGGGCCTC	TTG2, RBTN2, RHOM2, RBTNL1	go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: development	LIM domain only 2
LMTK2_P1034_F	2316	0.06359252	4382.686	304.4243	0.002718577	22	200.1208	0.7033612	3412.4	8328.264	1.148703E-13	32	869.7708	0.6922801	4701.777	10802.6	1.382187E-26	25	733.0693	0.09524069	1891.813	209.6708	0.3993497	31	93.23322	0.6974698	3450.852	8186.33	1.952939E-14	22	596.4819	0.6385072	4742.545	8553.423	6.275109E-22	44	520.0225	0.690488	4557.62	10390.65	4.057011E-19	23	757.7784	0.637511	6159.817	11009.17	1.044489E-17	27	512.6815	0.6481637	3888.435	7347.619	1.577818E-13	38	552.48	0.7157412	3777.566	9763.404	1.565424E-19	18	545.401	LMTK2	LMTK2_P1034_F	38016936	NM_014916.2	LMTK2	22853	7	36.1	97573099	-1034	N	TCTGTGTGTCCAGTGCTGTGTTAACATCATCGACAGCTGGCATTTAGGATGGACATTT	KPI2, LMR2, cprk, KPI-2, KIAA1079	kinase phosphatase inhibitor 2; go_component: integral to membrane; go_function: ATP binding; go_function: protein binding; go_function: protein-tyrosine kinase activity; go_function: protein phosphatase inhibitor activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid autophosphorylation	lemur tyrosine kinase 2
LOX_P313_R	1311	0.2667315	5514.391	2042.274	4.625536E-08	39	230.622	0.1848351	7573.804	1740.002	1.41858E-08	27	441.1791	0.1653951	8658.768	1735.74	1.615215E-11	30	536.538	0.8315278	1469.203	7745.114	4.331794E-07	26	431.1365	0.2560154	6953.208	2427.107	2.655294E-09	34	323.6342	0.4165876	6543.787	4744.019	1.447579E-15	22	592.547	0.1928617	8327.649	2013.745	5.809445E-09	21	427.468	0.228548	8033.136	2409.498	1.493087E-06	32	417.9167	0.3264694	5884.535	2900.785	3.732075E-08	24	502.8488	0.1555939	8737.109	1628.364	2.992738E-11	37	359.9074	LOX	LOX_P313_R	21264603	NM_002317.3	LOX	4015	5	36.1	121442166	-313	Y	AGGCGAAGGCAGCCAGGCCATGGGGCGACGCCAAAATATGCACGAAGAAAAATG	MGC105112	protein-lysine 6-oxidase; go_component: extracellular matrix (sensu Metazoa); go_function: metal ion binding; go_function: copper ion binding; go_function: oxidoreductase activity; go_function: protein-lysine 6-oxidase activity; go_process: protein modification; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	lysyl oxidase preproprotein
LOX_P71_F	1309	0.05259743	8631.153	484.7318	8.358288E-12	31	419.43	0.09810746	10498.7	1152.922	1.865615E-13	26	589.6503	0.08619073	12111.53	1151.795	3.815922E-19	26	548.1582	0.06723195	5712.201	418.9312	0.001878236	27	133.2224	0.1371906	10715.79	1719.759	1.479498E-16	31	528.6176	0.1585811	10168.21	1935.235	5.229341E-18	28	783.2388	0.1075881	9338.114	1137.848	3.368829E-09	23	519.6423	0.09238289	11988.72	1230.465	2.0863E-10	30	545.2169	0.1253709	7071.379	1027.958	6.31362E-07	18	625.3459	0.08712757	12720.78	1223.658	9.179491E-21	26	588.7508	LOX	LOX_P71_F	21264603	NM_002317.3	LOX	4015	5	36.1	121441924	-71	Y	AGTTACACAAGCCGTTCTGGCCCGGCCGCCCCTCAGCTATTTGTTCAC	MGC105112	protein-lysine 6-oxidase; go_component: extracellular matrix (sensu Metazoa); go_function: metal ion binding; go_function: copper ion binding; go_function: oxidoreductase activity; go_function: protein-lysine 6-oxidase activity; go_process: protein modification; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	lysyl oxidase preproprotein
LRP2_E20_F	3574	0.6862161	4256.932	9528.203	5.862296E-28	27	654.8055	0.08303969	15449.49	1408.158	7.732789E-29	22	1221.216	0.05537055	23297.51	1371.472	3.678E-38	26	1250.999	0.3878515	5285.244	3412.04	2.316403E-06	30	437.7948	0.06703016	18460	1333.462	3.678E-38	22	1235.911	0.08161435	18600.31	1661.844	3.678E-38	31	1563.036	0.0833497	17642.19	1613.271	1.804122E-32	14	1936.075	0.06373236	24014.09	1641.462	3.678E-38	23	753.5514	0.1453117	8837.929	1519.601	2.005832E-11	23	612.2847	0.04868193	25694.92	1320.007	3.678E-38	29	981.7475	LRP2	LRP2_E20_F	6806918	NM_004525.1	LRP2	4036	2	36.1	169927239	20	Y	GCACCGGCAGCGCCTCTGCTAGCGAACGCTCCTTTAGGTCTGCACCTCCG	gp330	megalin; calcium sensor protein; Heymann nephritis antigen homolog; go_component: membrane; go_component: coated pit; go_component: lysosome; go_component: integral to membrane; go_function: receptor activity; go_function: calcium ion binding; go_function: protein binding; go_function: protein binding; go_process: lipid metabolism; go_process: receptor mediated endocytosis; go_process: protein amino acid glycosylation	low density lipoprotein-related protein 2
LRRC32_E157_F	3027	0.657127	1000.286	2108.733	0.08513204	28	112.9606	0.9298392	733.0385	11040.24	9.607511E-14	32	607.4	0.955569	779.6608	18918.67	3.678E-38	26	1039.87	0.1319533	1019.514	170.1793	0.6341926	34	54.60573	0.9528421	676.7618	15694.75	2.365974E-29	29	1107.572	0.9446731	780.0497	15026.32	1.516023E-31	28	901.5419	0.943513	761.8142	14395.05	1.116159E-19	25	960.6469	0.9548759	850.8859	20121.78	8.989044E-27	27	992.5344	0.9275316	704.6773	10299.16	5.9382E-13	21	524.7324	0.9567313	692.9449	17533.11	2.417943E-36	28	979.6285	LRRC32	LRRC32_E157_F	5031706	NM_005512.1	LRRC32	2615	11	36.1	76058386	157	N	GTTTTCTCCAGCACATGCTGAGCCGACTGCCCCCAATAGAACTGTCTTTTTT	GARP, D11S833E	garpin; glycoprotein A repetitions predominant; go_component: integral to plasma membrane	leucine rich repeat containing 32 precursor
LRRC32_P865_R	2087	0.09809076	2831.344	318.8101	0.07955471	27	131.7555	0.03626199	12473.27	473.0869	1.069133E-16	39	822.6572	0.03062714	16588.72	527.277	9.592262E-33	23	893.6738	0.2529236	4109.006	1424.964	0.006100566	23	301.4544	0.03522729	13551.48	498.464	2.473517E-21	27	839.5317	0.03522919	15184.19	558.1116	2.812983E-31	31	843.2159	0.03827385	12079.81	484.7202	2.470907E-13	35	860.9689	0.03181005	17453.81	576.7335	1.383379E-19	28	999.6562	0.05794344	9231.881	573.9796	3.325809E-10	29	784.8669	0.04195252	12292.06	542.6434	1.791585E-17	22	644.7307	LRRC32	LRRC32_P865_R	5031706	NM_005512.1	LRRC32	2615	11	36.1	76059408	-865	Y	GCGCCAGACCCCGGGGTCACGGCCCGAGGAGGAGCAGGCCGCTCAGCT	GARP, D11S833E	garpin; glycoprotein A repetitions predominant; go_component: integral to plasma membrane	leucine rich repeat containing 32 precursor
LRRK1_P39_F	2321	0.33932	1203.966	669.7066	0.3940767	27	54.15105	0.8940725	1321.455	11997.67	1.057258E-17	27	852.5598	0.9104681	1492.157	16190.97	4.505159E-35	34	924.5748	0.2751154	2410.251	952.7155	0.1395393	26	172.9783	0.9109042	1055.655	11815.26	8.838405E-18	33	827.8975	0.9023615	1318.391	13108.58	4.943079E-26	33	841.3911	0.90025	1323.632	12848.36	4.141586E-17	39	961.28	0.9079546	1574.453	16517.13	1.009245E-19	25	580.4106	0.8863372	1230.571	10375.73	1.784276E-14	26	709.6117	0.8692881	1677.082	11818.34	2.143656E-19	21	437.3605	LRRK1	LRRK1_P39_F	33469142	NM_024652.2	LRRK1	79705	15	36.1	99380156	-39	N	TTACCTGCGTGCTCAGCTGCGGAAAGCGGAAAAGTGCAAGCTGATGAAGAT	FLJ23119, KIAA1790	go_function: ATP binding; go_function: protein kinase activity; go_process: protein amino acid phosphorylation	leucine-rich repeat kinase 1
LRRK1_P834_F	2091	0.4113788	1471.26	1098.131	0.1868149	25	121.8027	0.6228704	2984.042	5093.63	1.700654E-06	17	239.2124	0.6524592	2738.987	5329.801	6.894096E-07	31	311.0977	0.2442348	746.634	273.6001	0.6751291	25	56.32176	0.6732941	2234.889	4811.872	2.546457E-05	26	462.5618	0.5216254	3517.92	3945.024	1.083516E-06	29	318.4979	0.6709084	2525.645	5352.818	2.919032E-05	25	425.1782	0.674569	2863.213	6142.29	5.759764E-05	17	525.9158	0.5827339	2537.333	3683.174	0.0003590428	23	374.6391	0.667259	2749.436	5714.087	1.747104E-07	22	345.9822	LRRK1	LRRK1_P834_F	33469142	NM_024652.2	LRRK1	79705	15	36.1	99379361	-834	N	GGGGAGGGGACTCAATTCTAAGCCGTGGGGATTTGCAGAAGACAGAG	FLJ23119, KIAA1790	go_function: ATP binding; go_function: protein kinase activity; go_process: protein amino acid phosphorylation	leucine-rich repeat kinase 1
LTA_E28_R	820	0.1774974	4223.63	933.0462	0.0006894514	29	209.2643	0.2921141	8086.704	3378.301	5.085626E-13	28	484.9775	0.0935777	8260.997	863.177	8.099946E-09	19	286.7195	0.03169728	4945.71	165.1708	0.01291406	22	218.4529	0.4675919	5676.181	5072.979	2.897793E-12	30	522.2916	0.3909466	8497.198	5518.475	1.697214E-24	39	736.5724	0.4949615	6272.486	6245.336	3.124821E-13	39	713.0708	0.2104067	7732.878	2087.264	7.855206E-06	26	450.0882	0.2999201	6409.632	2788.78	5.946972E-09	25	476.8908	0.0970496	9408.67	1021.997	2.143803E-11	28	476.0599	LTA	LTA_E28_R	6806892	NM_000595.2	LTA	4049	6	36.1	31648100	28	N	CATCTCCTTGGGCTGCCCGTGCTTCGTGCTTTGGACTACCGCCCAGCAGTGTC	LT, TNFB, TNFSF1	tumor necrosis factor beta; go_component: membrane; go_component: extracellular space; go_function: tumor necrosis factor receptor binding; go_process: immune response; go_process: cell-cell signaling; go_process: signal transduction; go_process: induction of apoptosis	lymphotoxin alpha precursor
LTA_P214_R	4046	0.08863392	8348.093	821.61	6.001402E-12	28	272.4149	0.464247	5788.22	5102.33	9.928902E-12	28	595.5522	0.5523211	6630.749	8304.02	1.43072E-24	23	932.2024	0.2397015	4807.394	1547.168	0.001165522	38	310.2627	0.5532815	5251.398	6627.955	4.616521E-15	35	586.5028	0.4973217	6069.025	6103.288	3.186676E-18	22	877.0563	0.5155559	6916.099	7466.682	1.212379E-17	30	612.7923	0.5482962	6867.676	8457.645	4.937621E-14	32	798.5755	0.4888498	4424.959	4327.544	4.299784E-08	29	454.6689	0.4492438	7992.06	6600.575	7.920796E-23	26	806.3445	LTA	LTA_P214_R	6806892	NM_000595.2	LTA	4049	6	36.1	31647858	-214	N	CCTTTCCCAGAACTCAGTCGCCTGAACCCCCAGCCTGTGGTTCTC	LT, TNFB, TNFSF1	tumor necrosis factor beta; go_component: membrane; go_component: extracellular space; go_function: tumor necrosis factor receptor binding; go_process: immune response; go_process: cell-cell signaling; go_process: signal transduction; go_process: induction of apoptosis	lymphotoxin alpha precursor
LTB4R_E64_R	3582	0.381786	2874.401	1836.88	0.002543291	33	159.9142	0.4531674	4958.958	4192.425	2.784306E-08	22	268.7308	0.4010979	6169.185	4198.61	1.858963E-11	40	454.3604	0.3144184	2934.979	1391.889	0.04321116	25	205.8855	0.4061715	5316.056	3704.517	1.334654E-08	24	448.687	0.4563247	5368.285	4589.712	5.32718E-12	32	553.8907	0.378446	6299.899	3896.71	1.03455E-08	26	478.2105	0.4067443	6786.49	4721.472	6.58909E-08	28	465.0665	0.3537909	5154.66	2876.857	8.226472E-07	33	487.4424	0.4766526	5627.415	5216.396	2.446875E-12	42	396.4362	LTB4R	LTB4R_E64_R	31881791	NM_181657.1	LTB4R	1241	14	36.1	23852421	64	N	CCTGAACTCTGACTTCAGTTCTTGCTGCGGTTTCTGCCCATTTTTTTCATATCCT	BLT1, BLTR, P2Y7, GPR16, LTBR1, P2RY7, CMKRL1, LTB4R1	chemokine receptor-like 1; G protein-coupled receptor 16; purinergic receptor P2Y, G-protein coupled, 7; go_component: integral to plasma membrane; go_function: receptor activity; go_function: nucleotide binding; go_function: leukotriene receptor activity; go_process: cell motility; go_process: signal transduction; go_process: muscle contraction; go_process: inflammatory response; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	leukotriene B4 receptor
LTB4R_P163_F	1320	0.06778985	5174.116	383.531	0.0001876283	27	168.1603	0.6153277	4041.119	6624.196	3.03598E-11	27	444.4243	0.6594114	3871.923	7690.017	2.296753E-14	41	370.1891	0.3476833	4117.081	2247.694	0.001139832	30	238.2838	0.5518577	4100.963	5173.208	4.308792E-09	26	317.4426	0.6181059	4170.636	6912.138	5.546414E-15	35	499.2103	0.6580313	3822.248	7547.362	7.32302E-11	29	473.5477	0.554827	5119.517	6505.175	4.581275E-08	32	400.5904	0.6149066	3499.972	5748.337	4.73141E-09	25	337.4461	0.6785721	3468.619	7533.774	1.03657E-12	24	457.614	LTB4R	LTB4R_P163_F	31881791	NM_181657.1	LTB4R	1241	14	36.1	23852194	-163	N	GGGGAAGAAAGGCCATCAAGGTAGATGCGGGTGGGGAACAGCTTGAG	BLT1, BLTR, P2Y7, GPR16, LTBR1, P2RY7, CMKRL1, LTB4R1	chemokine receptor-like 1; G protein-coupled receptor 16; purinergic receptor P2Y, G-protein coupled, 7; go_component: integral to plasma membrane; go_function: receptor activity; go_function: nucleotide binding; go_function: leukotriene receptor activity; go_process: cell motility; go_process: signal transduction; go_process: muscle contraction; go_process: inflammatory response; go_process: G-protein signaling, coupled to IP3 second messenger (phospholipase C activating)	leukotriene B4 receptor
LY6G6E_E300_R	3588	0.3874114	2453.58	1614.927	0.01294761	35	114.6546	0.9523195	722.6563	16430.87	6.698854E-30	32	1521.433	0.9619309	748.5092	21440.12	3.678E-38	37	805.2422	0.269459	359.7869	169.5917	0.7811418	28	16.42803	0.9577428	748.7004	19235.46	3.678E-38	27	954.8336	0.9501447	755.0549	16295.68	5.333893E-37	34	1484.834	0.9587464	754.5248	19859.44	1.852773E-37	26	1251.938	0.9658499	788.2278	25121.32	3.678E-38	29	1412.822	0.9232944	669.4523	9261.785	1.784843E-10	19	647.1589	0.9662548	722.0289	23537.88	3.678E-38	24	954.2252	LY6G6E	LY6G6E_E300_R	13236491	NM_024123.1	LY6G6E	79136	6	36.1	31789268	300	N	ATAAGGGATAGGGGAGACAGGGGCGGATCAAAGATGCAGCAAGGGGG	G6e, C6orf22	lymphocyte antigen-6 G6E; Partial coding region; go_component: membrane; go_function: transforming growth factor beta receptor activity	lymphocyte antigen 6 complex G6E
LY6G6E_P45_R	1321	0.3218067	4092.3	1989.271	2.854972E-05	17	240.7132	0.9506325	767.9005	16712.51	4.253228E-31	23	1257.06	0.9637487	671.5494	20511.81	3.678E-38	28	1364.617	0.9117628	362.727	4781.402	0.01220569	30	178.906	0.9526073	613.9478	14350.58	2.490374E-24	18	883.9213	0.9489801	826.1629	17226.8	3.678E-38	27	1216.232	0.9582876	690.356	18157.4	4.792388E-31	30	1212.139	0.9623601	739.9145	21474.55	3.630773E-30	27	1308.33	0.9403526	643.1169	11715.38	1.655764E-16	30	607.4052	0.9663968	645.2761	21433.45	3.678E-38	27	950.1397	LY6G6E	LY6G6E_P45_R	51243048	NM_021246.2	LY6G6D	58530	6	36.1	31789613	-1499	N	AATCTGGGAGAGGTGATCTGCACCCCGAGATCCCGGGATTTGTAGAGTT	G6D, NG25, LY6-D, MEGT1, C6orf23	lymphocyte antigen-6 G6D; megakaryocyte-enhanced gene transcript 1	lymphocyte antigen 6 complex G6D
LYN_E353_F	752	0.2096746	5068.269	1371.15	7.000583E-06	36	255.4069	0.1714621	2602.33	559.2348	0.1491202	34	168.5705	0.1496653	3627.728	656.108	0.02966922	32	189.5186	0.1126683	2875.66	377.8323	0.156106	18	145.1069	0.1557	3466.959	657.7941	0.03477894	27	193.3444	0.1503973	3100.45	566.5461	0.05455719	29	158.549	0.157457	3473.09	667.7501	0.07210883	26	157.9349	0.1526571	4200.905	774.85	0.05835122	32	162.7246	0.1452301	3108.786	545.1904	0.08319849	33	156.4404	0.1838631	2941.932	685.3007	0.07954235	22	131.4585	LYN	LYN_E353_F	4505054	NM_002350.1	LYN	4067	8	36.1	56955279	353	Y	GGGCAGTGGGTGCAGGGGCCGCGGCTGTGCCACCAGCCGGAGTCCC	JTK8	Yamaguchi sarcoma viral (v-yes-1) related oncogene homolog; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: receptor signaling protein tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
LYN_P241_F	4250	0.2207708	5137.757	1483.958	3.294854E-06	36	294.0366	0.1013469	13842.9	1572.43	5.981397E-24	29	949.2188	0.07681159	16309.74	1365.332	4.868251E-35	24	629.4752	0.1280071	6087.097	908.2557	0.0002654179	40	447.7274	0.09101656	12592.64	1270.915	9.511524E-21	24	925.7117	0.1130802	12866.01	1653.136	2.202916E-26	19	1207.642	0.1161922	12725.39	1686.124	1.023791E-17	30	995.0462	0.119858	15950.85	2185.809	7.99E-20	34	706.7009	0.1729208	10321.09	2178.779	6.616183E-17	25	912.6189	0.101867	16673.59	1902.474	8.069957E-38	29	618.1846	LYN	LYN_P241_F	4505054	NM_002350.1	LYN	4067	8	36.1	56954685	-241	Y	GGAAAGGAGACGCGAGAGGTGTAGTCGATGTGCCTGCGAAGCCCAGGCT	JTK8	Yamaguchi sarcoma viral (v-yes-1) related oncogene homolog; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: receptor signaling protein tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
MAD2L1_E93_F	3606	0.3573166	5160.064	2924.47	3.088666E-09	35	398.7858	0.7833124	4607.792	17018.38	3.678E-38	23	1338.343	0.7911703	5429.014	20947.17	3.678E-38	22	1396.88	0.1327325	7337.72	1138.319	4.588994E-06	32	322.3911	0.7691846	4756.777	16185.05	3.678E-38	28	1326.401	0.7804921	4746.759	17233.36	3.678E-38	38	1753.583	0.7768067	4809.96	17088.73	3.678E-38	26	1445.838	0.765975	6230.845	20721.16	3.678E-38	17	952.3069	0.8557267	1705.914	10711.39	1.132125E-16	24	616.4443	0.7939824	5784.753	22679.56	3.678E-38	26	1608.016	MAD2L1	MAD2L1_E93_F	88976723	XM_932966.1	LOC645555	645555	4	36.1	121207318	-213	Y	CGCAGGGTGATTCCCTGCTCCCGGGAGAGCTGCAGCGCCATGGCCAGGG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_938059
MAF_E77_R	859	0.3508901	2886.854	1614.607	0.004471543	23	161.4261	0.09538295	7239.189	773.8452	2.137149E-06	29	185.7459	0.1516418	6530.652	1185.212	2.635304E-06	24	279.9709	0.2381086	2755.236	892.327	0.102212	28	144.1207	0.1738948	6458.021	1380.46	1.602406E-06	21	315.6447	0.1425527	7192.79	1212.444	1.741174E-08	24	318.0289	0.1377169	7349.796	1189.821	3.876922E-06	38	351.7356	0.1209734	7581.033	1057.079	0.0001323452	30	329.4927	0.1517977	6003.465	1092.3	2.410636E-05	29	503.5156	0.2021912	6187.844	1593.548	2.383988E-06	22	235.5913	MAF	MAF_E77_R	73427804	NM_005360.3	MAF	4094	16	36.1	78192035	77	Y	AAAATAGCGAAGTCCTGGGGAAAGACGAGGCAGAGAGCAAAGGGGG	MGC71685	isoform a is encoded by transcript variant 1; Avian musculoaponeurotic fibrosarcoma (MAF) protooncogene; v-maf musculoaponeurotic fibrosarcoma (avian) oncogene homolog; T lymphocyte c-maf long form; c-maf proto-oncogene; go_component: nucleus; go_component: chromatin; go_function: protein dimerization activity; go_function: sequence-specific DNA binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	v-maf musculoaponeurotic fibrosarcoma oncogene homolog isoform a
MAF_P826_R	4251	0.09651005	2845.243	314.6084	0.07828117	33	78.60249	0.08726316	6625.812	643.0283	2.539541E-05	31	362.4441	0.06497974	6786.368	478.5719	1.315787E-05	27	511.5109	0.1703273	2258.064	484.0979	0.2497651	25	114.1853	0.0593355	6915.728	442.5401	8.944641E-06	20	387.9094	0.09115209	6285.734	640.4515	8.77638E-06	28	430.4504	0.05752543	6549.175	405.843	0.0003532278	26	357.9635	0.08420116	7442.888	693.5146	0.0003857174	24	284.5101	0.08791711	5491.895	539.0115	0.0006083549	33	294.082	0.07575668	6692.287	556.7377	1.529792E-05	20	415.5528	MAF	MAF_P826_R	73427804	NM_005360.3	MAF	4094	16	36.1	78192938	-826	Y	GTGCCCTTGGACAGAGCGAGCGCCTATGCGAGATAACTCCGGGGAAGCTCAA	MGC71685	isoform a is encoded by transcript variant 1; Avian musculoaponeurotic fibrosarcoma (MAF) protooncogene; v-maf musculoaponeurotic fibrosarcoma (avian) oncogene homolog; T lymphocyte c-maf long form; c-maf proto-oncogene; go_component: nucleus; go_component: chromatin; go_function: protein dimerization activity; go_function: sequence-specific DNA binding; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	v-maf musculoaponeurotic fibrosarcoma oncogene homolog isoform a
MAGEA1_E113_R	3608	0.6216787	550.7268	1069.31	0.4831221	25	85.59612	0.896874	506.6815	5276.232	0.001526087	32	334.9043	0.9221033	548.7509	7679.599	3.671496E-07	30	351.1408	0.8817871	368.8471	3497.277	0.07891695	34	106.4894	0.923479	697.0178	9618.66	2.821771E-11	34	605.4597	0.9064612	797.5522	8697.958	7.01755E-11	31	811.9021	0.9329703	645.6808	10378.96	3.352475E-10	40	559.4861	0.9459189	655.519	13214.58	1.835345E-11	32	436.3446	0.891982	836.5054	7733.399	9.345392E-08	23	534.7047	0.9315857	571.5299	9144.104	7.293154E-10	19	649.6565	MAGEA1	MAGEA1_E113_R	29029615	NM_004988.3	MAGEA1	4100	X	36.1	152139164	113	N	GGCCAGGGCTGGCAGCAAGGGCGGCGCTGGAATATTTGGGGCTCT	MAGE1, MGC9326	melanoma antigen, family A, 1 (directs expression of antigen MZ2-E); melanoma-associated antigen 1; melanoma-associated antigen MZ2-E; melanoma antigen MAGE-1; go_component: plasma membrane	melanoma antigen family A, 1
MAGEA1_P926_F	1335	0.0946736	10243.13	1081.622	1.615202E-18	28	388.5403	0.9113311	879.7861	10070.16	7.361484E-12	25	252.5004	0.9247707	879.2469	12037.58	4.127991E-18	25	432.924	0.3652016	4804.247	2821.429	5.264771E-05	34	280.2699	0.9428081	724.4885	13591.69	3.488161E-22	36	688.3447	0.9388594	894.1871	15266.49	4.724087E-33	26	885.3345	0.935664	805.9149	13175.08	1.238583E-16	23	1176.803	0.9453841	886.8682	17082.38	1.896466E-19	29	859.2755	0.9318911	750.5375	11637.36	1.369488E-16	25	856.6618	0.9522035	765.1163	17234.85	2.093687E-35	25	860.7211	MAGEA1	MAGEA1_P926_F	29029615	NM_004988.3	MAGEA1	4100	X	36.1	152140203	-926	N	AATCTGGACACCCATATTCTCTGCCGATTGTGTCTGCTTCTCTCCCACCAAGTC	MAGE1, MGC9326	melanoma antigen, family A, 1 (directs expression of antigen MZ2-E); melanoma-associated antigen 1; melanoma-associated antigen MZ2-E; melanoma antigen MAGE-1; go_component: plasma membrane	melanoma antigen family A, 1
MAGEC3_E307_F	3619	0.1406913	6373.692	1059.912	8.427997E-08	34	305.3529	0.8828217	1105.056	9078.9	3.025633E-10	30	516.9309	0.902418	1251.625	12499.55	1.182607E-20	25	520.8596	0.03593429	5115.089	194.3856	0.009161237	35	246.2436	0.9023702	1350.925	13410.57	1.201653E-23	20	765.2363	0.8387882	2211.858	12028.64	2.491294E-25	31	626.7147	0.9175504	1151.54	13927.92	1.805971E-19	28	1098.012	0.9004046	1669.042	15993.25	9.040082E-19	27	863.4052	0.8573065	1570.759	10037.96	1.758596E-14	30	523.3107	0.924985	1110.996	14932.39	7.919855E-28	36	510.8964	MAGEC3	MAGEC3_E307_F	20162567	NM_138702.1	MAGEC3	139081	X	36.1	140754075	307	N	TCCCTTGGTTGCAGTAGCCTGTGGTCGCTCATGTCTGAATCTCCAGGGAA	HCA2, MAGEC4, MAGE-C3, MGC119270, MGC119271	isoform 1 is encoded by transcript variant 1; hepatocellular carcinoma-associated protein HCA2; MAGE family testis and tumor-specific protein; melanoma antigen, family C, 3 protein	melanoma antigen family C, 3 isoform 1
MAGEC3_P903_F	1338	0.2491684	936.1588	343.8561	0.6030225	30	41.11395	0.6388175	1496.845	2824.314	0.02934256	30	176.6083	0.6975058	1306.895	3244.088	0.01815796	18	208.8306	0.2226765	747.2872	242.7186	0.6822309	29	37.63339	0.7008733	1700.104	4217.76	0.0007180509	33	268.9312	0.686515	1890.665	4359.447	9.362498E-05	31	313.3035	0.7162175	1701.906	4547.697	0.001841551	15	413.6234	0.7324449	1971.613	5671.14	0.001025838	28	238.6833	0.6046903	2138.509	3424.162	0.002050388	29	236.8481	0.6363744	1875.67	3457.583	0.003377516	25	182.4718	MAGEC3	MAGEC3_P903_F	20162567	NM_138702.1	MAGEC3	139081	X	36.1	140752865	-903	N	TGCAGCCTGAGTTAGACTTCTGCAACGTCCCGTGAGGTGGGATCAGGAATG	HCA2, MAGEC4, MAGE-C3, MGC119270, MGC119271	isoform 1 is encoded by transcript variant 1; hepatocellular carcinoma-associated protein HCA2; MAGE family testis and tumor-specific protein; melanoma antigen, family C, 3 protein	melanoma antigen family C, 3 isoform 1
MAGEL2_E166_R	3624	0.0777371	12132.98	1031.112	2.221122E-25	34	803.9267	0.8865296	892.8452	7756.972	2.048172E-07	17	648.7565	0.8973545	1182.376	11210.87	1.316394E-16	24	695.4976	0.09901742	5899.109	659.2983	0.0007411176	29	358.4803	0.8927053	1069.202	9727.904	2.238002E-12	20	448.5778	0.869653	1246.592	8984.238	1.088551E-12	26	458.2621	0.8696558	1099.444	8002.685	5.960816E-07	32	422.5946	0.8864303	1221.314	10313.07	6.071001E-08	29	357.8033	0.8827343	840.9794	7083.357	1.242987E-06	33	423.4801	0.8779481	1019.766	8054.739	1.346776E-08	20	485.7237	MAGEL2	MAGEL2_E166_R	18765721	NM_019066.2	MAGEL2	54551	15	36.1	21441916	166	N	GGGCTGGGCCTGCAAGACTGCAGGCGGTGCCTGCCAGGAAGGCTG	nM15, NDNL1	go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown	MAGE-like protein 2
MAGEL2_P170_R	1339	0.4808379	451.6574	510.9344	0.7069528	26	33.9571	0.9168172	489.3035	6495.14	6.066104E-05	27	296.2023	0.9295817	472.8501	7562.108	7.864365E-07	18	392.6335	0.3238059	3367.903	1660.658	0.0148227	27	357.5076	0.9305673	457.3659	7470.066	1.14882E-06	23	297.2458	0.9198517	513.0268	7035.628	7.623673E-07	32	298.9064	0.9269633	464.1581	7160.153	6.020964E-05	34	326.7511	0.9320645	476.5139	7909.688	0.000228621	26	333.0786	0.9171234	452.5403	6114.486	0.0001298939	33	327.207	0.9321127	393.9919	6782.657	1.945816E-05	18	327.7644	MAGEL2	MAGEL2_P170_R	18765721	NM_019066.2	MAGEL2	54551	15	36.1	21442252	-170	Y	AGATGATGGAAGGGCAGTGCACAGCCTGCGGGGCAGACAGTGGGGCAGACA	nM15, NDNL1	go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown	MAGE-like protein 2
MALT1_P406_R	4065	0.1939222	2624.948	655.5543	0.06370201	28	133.4514	0.09941974	9389.09	1047.55	9.188652E-11	25	600.8638	0.09285829	9220.416	954.0714	5.076153E-11	32	494.9737	0.0242289	5642.531	142.59	0.003781394	22	278.4419	0.09592346	8036.616	863.3034	2.256279E-08	30	403.9049	0.1017901	8557.283	981.0906	5.559288E-11	22	906.4991	0.09066488	9356.776	942.884	6.867527E-09	24	496.3199	0.1348365	8837.748	1392.956	2.663326E-06	23	531.7339	0.1260952	7616.965	1113.476	4.727515E-08	28	415.5927	0.1452642	8793.979	1511.551	4.058408E-11	27	415.4352	MALT1	MALT1_P406_R	27886564	NM_006785.2	MALT1	10892	18	36.1	54489192	-406	Y	TGCCATACACATCTAACCCTAAAACGAGGAAGCGTCCGCTGAGGTTGCCCAC	MLT, MLT1, DKFZp434L132	isoform a is encoded by transcript variant 1; MALT associated translocation; MALT-lymphoma associated translocation; paracaspase; caspase-like protein; go_component: intracellular; go_function: peptidase activity; go_function: protein binding; go_function: caspase activity; go_function: signal transducer activity; go_process: proteolysis; go_process: anti-apoptosis; go_process: anti-apoptosis; go_process: defense response; go_process: regulation of apoptosis; go_process: activation of NF-kappaB-inducing kinase; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	mucosa associated lymphoid tissue lymphoma translocation protein 1 isoform a
MAP2K6_E297_F	5639	0.05420396	4815.372	281.702	0.0008280701	31	196.7779	0.0551499	10543.96	621.2767	2.450308E-12	29	625.1835	0.06139904	10669.49	704.4916	6.969772E-14	28	473.8345	0.02904224	5154.841	157.1771	0.009120143	38	178.8139	0.06319292	9170.307	625.3344	3.755043E-10	34	414.817	0.09847392	9796.87	1081.038	2.063808E-14	30	457.0918	0.1012141	9067.665	1032.39	1.512097E-08	27	487.2151	0.06270105	11347.01	765.7531	9.571755E-09	24	519.9913	0.0813198	7197.794	645.9867	1.68762E-06	32	239.5929	0.06489437	11383.71	796.9454	1.119148E-15	29	670.5777	MAP2K6	MAP2K6_E297_F	14589899	NM_002758.2	MAP2K6	5608	17	36.1	64922731	297	N	AAGGAAAGGGGAAAATGTCTCAGTCGAAAGGTAAGAGGCTGTTTGCATTAG	MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3	isoform 1 is encoded by transcript variant 1; protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6); go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: MAP kinase kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell cycle arrest; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: DNA damage induced protein phosphorylation	mitogen-activated protein kinase kinase 6 isoform 1
MAP2K6_P297_R	5050	0.05521866	8532.44	504.5313	1.352984E-11	36	500.6493	0.2524708	13368.66	4548.91	9.745518E-33	37	1199.067	0.2300814	16380.26	4924.94	3.678E-38	32	999.8491	0.07607011	7355.688	613.8506	2.034314E-05	27	348.2834	0.2693115	12414.53	4612.507	7.303117E-32	33	1234.918	0.2597936	14890.47	5261.273	3.678E-38	25	1936.768	0.2536108	12499.02	4280.939	2.439766E-24	39	1008.734	0.2547416	17239.36	5926.88	6.515454E-33	31	1118.363	0.2371682	9581.482	3010.021	3.62753E-17	27	1369.956	0.242801	18321.97	5907.131	3.678E-38	33	908.6551	MAP2K6	MAP2K6_P297_R	14589899	NM_002758.2	MAP2K6	5608	17	36.1	64922137	-297	Y	ACTCCCAAACAGACCTTCTCGACAAGCCAAAAGCTCTTTAGCTAACCTAA	MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3	isoform 1 is encoded by transcript variant 1; protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6); go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: MAP kinase kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell cycle arrest; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: DNA damage induced protein phosphorylation	mitogen-activated protein kinase kinase 6 isoform 1
MAP3K1_E81_F	5643	0.741373	2431.967	7258.067	2.170876E-13	33	366.34	0.02754956	12355.78	352.8728	4.498589E-16	36	729.3697	0.03054784	11764.13	373.8435	6.710836E-16	20	503.9131	0.325319	5366.175	2635.69	1.855715E-05	30	229.6312	0.03525392	10563.24	389.6581	9.578553E-13	24	536.7816	0.07310992	10040.16	799.821	2.624085E-14	26	587.9117	0.04792832	12887.19	653.7895	1.448956E-15	39	712.5294	0.07165723	14193.12	1103.262	5.590771E-14	29	711.225	0.09638178	7845.256	847.4573	5.556228E-08	26	423.9626	0.1379277	10422.89	1683.615	1.760909E-15	35	464.6033	MAP3K1	MAP3K1_E81_F	88983555	XM_042066.10	MAP3K1	4214	5	36.1	56146103	81	Y	CTGCAGGGAAGAAGGACGTGCGGCGAGAAGCATCGGATTCGGGG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	mitogen-activated protein kinase kinase kinase 1
MAP3K1_P7_F	5052	0.1564742	5074.738	959.9147	3.40805E-05	27	208.3908	0.1347814	8486.705	1337.613	1.557231E-09	27	494.1687	0.1496593	9830.035	1747.678	2.090456E-14	27	386.41	0.09557917	5255.802	566.001	0.003518922	28	177.6989	0.1165726	8922.483	1190.562	7.879972E-11	28	369.4962	0.1706403	9338.89	1942.047	1.514913E-15	25	343.5257	0.1369957	9330.621	1497.043	7.798418E-10	32	404.7591	0.1210234	10690.86	1485.759	7.755782E-09	29	540.5529	0.1513422	7051.593	1275.353	2.546891E-07	28	498.1899	0.1513972	8747.987	1578.548	3.648382E-11	22	512.5024	MAP3K1	MAP3K1_P7_F	88983555	XM_042066.10	MAP3K1	4214	5	36.1	56146015	-7	Y	GTAGAGTCCAGGGACTAGGAGGACTCACAACGCAGCGATGGGCAGCCAGGCCCTG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	mitogen-activated protein kinase kinase kinase 1
MAP3K8_P1036_F	4067	0.4208426	1547.865	1197.415	0.1476213	38	99.4884	0.9281581	992.3206	14112.19	5.85115E-23	33	914.1592	0.9200764	1360.918	16818.01	3.545145E-37	31	921.5348	0.8178084	299.3814	1792.715	0.4017291	20	77.63337	0.8772752	1548.016	11780.53	4.062187E-19	23	766.5494	0.8725271	1815.54	13111.5	5.753218E-28	28	845.2856	0.8918235	1443.865	12727.87	4.147955E-17	37	764.9959	0.868956	2576.153	17745.64	4.43613E-25	21	855.1487	0.9220346	789.3286	10517.38	1.047477E-13	31	609.8114	0.8857941	2071.692	16843.9	3.678E-38	23	1122.291	MAP3K8	MAP3K8_P1036_F	22035597	NM_005204.2	MAP3K8	1326	10	36.1	30761836	-1036	Y	ACCTGGGCACTGGGAAGAATAGGGCGTGGACTTGGAGTGTGACCG	COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486	Cancer Osaka thyroid oncogene; cot (cancer Osaka thyroid) oncogene; Ewing sarcoma transformant; proto-oncogene serine/threoine protein kinase; tumor progression locus-2; go_component: cytosol; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	mitogen-activated protein kinase kinase kinase 8
MAP3K9_E17_R	5653	0.886346	1364.451	11420.72	7.159433E-24	36	547.9216	0.06697747	8018.104	582.762	2.471169E-07	25	264.2298	0.06795461	9140.434	673.7119	3.112891E-10	22	368.1085	0.6876674	2351.22	5396.889	3.773598E-05	25	414.0973	0.1063888	7182.652	867.0352	7.218656E-07	29	400.3701	0.1303748	7886.576	1197.353	6.173342E-10	37	278.7191	0.104193	8400.517	988.7114	2.169357E-07	32	366.1856	0.1062268	9190.102	1104.147	2.242318E-06	33	268.3492	0.1136042	6738.554	876.4581	3.939749E-06	29	369.56	0.09269281	7710.217	797.9117	1.459316E-07	28	351.9898	MAP3K9	MAP3K9_E17_R	52421789	NM_033141.2	MAP3K9	4293	14	36.1	70345624	17	Y	GGCGCTCGCTAGGCAGCCGAGAAGCGCTCTGGAGGGCTCCATGGA	MLK1, PRKE1	mixed lineage kinase 1 (tyr and ser/thr specificity); go_component: cellular component unknown; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: MAP kinase kinase activity; go_function: protein-tyrosine kinase activity; go_function: JUN kinase kinase kinase activity; go_function: protein homodimerization activity; go_function: protein serine/threonine kinase activity; go_process: activation of JNK activity; go_process: protein amino acid autophosphorylation	mitogen-activated protein kinase kinase kinase 9
MAPK10_E26_F	884	0.3753952	3344.146	2069.974	0.0003031252	29	167.063	0.9167369	988.6849	11986.55	8.960363E-17	36	727.9312	0.9177986	1042.24	12753.39	8.556089E-21	36	418.1696	0.1939903	1856.664	470.9296	0.3433533	34	72.36354	0.898266	1053.458	10184.52	1.955249E-13	33	488.3563	0.900885	1209.723	11904.45	2.643806E-21	26	536.8768	0.9034885	1319.084	13284.69	3.271042E-18	20	603.7996	0.8980863	1398.19	13202.39	1.023032E-12	27	437.7642	0.9083991	984.7262	10757.15	7.870001E-15	28	523.183	0.9031044	1164.153	11782.39	8.620211E-18	28	469.1511	MAPK10	MAPK10_E26_F	20986509	NM_138982.1	MAPK10	5602	4	36.1	87593281	26	N	AGCGGCAAAATCCCTCTGGGCTCGCTGGGTCCCCTGCCACGCCATTT	JNK3, JNK3A, PRKM10, p493F12, FLJ12099, MGC50974, p54bSAPK	isoform 2 is encoded by transcript variant 2; MAP kinase; JNK3 alpha protein kinase; stress activated protein kinase beta; c-Jun kinase 3; c-Jun N-terminal kinase 3; stress activated protein kinase JNK3; go_function: ATP binding; go_function: nucleotide binding; go_function: MAP kinase activity; go_function: transferase activity; go_function: JUN kinase activity; go_function: MAP kinase kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: JNK cascade; go_process: signal transduction; go_process: protein amino acid phosphorylation	mitogen-activated protein kinase 10 isoform 2
MAPK12_E165_R	5655	0.07346449	6537.714	526.3007	4.761889E-07	22	170.8095	0.03036985	15364.02	484.3496	2.289129E-25	22	1339.891	0.03242898	20385.47	686.5882	3.678E-38	32	983.1908	0.0335664	7599.205	267.4106	2.717881E-05	29	282.2486	0.04030514	15191.84	642.2245	2.24596E-27	34	1294.219	0.04811468	16222.13	825.0302	5.538245E-37	28	1475.82	0.04066972	15315.34	653.5159	6.061465E-22	37	1255.445	0.02636339	23888.84	649.5515	4.299879E-37	28	787.4893	0.05833919	11555.56	722.1025	2.782659E-16	38	757.0419	0.04046827	14235.67	604.6072	1.209204E-23	24	668.3306	MAPK12	MAPK12_E165_R	48255969	NM_002969.3	MAPK12	6300	22	36.1	49042051	165	Y	CGGTAAAAGCCACTGCGGGCGGGCGGCGGAGAGCTCATGGCAGGCC	ERK3, ERK6, SAPK3, PRKM12, SAPK-3, P38GAMMA	stress-activated protein kinase 3; mitogen-activated protein kinase 3; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: MAP kinase activity; go_function: protein binding; go_function: transferase activity; go_function: MAP kinase activity; go_function: magnesium ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: muscle development; go_process: signal transduction; go_process: myoblast differentiation; go_process: protein amino acid phosphorylation; go_process: DNA damage induced protein phosphorylation	mitogen-activated protein kinase 12
MAPK12_P416_F	5060	0.2550054	512.2383	209.564	0.776202	29	24.36273	0.1453993	7934.458	1366.96	1.494177E-08	22	412.6439	0.14077	9353.807	1548.843	1.028313E-12	22	578.3917	0.03175339	4688.37	157.0333	0.01995548	35	221.7703	0.1289952	7997.031	1199.165	6.123864E-09	31	332.6727	0.2028658	7732.168	1993.239	1.983145E-11	33	343.3967	0.1389693	8049.618	1315.339	2.366299E-07	28	477.8199	0.1345964	10290.91	1616.1	1.868981E-08	33	501.356	0.153686	7304.848	1344.68	6.677687E-08	37	291.7033	0.1556555	7192.853	1344.443	1.296504E-07	30	287.1413	MAPK12	MAPK12_P416_F	48255969	NM_002969.3	MAPK12	6300	22	36.1	49042632	-416	Y	GCCCATCCTTGACAGCCTGAGCGCTGACTTCTATGGCAGCCGCAAGTCGGGC	ERK3, ERK6, SAPK3, PRKM12, SAPK-3, P38GAMMA	stress-activated protein kinase 3; mitogen-activated protein kinase 3; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: MAP kinase activity; go_function: protein binding; go_function: transferase activity; go_function: MAP kinase activity; go_function: magnesium ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell cycle; go_process: cell cycle arrest; go_process: muscle development; go_process: signal transduction; go_process: myoblast differentiation; go_process: protein amino acid phosphorylation; go_process: DNA damage induced protein phosphorylation	mitogen-activated protein kinase 12
MAPK14_P327_R	4072	0.6531575	2067.07	4080.925	2.215573E-05	27	267.2001	0.2143949	7005.157	1939.027	6.451103E-08	38	361.3886	0.2040469	7394.891	1921.356	3.362927E-09	23	308.9661	0.8078706	643.999	3128.385	0.08836161	25	174.1933	0.2401359	6540.504	2098.564	6.824724E-08	27	331.5208	0.2130912	6895.104	1894.241	2.731149E-09	35	274.6799	0.2263718	6849.458	2033.484	1.2576E-06	37	265.6144	0.195088	8446.849	2071.516	1.210053E-06	29	371.8112	0.2504929	5681.633	1932.281	3.955525E-06	29	375.0495	0.2385691	8460.861	2682.261	4.779284E-13	37	347.9623	MAPK14	MAPK14_P327_R	20986513	NM_139013.1	MAPK14	1432	6	36.1	36103224	-327	Y	AAGATCTTTTGACTCTTTCCCCGACACGCTATTTGTCAGTGTCGTTTTCCAC	RK, p38, EXIP, Mxi2, CSBP1, CSBP2, CSPB1, PRKM14, PRKM15, SAPK2A, p38ALPHA	isoform 3 is encoded by transcript variant 3; Csaids binding protein; cytokine suppressive anti-inflammatory drug binding protein; MAP kinase Mxi2; p38 mitogen activated protein kinase; p38 MAP kinase; p38alpha Exip; stress-activated protein kinase 2A; MAX-interacting protein 2; go_component: nucleus; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: MAP kinase activity; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: MP kinase activity; go_function: MAP kinase kinase activity; go_function: protein serine/threonine kinase activity; go_process: chemotaxis; go_process: cell motility; go_process: response to stress; go_process: protein kinase cascade; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction; go_process: antimicrobial humoral response (sensu Vertebrata)	mitogen-activated protein kinase 14 isoform 3
MAPK4_E273_R	5660	0.3345165	5270.671	2699.658	5.649542E-09	22	418.8661	0.8234257	2005.337	9817.896	7.299177E-14	35	565.3489	0.8413954	2405.667	13292.53	2.727069E-27	35	748.0306	0.3688138	3368.413	2026.658	0.007863823	30	254.7496	0.8145681	2186.406	10043.76	5.381379E-16	33	605.8535	0.7919846	2567.498	10156.06	5.389815E-20	36	795.0512	0.8542408	1845.276	11400.54	7.175093E-15	28	620.1529	0.8411352	2568.22	14127.32	1.016809E-16	26	767.5038	0.8118963	1864.175	8477.801	2.176484E-11	34	484.2756	0.8392926	2108.52	11533.97	7.735864E-20	31	607.2307	MAPK4	MAPK4_E273_R	6715608	NM_002747.2	MAPK4	5596	18	36.1	46444109	273	N	CCCTCCCAATGCAGGTTAAGACGACAGCCTGCGCCCCCAACTAGC	ERK3, Erk4, PRKM4, p63MAPK	Erk3-related; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: MAP kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell cycle; go_process: protein amino acid phosphorylation	mitogen-activated protein kinase 4
MAPK9_P1175_F	5073	0.5109627	1247.83	1408.258	0.1667521	31	87.26611	0.9330216	740.8272	11712.88	2.032095E-15	28	738.0659	0.9431412	750.358	14105.26	2.684506E-24	32	840.0939	0.3391229	321.8454	216.466	0.7794083	31	23.65956	0.9471973	519.3627	11110.39	2.040177E-14	22	604.6726	0.9443713	628.6299	12369.48	6.54567E-21	38	701.8868	0.9447818	724.381	14105.15	8.381858E-19	26	484.267	0.9523445	664.987	15287.46	3.134361E-15	28	581.023	0.9149917	727.7415	8909.444	7.57116E-10	16	815.6738	0.9478756	607.6736	12868.97	2.439386E-19	37	519.014	MAPK9	MAPK9_P1175_F	21237744	NM_139070.1	MAPK9	5601	5	36.1	179641391	-1175	N	CCAAGTGACCACTGCCCCACGGTCTTCTCCCCGTCCTCTGGGTGGT	JNK2, JNK2A, JNK2B, PRKM9, JNK-55, JNK2BETA, p54aSAPK, JNK2ALPHA	isoform 4 is encoded by transcript variant 4; MAP kinase 9; c-Jun kinase 2; c-Jun N-terminal kinase 2; stress-activated protein kinase JNK2; go_function: ATP binding; go_function: nucleotide binding; go_function: MAP kinase activity; go_function: protein binding; go_function: transferase activity; go_function: JUN kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: JNK cascade; go_process: response to stress; go_process: protein amino acid phosphorylation	mitogen-activated protein kinase 9 isoform 4
MAPK9_P1286_R	5070	0.8562681	526.6539	3733.227	0.008229051	36	190.1251	0.9680014	448.8199	16602.54	1.567107E-29	42	994.1356	0.9737418	428.4107	19595.25	3.678E-38	36	1163.542	0.9117976	311.526	4254.178	0.03065702	36	182.5618	0.964006	408.7993	13626.86	2.744272E-21	32	1203.377	0.9684446	420.3204	15968.82	4.823202E-34	35	968.3229	0.9654408	464.1607	15760.31	1.101636E-22	37	873.8875	0.9736607	470.2177	21078.72	2.543519E-28	37	788.1577	0.9475151	529.2477	11359.86	3.195304E-15	29	663.2658	0.9665598	412.2109	14805.03	6.464848E-25	21	1035.511	MAPK9	MAPK9_P1286_R	21237744	NM_139070.1	MAPK9	5601	5	36.1	179641502	-1286	N	AGCCAGGGAGTGACTCCAGTGACGCCACAGCGCTTAGATGCTGGACAAACAGCTGCTC	JNK2, JNK2A, JNK2B, PRKM9, JNK-55, JNK2BETA, p54aSAPK, JNK2ALPHA	isoform 4 is encoded by transcript variant 4; MAP kinase 9; c-Jun kinase 2; c-Jun N-terminal kinase 2; stress-activated protein kinase JNK2; go_function: ATP binding; go_function: nucleotide binding; go_function: MAP kinase activity; go_function: protein binding; go_function: transferase activity; go_function: JUN kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: JNK cascade; go_process: response to stress; go_process: protein amino acid phosphorylation	mitogen-activated protein kinase 9 isoform 4
MAS1_P469_R	2733	0.7198423	487.7191	1510.096	0.3521522	32	63.38367	0.9563903	575.7086	14818.73	6.983441E-24	20	1020.11	0.9605857	644.9271	18154.98	3.678E-38	41	690.2667	0.3164937	381.6839	223.041	0.7662762	31	28.4495	0.9551726	502.1748	12831.01	3.935019E-19	28	897.3531	0.9526825	560.8199	13304.84	5.991115E-24	25	947.049	0.9517737	682.9014	15451.01	2.022563E-22	18	1100.549	0.9652881	590.4937	19201.66	9.584988E-24	24	662.6315	0.9355437	642.5789	10778.08	5.376732E-14	32	613.7169	0.9634309	548.1916	17076.94	7.029979E-34	23	900.9274	MAS1	MAS1_P469_R	6006022	NM_002377.2	MAS1	4142	6	36.1	160247495	-469	N	CAGTGGCAGCATTGCCCAGACATGCGTTTTGTCATCAAGTCTTAATGCAGTCCAC	MAS	go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: angiotensin type II receptor activity; go_process: morphogenesis; go_process: signal transduction; go_process: cell proliferation; go_process: G-protein coupled receptor protein signaling pathway	MAS1 oncogene
MAS1_P657_R	2738	0.8661556	591.6888	4476.169	0.0009049983	25	172.3477	0.9613193	511.424	15195.53	6.718023E-25	36	1020.473	0.9647961	631.6218	20050.79	3.678E-38	24	845.0189	0.5471371	2910.493	3637.2	0.000759281	21	310.2765	0.9632077	503.4017	15796.83	4.369786E-29	29	1299.401	0.9616199	494.0937	14885.09	8.86954E-30	26	1207.728	0.9543443	675.3721	16207.66	1.184333E-24	36	1118.167	0.9621724	661.0012	19356.62	2.619429E-24	39	700.9597	0.9369901	592.4899	10297.69	1.12279E-12	24	923.2123	0.9671204	602.8495	20673.63	3.678E-38	29	1223.623	MAS1	MAS1_P657_R	6006022	NM_002377.2	MAS1	4142	6	36.1	160247307	-657	N	CCACACATCAATGGCTTGCCTGGCTTACGTAGTCTGAGCAGGTGCCCAGCTTTGTCGC	MAS	go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: angiotensin type II receptor activity; go_process: morphogenesis; go_process: signal transduction; go_process: cell proliferation; go_process: G-protein coupled receptor protein signaling pathway	MAS1 oncogene
MATK_P190_R	5839	0.0506805	3947.485	216.0796	0.01037162	29	152.25	0.4124883	5007.669	3586.063	2.539445E-07	28	345.9545	0.4675096	5514.228	4929.113	1.247863E-11	24	360.5121	0.09659611	1503.543	171.4582	0.5098462	31	49.21437	0.3675215	5843.633	3453.735	3.878358E-09	26	249.4564	0.4974326	5094.197	5141.128	1.060003E-12	23	272.1223	0.3942779	5619.159	3722.727	2.569413E-07	30	311.2333	0.3206401	7379.381	3530.072	3.972854E-07	34	354.2477	0.4488597	5079.628	4218.393	3.76201E-09	31	287.623	0.264273	6982.449	2544.015	1.766352E-09	17	568.4928	MATK	MATK_P190_R	21450845	NM_139355.1	MATK	4145	19	36.1	3753000	-190	Y	CTCCCGGGGCATAAGGAAGGAAGCGGGGCTGCAGGTACCGCCTG	CHK, CTK, HYL, Lsk, HYLTK, HHYLTK, MGC1708, MGC2101, DKFZp434N1212	isoform a is encoded by transcript variant 1; Csk-homologous kinase; tyrosine-protein kinase CTK; protein kinase HYL; hematopoietic consensus tyrosine-lacking kinase; tyrosylprotein kinase; hydroxyaryl-protein kinase; Csk-type protein tyrosine kinase; HYL tyrosine kinase; tyrosine kinase MATK; leukocyte carboxyl-terminal src kinase related gene; go_component: soluble fraction; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell proliferation; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of progression through cell cycle	megakaryocyte-associated tyrosine kinase isoform a
MATK_P64_F	5744	0.04067392	5580.152	240.8295	7.474307E-05	17	239.9108	0.1256	13068.18	1891.495	1.663843E-22	28	1104.4	0.1194388	16984.13	2317.282	3.678E-38	33	1121.429	0.03060487	5877.21	188.7071	0.002150832	29	286.9915	0.08993299	12976.93	1292.264	4.943566E-22	33	593.5829	0.1611781	11966.16	2318.491	1.702262E-25	24	1010.797	0.121668	12514.23	1747.344	2.463339E-17	27	811.944	0.07050429	18623.32	1420.205	2.25438E-24	21	1222.124	0.1264049	10354.22	1512.674	3.663877E-15	24	825.8543	0.06826891	17536	1292.208	3.678E-38	24	955.3001	MATK	MATK_P64_F	21450845	NM_139355.1	MATK	4145	19	36.1	3752874	-64	Y	GGCCGACTTAACTCTTTGTCAGCCGGGCTGGTTTTCACCCACCTGGTGGCAG	CHK, CTK, HYL, Lsk, HYLTK, HHYLTK, MGC1708, MGC2101, DKFZp434N1212	isoform a is encoded by transcript variant 1; Csk-homologous kinase; tyrosine-protein kinase CTK; protein kinase HYL; hematopoietic consensus tyrosine-lacking kinase; tyrosylprotein kinase; hydroxyaryl-protein kinase; Csk-type protein tyrosine kinase; HYL tyrosine kinase; tyrosine kinase MATK; leukocyte carboxyl-terminal src kinase related gene; go_component: soluble fraction; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: cell proliferation; go_process: mesoderm development; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation; go_process: regulation of progression through cell cycle	megakaryocyte-associated tyrosine kinase isoform a
MBD2_P233_F	4074	0.2927517	2080.202	902.4522	0.1040937	26	82.86574	0.7057703	2295.908	5747.077	1.922991E-06	25	373.015	0.7042879	2897.107	7138.112	1.032508E-10	37	347.3011	0.05533268	3075.672	186.0109	0.1548233	29	215.2271	0.7409998	2239.94	6694.573	1.942591E-08	26	465.0609	0.7073822	2677.622	6714.699	1.223344E-10	35	441.1949	0.7142496	2382.028	6203.973	3.340234E-06	29	523.3776	0.7634009	2582.016	8653.684	1.512821E-07	26	561.8289	0.7192815	2121.19	5691.327	1.898338E-06	31	320.6896	0.7657423	2167.453	7411.857	1.382431E-09	34	276.4165	MBD2	MBD2_P233_F	21464121	NM_003927.3	MBD2	8932	18	36.1	50005389	-233	N	GGGGTGATAGCCCCTTTTCCCGCCCCTCTGCACAAAGCTTGCAGGGGA	DMTase, NY-CO-41, DKFZp586O0821	isoform 1 is encoded by transcript variant 1; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: methyl-CpG binding; go_function: satellite DNA binding; go_function: transcriptional repressor activity; go_process: transcription; go_process: negative regulation of transcription; go_process: regulation of transcription, DNA-dependent	methyl-CpG binding domain protein 2 isoform 1
MC2R_E455_F	3630	0.4169291	5458.465	3974.621	1.14819E-12	38	335.2343	0.919566	1113.035	13868.09	1.426258E-22	24	512.9402	0.9452999	1038.281	19671.21	3.678E-38	29	694.5563	0.802106	1001.755	4465.645	0.006896441	30	203.1548	0.9328015	973.2505	14898.11	1.646331E-27	23	938.0402	0.9361088	942.5305	15274.74	2.693154E-33	24	1004.044	0.9266733	1098.046	15140.43	1.002521E-22	36	940.9617	0.9328308	1331.696	19883.07	2.036458E-27	27	865.2997	0.9270125	1023.298	14266.98	7.818419E-26	29	825.8001	0.9395652	1007.577	17219.22	2.400734E-36	14	929.4642	MC2R	MC2R_E455_F	66346710	NM_000529.2	MC2R	4158	18	36.1	13905080	455	N	GCCGCATGCCCACGTCTTTGTGGCGCTAAAACCCCCGCACTCTTACAC	ACTHR, MGC125798	adrenocorticotropic hormone receptor; ACTH receptor; corticotropin receptor; MC2 receptor; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: adrenocorticotropin receptor activity; go_process: signal transduction; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	melanocortin 2 receptor
MC2R_P1025_F	1360	0.7583129	559.9093	2070.519	0.1725399	29	91.3167	0.8075547	1146.545	5230.853	0.0003389799	31	369.7389	0.7662068	1559.846	5439.787	3.207832E-05	27	230.3978	0.6218843	554.6437	1076.688	0.5212633	37	71.19284	0.7918875	1314.185	5381.106	7.768516E-05	30	265.1608	0.7692844	1322.177	4742.021	0.0001704305	27	513.763	0.813677	1098.692	5234.714	0.001530839	34	283.6437	0.7710879	1398.277	5046.931	0.008133034	42	213.7115	0.7345367	1252.555	3742.519	0.007585209	33	314.8017	0.8254648	1067.476	5521.585	0.0001232103	24	262.2521	MC2R	MC2R_P1025_F	66346710	NM_000529.2	MC2R	4158	18	36.1	13906560	-1025	N	AACATGCCCTGCAGCTGAAACCCGGCGTTCCACAGGCCTCTTTCC	ACTHR, MGC125798	adrenocorticotropic hormone receptor; ACTH receptor; corticotropin receptor; MC2 receptor; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: adrenocorticotropin receptor activity; go_process: signal transduction; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	melanocortin 2 receptor
MC2R_P6_R	1344	0.4333847	413.1056	392.457	0.7532226	32	24.71854	0.8811905	1189.584	9564.628	1.959316E-11	33	749.773	0.9308193	1356.218	19593.25	3.678E-38	38	805.9932	0.06817202	2109.034	161.6117	0.3571906	22	120.8193	0.9255008	1316.874	17601.75	3.678E-38	31	734.4035	0.8969272	1674.782	15443.95	2.6057E-37	31	1213.7	0.9353474	1018.382	16179.96	1.258876E-25	26	1364.484	0.9080024	1081.528	11661.5	1.134838E-09	30	568.6956	0.9028202	1218.312	12247.39	9.119449E-20	27	989.0095	0.941322	1192.201	20729.69	3.678E-38	29	674.3635	MC2R	MC2R_P6_R	66346710	NM_000529.2	MC2R	4158	18	36.1	13905541	-6	N	GGCAAAATGAATGAGAAGGAATGAGCTCGGAGAGAAAAGCAAGCAAGTGGACC	ACTHR, MGC125798	adrenocorticotropic hormone receptor; ACTH receptor; corticotropin receptor; MC2 receptor; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: adrenocorticotropin receptor activity; go_process: signal transduction; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	melanocortin 2 receptor
MCAM_P169_R	4262	0.5950475	3218.748	4876.654	2.914647E-09	20	472.9724	0.07589519	9464.771	785.5387	2.219823E-10	15	689.1495	0.07237747	11258.74	886.2625	6.419632E-16	33	594.7275	0.7028538	596.1564	1646.651	0.3640251	28	87.0798	0.0852895	8623.571	813.4038	2.045232E-09	29	548.2131	0.1680867	8508.71	1739.376	9.828887E-13	28	551.3377	0.0803938	9912.822	875.3408	9.217276E-10	24	333.8217	0.08661947	12347.71	1180.465	6.690923E-11	30	703.6466	0.0972772	7422.565	810.6299	3.715382E-07	29	413.8854	0.07075778	9963.618	766.301	4.494339E-12	29	468.5451	MCAM	MCAM_P169_R	71274106	NM_006500.2	MCAM	4162	11	36.1	118693219	-169	Y	GGGAGCTGCGCCTAGGAGCGCTGCCGGAGGTAGGCCAGAGCCGGACTC	CD146, MUC18	melanoma adhesion molecule; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_process: cell adhesion; go_process: morphogenesis	melanoma cell adhesion molecule
MCAM_P265_R	4265	0.1107537	9157.982	1153.061	3.130745E-15	26	497.6491	0.1815967	10439.43	2338.609	2.966587E-16	22	712.4067	0.1280198	12239.23	1811.585	1.304772E-21	33	535.1652	0.170173	6516.773	1356.905	2.664753E-05	32	255.7774	0.1941679	9851.972	2397.96	4.757542E-16	43	431.6009	0.270254	9599.02	3591.934	1.44415E-21	36	366.6971	0.1650591	11674.45	2327.685	1.098053E-16	26	789.6636	0.1613381	11986.8	2325.207	3.265476E-12	33	618.035	0.2034423	7799.624	2017.579	3.144932E-10	32	864.5385	0.1648661	10553.94	2103.225	5.63856E-17	25	478.8974	MCAM	MCAM_P265_R	71274106	NM_006500.2	MCAM	4162	11	36.1	118693315	-265	Y	GTCTGACTGGCCGAGGTGGCAGCGAGGAGAAGCTGTCCCGGATG	CD146, MUC18	melanoma adhesion molecule; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_process: cell adhesion; go_process: morphogenesis	melanoma cell adhesion molecule
MCC_E23_R	887	0.1173067	2385.28	330.2846	0.1538248	27	87.00729	0.03108514	9397.788	304.7121	2.671099E-09	25	289.7388	0.04270764	11695.09	526.2137	3.960135E-16	25	476.4534	0.04534	3816.25	185.9958	0.06659097	30	149.8607	0.05138427	9538.604	522.1004	1.023456E-10	37	406.2502	0.05258637	10831.67	606.7642	5.299898E-16	36	528.2616	0.05606248	9659.923	579.6628	8.725596E-09	21	802.3047	0.06599604	11928.46	849.9221	1.003193E-09	25	774.5039	0.0659294	8143.271	581.8338	4.837027E-08	25	603.5291	0.03096891	12040.97	388.0089	2.396881E-16	37	788.7161	MCC	MCC_E23_R	4505128	NM_002387.1	MCC	4163	5	36.1	112658178	23	Y	AAAAGAGCAGCCGTGGCTCGCGTTTCACGGACGAGCCATTGCTGCAGGAGG	FLJ46755	go_function: calcium ion binding; go_function: protein binding; go_function: receptor activity; go_process: cell cycle; go_process: signal transduction; go_process: negative regulation of progression through cell cycle	mutated in colorectal cancers
MCC_P196_R	4270	0.04542534	3709.173	181.2671	0.01928053	26	180.9515	0.09038964	7192.278	724.6469	2.989717E-06	26	298.4305	0.09438088	8538.193	900.2463	1.900812E-09	22	412.4977	0.0454794	5470.862	265.4311	0.00415796	25	188.0148	0.09626786	7645.775	825.0998	1.364994E-07	29	385.713	0.08982579	8634.3	861.9948	6.987774E-11	27	443.2007	0.1009002	7584.543	862.387	5.206356E-06	28	265.1279	0.0949086	8389.214	890.1857	3.015611E-05	35	381.6822	0.09231232	6387.046	659.736	2.836863E-05	28	320.6018	0.09727295	8737.104	952.2383	8.2572E-10	21	391.9126	MCC	MCC_P196_R	4505128	NM_002387.1	MCC	4163	5	36.1	112658397	-196	Y	AGCACGAGCCGACACCCTAGAGGGCACCGGCGAGCTCCCGAAAAAACTAGGGCG	FLJ46755	go_function: calcium ion binding; go_function: protein binding; go_function: receptor activity; go_process: cell cycle; go_process: signal transduction; go_process: negative regulation of progression through cell cycle	mutated in colorectal cancers
MCF2_E195_F	780	0.3797678	1865.661	1203.573	0.09080005	37	97.85591	0.9119652	1090.899	12336.69	5.318561E-18	24	1049.137	0.9010819	1412.771	13780.39	1.786227E-25	35	563.6508	0.7755582	391.7164	1699.125	0.4020473	32	66.53867	0.9397258	868.2985	15096.6	7.528888E-28	31	1444.075	0.9492169	897.8995	18652.33	3.678E-38	27	1103.098	0.933268	1132.038	17230.42	2.148427E-29	34	1175.276	0.9326669	1402.39	20810.41	3.670189E-30	31	729.8615	0.9233711	948.7154	12636.92	3.870875E-20	34	973.4921	0.9479219	983.2635	19717.47	3.678E-38	29	930.2144	MCF2	MCF2_E195_F	19923309	NM_005369.2	MCF2	4168	X	36.1	138552324	195	N	TCTGAACCTCATCTTGCCTCTCCGGGGATTTGCTTCTGCCATTTCGCCTGTACG	DBL	Oncogene MCF2 (oncogene DBL); MCF.2 cell line derived transforming sequence variant; go_component: cytosol; go_component: cytoskeleton; go_component: membrane fraction; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	MCF.2 cell line derived transforming sequence
MCF2_P1024_R	4090	0.01558434	20770.86	330.4078	3.678E-38	31	514.8685	0.8682709	442.1101	3573.231	0.04782802	29	265.7622	0.8813526	534.8647	4715.988	0.004176166	38	268.3073	0.0136131	12864.46	178.9222	5.414817E-14	29	1509.021	0.9197055	498.3542	6853.643	9.13994E-06	29	411.5273	0.9106191	622.0927	7356.738	1.213925E-07	28	324.7124	0.917518	582.3359	7590.209	1.218344E-05	29	512.1603	0.9179199	636.8753	8240.64	7.732234E-05	28	347.5762	0.8956478	530.1018	5408.118	0.0007814146	32	540.8809	0.9257734	545.6879	8053.185	1.008386E-07	25	492.148	MCF2	MCF2_P1024_R	19923309	NM_005369.2	MCF2	4168	X	36.1	138553543	-1024	N	TGGGAATACAGAAAGAGGAGTATCACTCCCCGGTAGACAAGTAATTACCCTCTGTTGAC	DBL	Oncogene MCF2 (oncogene DBL); MCF.2 cell line derived transforming sequence variant; go_component: cytosol; go_component: cytoskeleton; go_component: membrane fraction; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	MCF.2 cell line derived transforming sequence
MCF2_P445_F	4271	0.4977107	1726.9	1810.247	0.03975844	31	127.7679	0.894891	1195.029	11025.8	7.817805E-15	31	587.137	0.8964086	1505.195	13890.25	3.407459E-26	33	698.989	0.7090772	913.0894	2469.241	0.1367382	23	170.655	0.9163098	1281.795	15129.03	1.684615E-29	29	705.3926	0.9287465	1058.913	15105.74	4.541428E-33	19	1356.354	0.904265	1742.992	17407.98	4.211838E-32	26	1202.918	0.9146324	1480.399	16932.47	1.882402E-20	35	725.9302	0.896757	917.7862	8840.375	4.204065E-10	30	629.6676	0.9459645	949.6926	18376.29	3.678E-38	25	1007.605	MCF2	MCF2_P445_F	19923309	NM_005369.2	MCF2	4168	X	36.1	138552964	-445	N	AGAATAGAACATGCAAACTTTCTAAGACGGATACAATTCTCTCCCAAATTAACCTT	DBL	Oncogene MCF2 (oncogene DBL); MCF.2 cell line derived transforming sequence variant; go_component: cytosol; go_component: cytoskeleton; go_component: membrane fraction; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	MCF.2 cell line derived transforming sequence
MCM2_P241_R	2100	0.03783528	8117.607	323.1416	4.401176E-10	30	358.8638	0.06019079	13726.61	885.5357	1.951863E-21	21	764.7668	0.05261537	16374.34	914.9437	1.903041E-33	30	1097.006	0.03624305	7177.259	273.6687	8.379023E-05	34	309.6136	0.06212468	14365.28	958.1775	1.453766E-25	22	817.9965	0.06357132	13546.63	926.4288	3.302237E-26	27	1035.931	0.06299645	14966.34	1012.937	5.657892E-22	26	876.8334	0.05909262	17497.48	1105.19	6.873318E-21	27	824.6337	0.0793123	9232.718	803.9636	1.049892E-10	28	542.4076	0.04742496	17106.88	856.6629	2.956333E-35	33	774.2221	MCM2	MCM2_P241_R	33356546	NM_004526.2	MCM2	4171	3	36.1	128799702	-241	Y	CACGCAGCCAGCAAGTGTCGTCGGGTCCCCTGGAGCCTCAGCTTCTAC	BM28, CCNL1, CDCL1, cdc19, D3S3194, MITOTIN, KIAA0030, MGC10606	cyclin-like 1; minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin); cell devision cycle-like 1; nuclear protein BM28; DNA replication licensing factor MCM2; go_component: nucleus; go_component: chromatin; go_function: ATP binding; go_function: DNA binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: DNA-dependent ATPase activity; go_process: transcription; go_process: cell cycle; go_process: DNA replication; go_process: DNA replication initiation; go_process: regulation of transcription, DNA-dependent	minichromosome maintenance protein 2
MCM2_P260_F	2322	0.2744387	4443.266	1718.459	2.101562E-05	27	327.4393	0.1073859	9365.215	1138.713	6.652292E-11	27	469.1135	0.08273789	12157.37	1105.626	3.824767E-19	25	529.131	0.6910469	552.7911	1460.122	0.4219369	27	66.18616	0.1218201	9370.979	1313.803	4.091002E-12	30	462.4372	0.1516319	8642.723	1562.619	1.2653E-12	25	792.8482	0.1364986	9560.812	1527.139	2.54621E-10	30	445.1586	0.1335588	12843.53	1995.198	3.848532E-13	21	622.794	0.1309218	7905.667	1206.01	8.818597E-09	33	452.0482	0.08557785	10786.78	1018.859	1.07278E-14	32	320.1548	MCM2	MCM2_P260_F	33356546	NM_004526.2	MCM2	4171	3	36.1	128799683	-260	Y	GGCCCTGGTGTGACCGAGGTCACGCAGCCAGCAAGTGTCGTCGGGTCCC	BM28, CCNL1, CDCL1, cdc19, D3S3194, MITOTIN, KIAA0030, MGC10606	cyclin-like 1; minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin); cell devision cycle-like 1; nuclear protein BM28; DNA replication licensing factor MCM2; go_component: nucleus; go_component: chromatin; go_function: ATP binding; go_function: DNA binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: DNA-dependent ATPase activity; go_process: transcription; go_process: cell cycle; go_process: DNA replication; go_process: DNA replication initiation; go_process: regulation of transcription, DNA-dependent	minichromosome maintenance protein 2
MCM6_E136_F	2818	0.04511528	8362.529	399.8278	6.962592E-11	19	749.9193	0.05472075	12018.1	701.498	4.213388E-16	35	840.5677	0.05287898	15142.16	850.9891	2.209308E-28	27	1146.759	0.1983791	7305.508	1832.66	5.583835E-07	28	383.845	0.07051038	12420.66	949.808	3.045052E-19	22	897.0727	0.0574866	14382.27	883.3155	2.563243E-29	32	1292.454	0.07164759	14075.62	1094.034	1.030538E-19	20	870.1129	0.06816767	15230.59	1121.501	5.068271E-16	26	1097.775	0.09165777	9945.606	1013.669	7.629739E-13	31	710.4305	0.04436832	17714.77	827.1086	1.128356E-37	29	977.9819	MCM6	MCM6_E136_F	33469920	NM_005915.4	MCM6	4175	2	36.1	136350345	136	Y	TCTGGCACTTCTCGGCCACCTCGTCGCGGACCTCCAGGTGCTGGCTGCCG	Mis5, P105MCM, MCG40308	minichromosome maintenance deficient (mis5, S. pombe) 6; DNA replication licensing factor MCM6; go_component: nucleus; go_function: DNA binding; go_function: ATP binding; go_function: nucleotide binding; go_function: protein self binding; go_function: DNA-dependent ATPase activity; go_process: cell cycle; go_process: transcription; go_process: DNA replication; go_process: DNA replication initiation; go_process: regulation of transcription, DNA-dependent	minichromosome maintenance protein 6
MDR1_seq_42_S300_R	6068	0.03403471	6013.655	215.4078	1.618522E-05	22	284.6012	0.04246133	10137.23	453.9621	4.360244E-11	25	688.2064	0.02763493	11811.72	338.5348	6.210598E-16	22	546.1304	0.3880927	2136.09	1418.205	0.1135473	26	184.3239	0.03931353	9618.215	397.692	1.278518E-10	34	603.795	0.07144555	10635.43	826.0134	4.539611E-16	32	468.0967	0.03943631	10506.86	435.4685	4.78108E-10	18	796.6901	0.04779215	11061.98	560.2296	4.617024E-08	31	448.153	0.06060631	8755.469	571.3231	3.292329E-09	23	722.3633	0.03608713	12186.72	459.9922	6.029196E-17	34	390.7317	MDR1	MDR1_seq_42_S300_R	.	.	.	.	7	36.1	87068270	.	Y	ATTCAACCTGTTTCGCAGTTTCTCGAGGAATCAGCATTCAGTCAATCCG	.	.	.
MDS1_E45_F	799	0.06587621	5373.687	386.0149	9.302903E-05	29	225.9662	0.168661	9157.888	1878.229	4.753576E-12	20	879.0461	0.1436931	11697.85	1979.745	2.015354E-20	24	541.4692	0.2786833	4184.548	1655.351	0.003395573	31	263.3008	0.1448585	9657.022	1652.811	1.300317E-13	26	629.1722	0.1802228	9677.943	2149.619	3.683336E-17	27	799.3929	0.16099	8995.685	1745.288	1.124411E-09	37	669.9255	0.1549372	11786.12	2179.249	1.271584E-11	22	293.562	0.1521895	5736.728	1047.745	6.625836E-05	22	328.8109	0.145045	12896.34	2204.859	1.606481E-24	24	763.8037	MDS1	MDS1_E45_F	4826827	NM_004991.1	MDS1	4197	3	36.1	170864123	45	Y	CCTTTCTCTCAATCCACACTCGCTATCTCTCCAGCATTGTCAGTTTGGACA	PRDM3, MDS1-EVI1	go_component: nucleus; go_function: ATP binding; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent	myelodysplasia syndrome protein 1
MECP2_E90_R	3633	0.1417969	3076.856	524.897	0.03505783	35	111.9445	0.1569248	4918.355	934.0855	0.001291625	23	210.7757	0.1630796	5144.643	1021.954	0.0004049322	27	193.9279	0.8571223	717.5213	4904.306	0.005175259	31	162.4117	0.4266843	3641.386	2784.489	0.0001743644	21	324.1662	0.4962203	3840.617	3881.487	3.688001E-07	26	255.3575	0.3794004	4520.245	2824.563	0.000129133	22	279.6086	0.3844418	5386.591	3426.605	8.948678E-05	26	285.2003	0.334428	4470.058	2296.303	7.015214E-05	26	355.5483	0.5000843	3321.286	3422.44	7.721294E-05	30	234.8182	MECP2	MECP2_E90_R	7710148	NM_004992.2	MECP2	4204	X	36.1	153016233	90	Y	GCCCCCCGGCAAGGGTCCCCGCCCGCGGCCACGGCGGTCCCACTCACAGTCT	RTS, RTT, PPMX, MRX16, MRX79, AUTSX3, DKFZp686A24160	go_component: nucleus; go_function: DNA binding; go_function: DNA binding; go_function: transcription corepressor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	methyl CpG binding protein 2
MECP2_P398_R	1382	0.2157206	1528.931	448.0467	0.3590807	33	83.46547	0.155937	6075.092	1140.821	2.99566E-05	30	384.1788	0.1632576	6859.741	1357.922	3.831519E-07	27	320.3355	0.3970577	516.6544	406.0876	0.6977926	21	63.46654	0.5809061	3820.935	5434.807	4.68354E-09	31	397.752	0.5305332	4576.114	5284.365	9.284369E-12	31	567.7531	0.5165745	4837.427	5275.992	1.435078E-08	26	467.985	0.5711029	5458.835	7401.93	7.515121E-10	31	421.1127	0.6152916	3327.939	5482.548	3.346584E-08	37	408.8493	0.56899	5126.955	6900.269	2.849183E-15	29	345.768	MECP2	MECP2_P398_R	7710148	NM_004992.2	MECP2	4204	X	36.1	153016721	-398	Y	TGAATGTTAAGGATTAATGGACCCTTGCGGATGCTGGGGCAAGTGAA	RTS, RTT, PPMX, MRX16, MRX79, AUTSX3, DKFZp686A24160	go_component: nucleus; go_function: DNA binding; go_function: DNA binding; go_function: transcription corepressor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	methyl CpG binding protein 2
MEG3_E91_F	3640	0.2611112	1488.624	561.3936	0.3350133	34	53.17218	0.4631502	4210.361	3718.628	2.867105E-06	26	473.5971	0.4825314	4590.201	4373.54	1.660129E-08	30	292.2176	0.1968305	520.0168	151.9458	0.7525511	33	28.0535	0.4861549	3565.95	3468.398	2.651886E-05	21	303.7136	0.4783334	4144.031	3891.493	9.442202E-08	28	339.7309	0.4869503	4207.72	4088.581	8.337805E-06	26	297.2285	0.4727696	4738.961	4339.115	4.863108E-05	33	340.2682	0.4756509	3973.821	3695.47	3.23079E-06	27	324.253	0.4103889	4410.526	3139.475	5.452937E-06	18	293.2936	MEG3	MEG3_E91_F	89037804	XR_001355.1	MEG3	55384	14	36.1	100362306	91	Y	GGGCGCCCACGAGAGGATCCCTCACCCGGTGAGTGGTTGGCCATCCT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	.
MEG3_P235_F	1384	0.8057976	452.1623	2291.069	0.1480436	21	109.9376	0.8647386	2450.835	16307.73	5.121065E-36	22	1491.287	0.8768017	2714.485	20030.68	3.678E-38	33	841.5839	0.3555288	1392.543	823.376	0.3706678	33	84.22876	0.8735297	2393.7	17223.98	3.678E-38	36	1054.082	0.8495541	2622.801	15375.4	3.678E-38	26	1475.007	0.8620801	2539.242	16496.8	1.06401E-31	24	1472.376	0.8695201	3090.725	21263.03	1.626349E-36	27	1241.344	0.8523359	1882.259	11441.85	2.480477E-19	17	1487.742	0.8621986	2723.874	17668.47	3.678E-38	35	906.1854	MEG3	MEG3_P235_F	89037804	XR_001355.1	MEG3	55384	14	36.1	100361980	-235	Y	CGGGCTCACGCAGGGAAAAAGCACCCGCGACCACAGGGTGTTGGTCATGGC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	.
MEST_E150_F	3648	0.161827	3133.724	624.3385	0.02554744	40	134.1357	0.2029954	8602.544	2216.52	1.419758E-11	26	511.6144	0.1626333	9945.325	1951.003	3.025954E-15	24	597.2064	0.02301099	7002.214	167.2782	0.0001725253	15	238.6779	0.2124683	8705.606	2375.666	4.710354E-13	24	632.0505	0.2298581	8544.563	2580.074	4.225697E-15	19	715.0109	0.1412158	10533.81	1748.59	1.005031E-12	39	661.4199	0.1690698	12714.11	2607.294	5.021381E-14	23	787.7603	0.2126006	7269.538	1989.802	4.497313E-09	28	435.1324	0.1576059	10488.52	1981.038	1.857067E-16	32	677.1466	MEST	MEST_E150_F	29294638	NM_002402.2	MEST	4232	7	36.1	129913432	150	Y	TCAGGAAGCGCATGCGCAACCGGTTCTCCGAAACATGGAGTCCTGTAGGCAAGG	PEG1, MGC8703, MGC111102, DKFZp686L18234	isoform a is encoded by transcript variant 1; paternally expressed gene 1; go_function: catalytic activity; go_function: hydrolase activity; go_process: mesoderm development	mesoderm specific transcript isoform a
MEST_P4_F	1390	0.05741562	9228.514	568.2275	1.070614E-13	20	737.1949	0.111571	10342.33	1311.373	1.844662E-13	26	520.953	0.07046095	11980.34	915.7139	4.750759E-18	25	763.9827	0.04891264	7463.259	388.9643	2.82926E-05	34	304.468	0.1724794	8590.449	1811.343	1.810865E-11	51	526.3434	0.1035268	10220.8	1191.871	6.300109E-16	25	905.462	0.07282057	10092.2	800.4943	5.913096E-10	30	424.016	0.08708528	12424.87	1194.779	4.750769E-11	28	707.847	0.2063348	6824.401	1800.185	7.422079E-08	29	357.8332	0.1003462	11396.73	1282.33	4.900079E-17	31	1431.134	MEST	MEST_P4_F	29294638	NM_002402.2	MEST	4232	7	36.1	129913278	-4	Y	GCTGACGCCTGGCAGGGAGAAGGCGGCAGCACATGCTGGGCTCGGG	PEG1, MGC8703, MGC111102, DKFZp686L18234	isoform a is encoded by transcript variant 1; paternally expressed gene 1; go_function: catalytic activity; go_function: hydrolase activity; go_process: mesoderm development	mesoderm specific transcript isoform a
MEST_P62_R	1392	0.3867916	3213.507	2090.051	0.0004340342	33	386.4185	0.215917	8988.553	2502.762	4.420039E-13	33	756.5774	0.1241772	11190.07	1600.746	9.64072E-18	24	552.5603	0.1455426	3732.767	652.8481	0.03979157	19	258.3606	0.3091914	7653.899	3470.483	3.703532E-13	28	787.1154	0.1867675	12202.66	2825.436	2.291484E-28	20	692.5265	0.1016845	11218.08	1281.146	3.430078E-13	26	825.0201	0.112072	13004.2	1653.978	8.089193E-13	29	510.9745	0.3250336	5360.057	2629.319	9.683682E-07	33	591.7542	0.1418754	11452.21	1909.949	5.340529E-19	36	561.9423	MEST	MEST_P62_R	29294638	NM_002402.2	MEST	4232	7	36.1	129913220	-62	Y	GCCGGAGGCTATTGTCGAAGCCACGGCCTGCCATTTCATACCCTTTGCAA	PEG1, MGC8703, MGC111102, DKFZp686L18234	isoform a is encoded by transcript variant 1; paternally expressed gene 1; go_function: catalytic activity; go_function: hydrolase activity; go_process: mesoderm development	mesoderm specific transcript isoform a
MET_E333_F	805	0.1543536	3414.035	641.4074	0.01334172	33	178.8152	0.5736113	3685.731	5092.86	1.242475E-07	28	318.7901	0.6750029	3307.501	7077.212	1.700718E-11	20	446.181	0.1002597	1516.017	180.0757	0.5043283	23	59.30809	0.6260648	3264.237	5632.608	2.286416E-08	24	451.479	0.7198194	3022	8020.814	7.182562E-15	31	609.0294	0.753777	2394.317	7636.001	1.983711E-08	35	461.3239	0.6873016	3411.236	7717.589	2.083226E-07	31	372.1632	0.6602023	2369.243	4797.56	1.898975E-05	23	544.5706	0.5823646	3658.059	5240.361	2.880326E-08	22	479.0639	MET	MET_E333_F	42741654	NM_000245.2	MET	4233	7	36.1	116100028	333	Y	GGAAACTGAAGAGACGTGGCCACGGCGAGGACGAAACTAGAATGGGG	HGFR, RCCP2	Oncogene MET; go_component: membrane; go_component: basal plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: hepatocyte growth factor receptor activity; go_process: development; go_process: cell proliferation; go_process: signal transduction; go_process: protein amino acid phosphorylation	met proto-oncogene precursor
MFAP4_P10_R	2358	0.1002996	7160.525	809.4117	5.661166E-09	18	390.2143	0.4385051	6457.136	5120.862	2.777146E-13	30	460.0712	0.3610588	8238.166	4711.808	3.297301E-18	23	528.1131	0.05879457	6083.964	386.2956	0.000903244	23	276.752	0.3487847	6621.266	3599.846	4.570211E-11	22	702.487	0.5235489	5942.831	6640.172	1.555153E-19	23	806.201	0.2998854	8482.145	3676.055	1.842339E-12	33	369.2698	0.3146646	10432.51	4835.894	6.30233E-14	22	687.1584	0.3929935	6501.855	4274.232	2.11168E-12	34	550.2468	0.2690715	8147.265	3036.006	3.824201E-13	27	354.784	MFAP4	MFAP4_P10_R	23111004	NM_002404.1	MFAP4	4239	17	36.1	19231096	-10	N	TGCTCAGAGTGGCTGGGTGTCTGCGGCCCCAGACTGCAACCGCCCAGAGTT	.	microfibril-associated glycoprotein 4; go_component: microfibril; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion	microfibrillar-associated protein 4
MFAP4_P197_F	2363	0.1331249	4418.19	693.8529	0.0007910295	28	209.189	0.5816962	5105.506	7238.812	3.840163E-15	27	924.9843	0.5533903	7681.952	9642.553	1.366819E-33	31	778.4156	0.2196109	2113.341	622.8607	0.2510084	31	121.4686	0.524814	6407.797	7187.467	6.381205E-20	27	764.4916	0.605148	5393.542	8419.374	9.301121E-24	28	984.3	0.456161	7936.998	6741.269	2.092628E-18	22	1264.079	0.4308648	9127.412	6985.63	1.516418E-15	32	609.0776	0.5844317	3700.566	5344.9	1.187727E-08	30	542.6663	0.4635734	8946.228	7817.64	1.659041E-30	26	828.8877	MFAP4	MFAP4_P197_F	23111004	NM_002404.1	MFAP4	4239	17	36.1	19231283	-197	N	GACCACCTGTGTCTCATTAGTCCTGTCGGGCAAAGTACTGCAGACGTTAACTCCCTGC	.	microfibril-associated glycoprotein 4; go_component: microfibril; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: calcium ion binding; go_process: cell adhesion	microfibrillar-associated protein 4
MGMT_P272_R	1432	0.03788534	4749.655	190.9656	0.001322699	24	268.6705	0.06100896	6135.745	405.1544	0.0002172219	21	436.7218	0.03817208	8529.072	342.4621	2.490533E-08	30	406.2449	0.06718621	1808.766	137.4795	0.4391138	34	129.645	0.04671579	7884.093	391.2613	2.994558E-07	28	397.4501	0.04207643	7056.619	314.3518	1.571546E-06	27	554.7245	0.0588468	7382.648	467.8621	3.165444E-05	41	461.5086	0.05437912	9907.681	575.5043	1.334453E-06	20	399.2562	0.08705659	5766.152	559.3854	0.0002657408	27	301.08	0.05405119	7501.838	434.3664	1.347859E-06	33	232.3802	MGMT	MGMT_P272_R	49574515	NM_002412.2	MGMT	4255	10	36.1	131155184	-272	Y	GAAGGGCCATCCGGGTCAGGCGCACAGGGCAGCGGCGCTGCCGGAGG	.	Methylguanine-DNA methyltransferase; O6-methylguanine-DNA methyltransferase; go_component: nucleus; go_function: DNA binding; go_function: transferase activity; go_function: DNA-methyltransferase activity; go_function: methylated-DNA-[protein]-cysteine S-methyltransferase activity; go_process: DNA repair; go_process: DNA ligation	O-6-methylguanine-DNA methyltransferase
MGMT_P281_F	1407	0.06034101	5241.416	343.0036	0.0001712753	40	200.016	0.0506571	11243.57	605.2948	6.336156E-14	33	630.2173	0.05704252	13490.17	822.1129	1.824444E-22	38	705.1951	0.06429937	4036.481	284.2503	0.04358164	32	197.6087	0.04956901	11944.55	628.1744	6.161131E-17	25	1123.862	0.05897636	13779.68	869.8752	6.953051E-27	30	930.7502	0.0561157	11958.34	716.8912	1.410632E-13	32	750.3069	0.06964532	13954.92	1052.135	1.907593E-13	32	739.2891	0.06589483	8974.557	640.1489	8.437724E-10	26	958.1716	0.04586336	12741.92	617.2842	5.449045E-19	26	392.7614	MGMT	MGMT_P281_F	49574515	NM_002412.2	MGMT	4255	10	36.1	131155175	-281	Y	GGCTTGTACCGGCCGAAGGGCCATCCGGGTCAGGCGCACAGGGCAGCGG	.	Methylguanine-DNA methyltransferase; O6-methylguanine-DNA methyltransferase; go_component: nucleus; go_function: DNA binding; go_function: transferase activity; go_function: DNA-methyltransferase activity; go_function: methylated-DNA-[protein]-cysteine S-methyltransferase activity; go_process: DNA repair; go_process: DNA ligation	O-6-methylguanine-DNA methyltransferase
MKRN3_E144_F	3676	0.7809966	631.9014	2610.062	0.06810945	26	96.03251	0.968275	553.0674	19932.17	3.678E-38	37	1153.342	0.9715549	607.8144	24175.69	3.678E-38	30	1099.529	0.6651815	454.1539	1100.933	0.5411497	19	65.44797	0.9565287	811.3709	20053.51	3.678E-38	23	971.8926	0.9479272	850.815	17308.54	3.678E-38	28	1521.79	0.9675008	578.5359	20200.03	4.345407E-38	32	952.4443	0.9558083	955.9978	22839.86	8.4765E-35	29	1122.776	0.9464856	557.4994	11628.91	4.976408E-16	29	1050.444	0.9661744	719.2449	23400.43	3.678E-38	36	815.0665	MKRN3	MKRN3_E144_F	74272285	NM_005664.2	MKRN3	7681	15	36.1	21361691	144	Y	GTGAGAAGGGACTTAGGGACTGCCGGAACACAGCGAAGCAGAGGCAGAAGG	D15S9, RNF63, ZFP127, ZNF127, MGC88288	zinc finger protein 127; go_component: ubiquitin ligase complex; go_component: ribonucleoprotein complex; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_function: ubiquitin-protein ligase activity; go_process: protein ubiquitination	makorin, ring finger protein, 3
MKRN3_P108_F	1439	0.4898044	334.7501	417.3742	0.7680268	23	30.81957	0.9623971	345.7603	11408.64	1.065486E-13	30	601.9655	0.964396	369.144	12707.57	1.388073E-18	31	476.0972	0.6716999	273.7061	764.6004	0.6708523	31	31.44165	0.954441	461.2157	11757.2	5.789605E-16	23	502.1083	0.9532804	445.4166	11128.86	2.113614E-16	41	643.6435	0.9656501	358.7027	12895.15	6.872897E-15	31	482.8107	0.9596404	508.7948	14475.47	2.098827E-13	30	467.5343	0.9474784	380.9103	8675.518	1.130798E-08	27	526.726	0.9607077	441.0479	13228.79	6.391669E-20	31	550.9379	MKRN3	MKRN3_P108_F	74272285	NM_005664.2	MKRN3	7681	15	36.1	21361439	-108	N	AAGACCAAAAGAAACGGCGCCTTGTCAACCGAACGAATTGAAAAAAGCTTCCTG	D15S9, RNF63, ZFP127, ZNF127, MGC88288	zinc finger protein 127; go_component: ubiquitin ligase complex; go_component: ribonucleoprotein complex; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_function: ubiquitin-protein ligase activity; go_process: protein ubiquitination	makorin, ring finger protein, 3
MKRN4_E249_R	3677	0.5172991	666.5836	821.5292	0.5300654	26	49.36806	0.9301329	804.5261	12041.86	1.96362E-16	27	520.1619	0.9444335	750.7156	14459.13	1.559551E-25	28	633.3823	0.6493327	443.4644	1006.336	0.5684321	27	61.13839	0.9520355	695.3952	15787.6	9.009803E-30	29	825.7839	0.9321925	825.5482	12724.09	8.125573E-23	26	786.5848	0.9557602	672.8492	16696.72	3.655388E-26	23	1031.803	0.958028	721.0085	18739.87	6.259947E-23	33	542.3637	0.9306464	655.3105	10135.41	1.948178E-12	30	702.3092	0.934882	821.9775	13236.58	4.045978E-21	34	503.7315	MKRN4	MKRN4_E249_R	.	.	.	7682	X	36.1	40578589	249	Y	GGGTCCTTTGGCCCTATATGATCCCGGAAGTTCCGGGGCTTTTGGACCTCTGTGAT	.	.	.
MKRN4_P1320_R	1493	0.4701571	511.2817	542.4221	0.6783821	33	23.81799	0.9262997	920.2553	12823.04	6.948111E-19	29	800.4404	0.9259575	992.7804	13666.04	1.262905E-23	31	653.385	0.2961438	344.2567	186.9187	0.7807938	30	19.82704	0.9338419	859.8456	13548.51	1.753542E-22	17	1172.362	0.9207467	1323.369	16536.37	3.678E-38	33	784.5767	0.9442005	834.437	15811.9	6.181141E-24	26	886.9373	0.9430418	978.8452	17862.15	1.908578E-21	27	1590.16	0.9099473	828.3436	9380.552	4.351136E-11	24	936.0869	0.9393163	959.0215	16392.46	8.684669E-33	25	838.3836	MKRN4	MKRN4_P1320_R	.	.	.	7682	X	36.1	40577020	-1320	Y	CAGCTGCTGCATCTCCCTCTCTTTCGCTTCTAGTCGCTCAGTAAGCCTCTCAATT	.	.	.
MLF1_E243_F	891	0.1515468	4057.384	742.5729	0.001984303	28	161.7641	0.133342	10706.24	1662.623	3.331022E-15	31	567.4346	0.08973952	16159.88	1603.007	2.087164E-35	25	918.3571	0.1567707	5228.622	990.6817	0.001559574	31	209.5815	0.1044595	12842.02	1509.61	2.678939E-22	39	852.246	0.260625	11766.57	4182.889	3.774026E-32	30	1004.547	0.1636251	11663.88	2301.439	1.354077E-16	34	992.8776	0.1504303	16190.43	2884.49	5.331964E-22	30	829.8054	0.1425522	10241.43	1719.281	2.0517E-15	21	738.1349	0.1722786	17863.53	3738.856	3.678E-38	32	1082.33	MLF1	MLF1_E243_F	33636694	NM_022443.2	MLF1	4291	3	36.1	159771921	243	Y	AGGGAAAAGAGCGAGTTTTAGAGGGCGAGAGAGAATTCGGAGTAACTCTG	.	myeloid leukemia factor 1 variant 1; myeloid leukemia factor 1 variant 2; myeloid leukemia factor 1 variant 3; go_component: nucleus; go_component: cytoplasm; go_component: centrosome; go_function: protein binding; go_function: protein domain specific binding; go_process: hemopoiesis; go_process: cell differentiation	myeloid leukemia factor 1
MLF1_P97_F	4276	0.07856312	8152.524	703.6229	4.005428E-11	19	366.3006	0.07038696	9523.501	728.6569	2.200679E-10	24	559.3906	0.05148634	9884.064	541.9457	1.367753E-11	25	534.6275	0.06410317	7001.531	486.4112	7.601488E-05	37	237.8246	0.04784814	8804.328	447.4659	4.767839E-09	25	463.1704	0.07931912	9572.012	833.2697	3.841903E-13	29	486.0332	0.04568963	10271.45	496.5549	1.00355E-09	34	380.8975	0.04934501	11334.99	593.5482	1.743682E-08	30	526.4081	0.06678761	8898.962	644.0325	1.189832E-09	26	313.5533	0.03611611	12863.29	485.726	5.840422E-19	35	509.598	MLF1	MLF1_P97_F	33636694	NM_022443.2	MLF1	4291	3	36.1	159771581	-97	Y	TGCCAGGGCAGCGGCGCATTGCTCCCCGCCTCGTCCTGGTGACGTCACAGAG	.	myeloid leukemia factor 1 variant 1; myeloid leukemia factor 1 variant 2; myeloid leukemia factor 1 variant 3; go_component: nucleus; go_component: cytoplasm; go_component: centrosome; go_function: protein binding; go_function: protein domain specific binding; go_process: hemopoiesis; go_process: cell differentiation	myeloid leukemia factor 1
MLH1_P381_F	2741	0.1882284	3578.016	852.835	0.00536767	35	125.5262	0.02656995	11443.28	315.076	1.042647E-13	25	823.5531	0.04662175	11397.65	562.2538	2.042845E-15	37	469.5417	0.1454475	2809.282	495.1691	0.1482396	34	108.5079	0.03865295	9651.124	392.0641	1.116642E-10	34	361.6197	0.03102376	10392.24	335.9305	5.297074E-14	33	424.2061	0.04504706	9614.728	458.2634	1.680539E-08	33	808.2914	0.04804933	11038.93	562.233	4.931197E-08	27	650.9755	0.06066802	7928.674	518.5427	1.557222E-07	24	645.7315	0.03597412	12752.17	479.5985	1.291769E-18	23	515.9968	MLH1	MLH1_P381_F	31982934	NM_014805.2	EPM2AIP1	9852	3	36.1	37009602	197	Y	GCGGGAGGCCACAAGAGCAGGGCCAACGTTAGAAAGGCCGCAAGGGGAG	FLJ11207, KIAA0766	laforin interacting protein 1; go_component: endoplasmic reticulum	EPM2A interacting protein 1
MLH3_E72_F	3686	0.1384898	3139.073	520.6885	0.03123537	24	168.8342	0.09185877	9404.36	961.369	1.288151E-10	24	560.8546	0.08906592	9430.103	931.7989	1.917403E-11	29	612.2869	0.06044894	4341.744	285.7734	0.02795314	10	373.4409	0.08702871	9410.225	906.5593	2.805817E-11	26	458.725	0.09107865	9318.329	943.7656	9.045647E-13	32	436.3041	0.09781229	8478.845	930.0908	2.021172E-07	28	450.7311	0.08487934	9576.743	897.538	1.367833E-06	28	510.8489	0.09919886	6161.489	689.5336	5.362968E-05	29	493.1827	0.0735543	13247.83	1059.739	6.597915E-22	25	514.4371	MLH3	MLH3_E72_F	7657336	NM_014381.1	MLH3	27030	14	36.1	74587814	72	Y	CCCGGCATCATCTTTTCGTCGCGTGCTTCCCCCAGAGTCACCTG	HNPCC, HNPCC7, S240II117	mismatch repair gene MLH3; mutL (E. coli) homolog 3; go_component: nucleus; go_function: ATP binding; go_function: protein binding; go_function: satellite DNA binding; go_process: mismatch repair; go_process: meiotic recombination	mutL homolog 3
MLH3_P25_F	1543	0.07555258	7506.097	621.6256	2.451626E-09	20	438.7945	0.02974468	15768.3	486.4673	9.778458E-27	25	1289.246	0.02219102	20579.66	469.3174	3.678E-38	38	897.6973	0.09480301	3922.234	421.2563	0.04222032	31	165.5746	0.02875795	13495.06	402.5423	7.448284E-21	30	941.3287	0.03399708	17204.78	609.0167	3.678E-38	23	983.6165	0.02816938	16251.02	473.9491	3.580216E-24	35	1109.999	0.03983291	20750.1	864.9746	1.678028E-28	28	1041.214	0.03558027	12283.75	456.8727	1.349702E-17	32	988.7364	0.01769747	20402.33	369.3764	3.678E-38	29	1047.753	MLH3	MLH3_P25_F	7657336	NM_014381.1	MLH3	27030	14	36.1	74587911	-25	Y	GCGCGCACCTTGGATCTTGAGGCTCGTGCGTGCCCACGAGCATGCGCTTC	HNPCC, HNPCC7, S240II117	mismatch repair gene MLH3; mutL (E. coli) homolog 3; go_component: nucleus; go_function: ATP binding; go_function: protein binding; go_function: satellite DNA binding; go_process: mismatch repair; go_process: meiotic recombination	mutL homolog 3
MLLT3_E93_R	905	0.03240643	4818.055	164.7144	0.001167999	30	335.9113	0.03211546	8657.72	290.5906	6.345437E-08	24	682.6771	0.02701526	14065.18	393.3012	5.965441E-23	25	750.6356	0.04480549	2909.967	141.1891	0.1900026	24	199.0461	0.03219531	12837.5	430.3833	6.152996E-19	27	591.056	0.03156701	12506.72	410.9283	1.220558E-20	23	1000.713	0.0361568	11143.29	421.7713	3.018912E-11	35	829.3087	0.0308456	12166.22	390.401	2.160049E-09	35	573.9842	0.04761959	8171.096	413.5597	8.783692E-08	26	739.6673	0.04407877	14581.37	676.9769	4.674388E-25	26	444.0676	MLLT3	MLLT3_E93_R	4758719	NM_004529.1	MLLT3	4300	9	36.1	20612357	93	Y	TGAAGAGGCTGCTATGAATGAGAGCGCGCCCAGGAGCGGAGGGTAGATG	AF9, YEATS3, FLJ2035	Myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila); myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3; go_component: nucleus; go_process: transcription; go_process: regulation of transcription, DNA-dependent	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
MLLT4_P1400_F	4134	0.06277514	6519.479	443.3714	7.510569E-07	38	304.4845	0.1223691	10790.28	1518.444	4.717332E-15	27	868.4467	0.1005588	14430.91	1624.577	1.290189E-28	28	675.6501	0.03881517	6130.396	251.5998	0.001097687	27	337.7351	0.1233908	11747.11	1667.589	2.244229E-19	37	745.2656	0.1375657	11707.44	1883.389	5.806593E-23	29	758.7255	0.1280933	11923.1	1766.334	6.383057E-16	15	744.9764	0.1365662	14115.48	2248.411	4.79916E-16	33	779.0734	0.1207499	9158.636	1271.515	1.367438E-11	29	517.004	0.122159	11248.51	1579.24	1.87454E-17	28	563.1356	MLLT4	MLLT4_P1400_F	5174574	NM_005936.1	MLLT4	4301	6	36.1	167969262	-1400	Y	GCGGAAGAAAACAGCTTGAAAAGGTCGGCTTTGAAGTGACCCAGCGGA	AF6, AF-6, AFADIN, FLJ34371, RP3-431P23.3	Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 4; myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4; go_component: myosin; go_component: intercellular junction; go_function: motor activity; go_function: protein binding; go_function: protein C-terminus binding; go_process: cell adhesion; go_process: signal transduction; go_process: cell-cell signaling; go_process: signal transduction	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
MLLT6_P957_F	2369	0.2985487	1384.139	631.6727	0.3462076	38	65.866	0.1517803	8924.576	1614.857	5.60446E-11	20	684.7557	0.1726696	11206.03	2359.647	4.506096E-20	36	627.8081	0.04844	3537.158	185.1527	0.09373975	25	211.623	0.1584873	8542.018	1627.605	5.929584E-11	27	323.1842	0.2062237	6593.201	1738.898	2.450202E-08	28	350.1903	0.1740042	6682.506	1428.802	1.466134E-05	25	443.8715	0.1447539	10558.05	1803.919	4.181135E-09	30	733.6429	0.1534136	7478.009	1373.244	2.802629E-08	28	690.93	0.2017166	9683.009	2472.049	1.309176E-15	34	490.8599	MLLT6	MLLT6_P957_F	57222567	NM_005937.2	MLLT6	4302	17	36.1	34114444	-957	Y	TGTCTGTGAACCCGACAGGAAGCTCCCCGAGGGCAGGAATATGTTTTGCTC	AF17, FLJ23480	Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6; trithorax homolog; myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6; go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: regulation of transcription, DNA-dependent	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6
MME_E29_F	3690	0.1165906	2926.875	399.481	0.0587507	32	127.6512	0.363069	6252.393	3621.046	1.249988E-09	30	377.2998	0.2805049	8219.075	3243.304	4.145935E-14	25	460.0841	0.14282	1671.215	295.113	0.433926	28	60.13755	0.2301739	7529.751	2281.255	3.486304E-10	23	598.9925	0.4297923	6663.618	5098.055	5.826839E-17	24	959.8002	0.2685355	8100.12	3010.431	2.307019E-10	27	464.7238	0.2601422	8601.009	3059.371	4.096017E-08	30	437.6371	0.2883541	5937.643	2446.412	2.018448E-07	26	353.7075	0.2193404	10641.06	3017.893	6.896567E-20	31	500.4682	MME	MME_E29_F	6042205	NM_000902.2	MME	4311	3	36.1	156280182	29	Y	AGATGTGCAAGTGGCGAAGCTTGACCGAGAGCAGGCTGGAGCAGCCGCCCAA	NEP, CD10, CALLA, MGC126681, MGC126707	neprilysin; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: zinc ion binding; go_function: metal ion binding; go_function: neprilysin activity; go_function: metallopeptidase activity; go_process: proteolysis; go_process: cell-cell signaling	membrane metallo-endopeptidase
MME_P388_F	1553	0.2710397	4070.931	1550.823	0.0001506876	35	252.112	0.1075763	4213.644	519.9836	0.01415341	26	278.8456	0.07575472	5311.455	443.5438	0.001225109	30	227.4662	0.1524882	3645.42	673.8931	0.04366764	28	229.5633	0.1023559	4147.901	484.3764	0.01378799	31	249.4782	0.1570914	4434.671	845.1188	0.001671752	20	244.0669	0.07594782	4106.498	345.7319	0.04711752	26	288.0452	0.07233477	5056.729	402.0963	0.0326661	34	247.6404	0.1172706	3578.196	488.6483	0.04405945	29	318.3511	0.08015691	6472.748	572.762	2.986607E-05	26	293.138	MME	MME_P388_F	6042205	NM_000902.2	MME	4311	3	36.1	156279765	-388	Y	GGATTCAGGGAGGAAAGGGAGCGGGAAAGAGAGCGAAAGAAGAG	NEP, CD10, CALLA, MGC126681, MGC126707	neprilysin; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: zinc ion binding; go_function: metal ion binding; go_function: neprilysin activity; go_function: metallopeptidase activity; go_process: proteolysis; go_process: cell-cell signaling	membrane metallo-endopeptidase
MMP1_P397_R	4136	0.74937	775.9031	2618.902	0.0519276	19	152.2846	0.9746878	319.42	16150.42	1.778658E-27	31	1308.512	0.9785608	361.1473	21048.39	3.678E-38	30	1111.388	0.9378859	305.7117	6126.012	0.0009838766	27	396.2025	0.9749718	322.2672	16449.41	7.151149E-31	31	1205.487	0.9699309	338.4832	14144.04	3.039151E-26	27	1369.303	0.9750133	354.2711	17726.22	1.861434E-28	24	1056.686	0.9810494	348.39	23212.58	4.346704E-34	19	826.9807	0.954391	391.2	10278.61	3.777059E-12	28	579.8687	0.978749	342.4142	20376.11	3.678E-38	32	910.7659	MMP1	MMP1_P397_R	13027798	NM_002421.2	MMP1	4312	11	36.1	102174501	-397	N	AGGGCAGAGGGTGGAATTACTAACACTGCGCACCTGATGGCTGTTCGGCACC	CLG, CLGN	fibroblast collagenase; matrix metalloproteinase 1 (interstitial collagenase); matrix metalloprotease 1; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: interstitial collagenase activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 1 preproprotein
MMP1_P460_F	4304	0.712503	1335.247	3556.969	0.001523324	28	197.4955	0.9544539	937.8879	21749.77	3.678E-38	34	1516.811	0.9597245	929.5377	24532.83	3.678E-38	24	1691.211	0.8081586	986.4467	4576.81	0.005777016	29	248.9449	0.9516601	1004.746	21748.98	3.678E-38	30	1130.21	0.9518167	1013.057	21987.4	3.678E-38	28	1840.359	0.9362428	1115.629	17850.89	1.858256E-31	37	1573.149	0.9529485	1261.216	27569.12	3.678E-38	31	1362.227	0.9121087	1388.677	15449.03	1.166702E-31	28	1088.315	0.9594418	1027.564	26673.55	3.678E-38	34	1299.557	MMP1	MMP1_P460_F	13027798	NM_002421.2	MMP1	4312	11	36.1	102174564	-460	N	CCCCCAGCACTCACTTTACGGTGGCTCTTCGGGGTTCTCTGAGGTTCCC	CLG, CLGN	fibroblast collagenase; matrix metalloproteinase 1 (interstitial collagenase); matrix metalloprotease 1; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: interstitial collagenase activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 1 preproprotein
MMP10_E136_R	920	0.34091	4279.2	2265.112	4.551508E-06	26	155.6807	0.5979185	5124.92	7769.76	1.464881E-16	22	677.2538	0.6686494	4957.112	10205.01	2.298384E-25	40	757.0466	0.345128	3152.536	1714.139	0.01929086	24	211.2588	0.6323378	3978.478	7014.524	7.68154E-13	30	822.1169	0.569404	5536.053	7452.905	7.027805E-21	34	620.7285	0.7261282	3500.805	9546.968	2.052127E-14	35	588.0718	0.6552281	5207.327	10086.41	5.654508E-14	24	683.4867	0.5951564	3600.659	5440.301	1.211931E-08	23	320.1295	0.6637821	4832.03	9737.115	9.449252E-23	25	678.5212	MMP10	MMP10_E136_R	4505204	NM_002425.1	MMP10	4319	11	36.1	102156418	136	N	GAGCTGGCCAGTAGCTGCAATAGATGCCACCGTTAATTACCTGGGCAAGATCCTTGT	SL-2, STMY2	transin 2; matrix metalloproteinase 10 (stromelysin 2); matrix metalloprotease 10; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: stromelysin 2 activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 10 preproprotein
MMP14_P13_F	4148	0.121518	4221.728	597.8125	0.001877005	18	272.7771	0.8034186	3512.945	14765.94	3.980853E-34	18	763.0492	0.7774673	3958.43	14179.02	5.346811E-37	33	725.1508	0.08468915	1821.1	177.7498	0.4255491	32	158.0357	0.6340324	4827.563	8536.915	3.173306E-19	24	498.5048	0.8214422	2991.389	14221.71	9.591338E-38	23	755.0558	0.7145683	4351.367	11143.84	1.318272E-20	47	656.6533	0.7358469	4587.579	13058.12	9.828342E-19	32	635.9301	0.8065699	2470.377	10718.02	6.399214E-19	26	777.3058	0.7469355	4241.093	12813.01	1.270572E-31	33	606.1028	MMP14	MMP14_P13_F	13027797	NM_004995.2	MMP14	4323	14	36.1	22375620	-13	Y	AGGGAGGGACCAGAGGAGAGAGCGAGAGAGGGAACCAGACCCCAGTTCG	MMP-X1, MTMMP1, MT1-MMP	membrane-type-1 matrix metalloproteinase; matrix metalloproteinase 14 (membrane-inserted); membrane-type matrix metalloproteinase 1; membrane type 1 metalloprotease; go_component: membrane; go_component: integral to plasma membrane; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: metalloendopeptidase activity; go_process: proteolysis; go_process: peptidoglycan metabolism	matrix metalloproteinase 14 preproprotein
MMP14_P208_R	4149	0.01722975	20565.15	362.2977	3.678E-38	38	838.7662	0.4954388	4998.326	5006.148	6.911949E-10	33	503.621	0.4227288	6452.175	4798.079	1.430915E-13	33	474.2081	0.01770706	11918.93	216.6561	4.095144E-12	29	878.7969	0.5030577	4633.157	4791.403	2.165972E-09	28	416.9794	0.5609708	4301.905	5624.547	6.380267E-12	30	316.3165	0.3984247	6458.536	4343.734	8.683843E-10	28	442.0316	0.4386573	6972.142	5526.474	2.633163E-09	20	463.6301	0.4967048	4264.894	4307.738	9.239E-08	36	345.6089	0.4081641	6505.753	4555.708	7.500117E-13	20	418.8347	MMP14	MMP14_P208_R	13027797	NM_004995.2	MMP14	4323	14	36.1	22375425	-208	N	CTACAGCCCCCTGCTGTCCATCGCGGCCTCAACCCCTGCAGATGGCA	MMP-X1, MTMMP1, MT1-MMP	membrane-type-1 matrix metalloproteinase; matrix metalloproteinase 14 (membrane-inserted); membrane-type matrix metalloproteinase 1; membrane type 1 metalloprotease; go_component: membrane; go_component: integral to plasma membrane; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: metalloendopeptidase activity; go_process: proteolysis; go_process: peptidoglycan metabolism	matrix metalloproteinase 14 preproprotein
MMP19_E274_R	3693	0.36196	4429.437	2569.549	6.388187E-07	34	224.2584	0.9301836	962.2173	14152.22	5.444142E-23	35	799.2697	0.9488772	1026.076	20900.8	3.678E-38	32	838.4281	0.3381049	3208.29	1689.919	0.01834023	32	159.2077	0.9362789	966.441	15669.65	2.36482E-30	25	1150.671	0.9201142	1161.685	14531.92	4.491557E-31	35	1001.586	0.946016	873.3903	17057.71	5.75702E-28	35	1295.801	0.9502	1131.44	23496.27	2.250359E-37	33	753.8206	0.9210849	879.9289	11437.58	2.155361E-16	28	907.1927	0.9539675	954.1866	21846.73	3.678E-38	25	1269.965	MMP19	MMP19_E274_R	89036201	XM_938761.1	MMP19	4327	12	36.1	54522728	274	N	CTGAAGGTCAGGAGGGAGGCTTCGATGGGGCTGTGGAGCAGTAAC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Matrix metalloproteinase-19 precursor (MMP-19) (Matrix metalloproteinase RASI) (MMP-18)
MMP19_P306_F	1559	0.4424422	2729.308	2245.158	0.001197099	22	182.5702	0.8874739	1419.419	11983.4	6.225689E-18	36	659.7737	0.8984191	1597.734	15015.39	9.467221E-31	24	679.2853	0.6838638	337.1774	945.6995	0.6109757	31	64.51114	0.9068865	1136.653	12044.48	1.110117E-18	24	856.1967	0.8348765	2202.023	11639.2	7.347335E-24	26	567.8955	0.9030561	1262.607	12693.02	1.430741E-16	31	749.6752	0.9053943	1765.405	17852.27	2.586529E-23	21	743.5802	0.8759102	1174.176	8994.001	5.367104E-11	23	598.0106	0.9306846	1224.529	17784.2	3.678E-38	19	1019.101	MMP19	MMP19_P306_F	89036201	XM_938761.1	MMP19	4327	12	36.1	54523308	-306	N	CCTGGGCCAGCAAATCACTCCGCCCCTACCTTTGAGTCTCCCTAGAA	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Matrix metalloproteinase-19 precursor (MMP-19) (Matrix metalloproteinase RASI) (MMP-18)
MMP2_E21_R	925	0.09593008	3743.602	407.8413	0.01067305	30	165.8596	0.1221057	7948.117	1119.407	3.922658E-08	32	497.4453	0.127664	8681.007	1285.076	1.462591E-10	26	389.4283	0.1816494	1846.838	432.1397	0.355154	33	110.1225	0.1177428	7907.509	1068.652	1.620766E-08	27	377.6206	0.1392237	9463.466	1546.815	8.858125E-15	27	577.8895	0.133693	7908.039	1235.842	5.157935E-07	21	843.8647	0.1335318	9932.179	1546.063	7.222964E-08	28	386.5252	0.1307212	7204.252	1098.405	2.810032E-07	26	399.0034	0.1350878	8170.338	1291.716	2.37613E-09	24	272.1113	MMP2	MMP2_E21_R	75905807	NM_004530.2	MMP2	4313	16	36.1	54070610	21	Y	CGGCTGCCCTCCCTTGTTTCCGCTGCATCCAGACTTCCTCAGGCGGT	CLG4, MONA, CLG4A, TBE-1, MMP-II	matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase); matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase); neutrophil gelatinase; collagenase type IV-A; matrix metalloproteinase-II; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: gelatinase A activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 2 preproprotein
MMP2_P197_F	4307	0.2277252	7530.66	2250.097	1.190876E-13	35	392.9705	0.07099534	13457.04	1036.041	4.470799E-21	22	732.8779	0.06040374	16882.68	1091.764	2.661871E-36	24	1399.499	0.1303273	5454.742	832.4219	0.001348789	26	314.1958	0.05771986	13216.34	815.6995	2.817489E-21	28	1137.213	0.09620705	14421.83	1545.821	3.159237E-32	23	1079.942	0.05164742	15827.21	867.3981	4.422174E-24	28	913.2772	0.0542699	16244.01	937.8866	9.806713E-18	29	1140.678	0.05858773	10664.19	669.8975	8.930216E-14	31	603.9442	0.06077354	19102.75	1242.532	3.678E-38	27	993.4568	MMP2	MMP2_P197_F	75905807	NM_004530.2	MMP2	4313	16	36.1	54070392	-197	Y	GCGAGAGAGGCAAGTGGGGTGACGAGGTCGTGCACTGAGGGTG	CLG4, MONA, CLG4A, TBE-1, MMP-II	matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase); matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase); neutrophil gelatinase; collagenase type IV-A; matrix metalloproteinase-II; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: gelatinase A activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 2 preproprotein
MMP2_P303_R	4151	0.03604311	7529.812	285.2847	1.26307E-08	26	285.6979	0.06700161	11798.85	854.4949	6.257597E-16	26	565.3858	0.08178414	12663.18	1136.798	8.289004E-21	28	710.5038	0.02145296	8784.426	194.7757	9.413501E-07	24	329.0349	0.1003361	10807.69	1216.493	1.917356E-15	27	450.7421	0.1211428	11467.53	1594.483	3.977877E-21	27	544.5941	0.07927971	11991.75	1041.174	2.218793E-14	33	773.6548	0.08685292	13792.08	1321.329	1.218685E-13	28	599.2563	0.06652524	10061.83	724.1953	1.999291E-12	30	439.2538	0.06595942	12305.17	876.0198	1.814782E-18	30	563.6036	MMP2	MMP2_P303_R	75905807	NM_004530.2	MMP2	4313	16	36.1	54070286	-303	Y	CCGGCGTCCCTCCTAGTAGTACCGCTGCTCTCTAACCTCAGGACGTCAAGG	CLG4, MONA, CLG4A, TBE-1, MMP-II	matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase); matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase); neutrophil gelatinase; collagenase type IV-A; matrix metalloproteinase-II; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: gelatinase A activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 2 preproprotein
MMP3_P16_R	4850	0.6618305	419.2561	1016.235	0.5487102	27	55.44616	0.9370577	671.4905	11485.61	1.124677E-14	35	591.1544	0.9518912	642.7504	14696.21	5.425156E-26	39	891.2852	0.3777706	2897.731	1819.995	0.02436593	28	175.4366	0.9383695	569.165	10188.53	2.767801E-12	21	681.7579	0.9390341	698.6224	12300.87	6.475388E-21	32	816.7424	0.9389884	564.6903	10229.81	8.973673E-10	20	478.5483	0.9471974	788.5969	15940.08	8.691051E-17	24	790.9986	0.9255294	597.5576	8669.325	4.343732E-09	32	610.0816	0.9550517	536.2917	13519.77	4.119406E-21	22	696.7691	MMP3	MMP3_P16_R	73808272	NM_002422.3	MMP3	4314	11	36.1	102219568	-16	N	CTCCTTGTAGGTCCAACCTCGGGAGCGCAGCTTTTAAAGAGTGACAGTGTTTGT	SL-1, STMY, STR1, STMY1, MGC126102, MGC126103, MGC126104	proteoglycanase; matrix metalloproteinase 3 (stromelysin 1, progelatinase); transin-1; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: zinc ion binding; go_function: calcium ion binding; go_function: stromelysin 1 activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 3 preproprotein
MMP3_P55_F	4851	0.3831082	2211.263	1435.363	0.03206924	32	178.0772	0.8882636	1309.089	11201.75	1.453733E-15	34	561.0505	0.882737	1726.063	13746.3	1.803223E-26	24	806.9391	0.1777379	1735.352	396.7246	0.3916212	26	156.085	0.8745034	1466.997	10919.38	2.019892E-16	28	580.1849	0.8869034	1555.934	12985.84	1.805029E-26	24	762.3176	0.8700586	1698.316	12041.12	4.831847E-16	24	593.8435	0.8690602	1940.825	13545.15	2.465685E-14	32	706.2625	0.8799726	1088.845	8715.936	3.343553E-10	23	1001.138	0.8707455	1771.925	12610.55	3.797243E-22	27	603.1946	MMP3	MMP3_P55_F	73808272	NM_002422.3	MMP3	4314	11	36.1	102219607	-55	N	AGAGTGACAGTGTTTGTTTGGATCACCCGCAGCTTGACTCATCCTTGCTTTCATCC	SL-1, STMY, STR1, STMY1, MGC126102, MGC126103, MGC126104	proteoglycanase; matrix metalloproteinase 3 (stromelysin 1, progelatinase); transin-1; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: zinc ion binding; go_function: calcium ion binding; go_function: stromelysin 1 activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 3 preproprotein
MMP7_E59_F	931	0.1056713	2289.556	282.3431	0.1862142	30	94.55251	0.3461012	4368.494	2365.124	0.0001263386	28	482.0256	0.3310599	4770.757	2410.549	1.750226E-05	29	248.6058	0.04812081	4126.956	213.6873	0.04238875	22	305.9245	0.31841	4318.927	2064.335	0.0001974212	26	303.9087	0.46926	3303.492	3009.237	7.613544E-05	24	259.4695	0.3555583	4547.848	2564.361	0.0002373163	25	170.2099	0.2941624	5087.637	2161.981	0.002121559	31	143.3123	0.5348285	2044.692	2465.848	0.02013618	30	338.5186	0.4231078	4195.114	3150.149	1.106015E-05	28	262.1622	MMP7	MMP7_E59_F	75709180	NM_002423.3	MMP7	4316	11	36.1	101906629	59	N	CAGGCACACAGCACACAGCACGGTGAGTCGCATAGCTGCCGTCCAGAGAC	MMP-7, MPSL1, PUMP-1	matrin; matrix metalloproteinase 7 (matrilysin, uterine); uterine matrilysin; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: zinc ion binding; go_function: calcium ion binding; go_function: matrilysin activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 7 preproprotein
MMP7_P613_F	4156	0.605936	2182.656	3509.946	0.0001178367	29	250.0836	0.7924646	3557.023	13964.18	3.003095E-31	22	996.6173	0.8034481	3890.213	16310.85	3.678E-38	28	700.8943	0.2573376	4745.206	1678.897	0.001000584	37	238.959	0.8059052	3310.9	14162.47	1.235951E-33	26	542.3044	0.801169	3543.433	14680.84	3.678E-38	25	919.4863	0.7962535	3559.194	14300.35	9.850344E-28	31	1018.356	0.8045083	4375.84	18419.46	7.927833E-32	30	845.7805	0.8235512	2312.682	11260.87	4.221809E-20	38	754.5745	0.8003293	3778.224	15544.88	3.678E-38	27	862.7885	MMP7	MMP7_P613_F	75709180	NM_002423.3	MMP7	4316	11	36.1	101907301	-613	N	TGTGTCCCCTCACCTTCCACGTCCCTTAGCAGAGCAGTGATAATTCCC	MMP-7, MPSL1, PUMP-1	matrin; matrix metalloproteinase 7 (matrilysin, uterine); uterine matrilysin; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: zinc ion binding; go_function: calcium ion binding; go_function: matrilysin activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 7 preproprotein
MMP8_E89_R	3694	0.6660358	616.793	1429.524	0.3362174	30	84.74983	0.890456	1132.44	10018.21	2.642023E-12	35	630.0206	0.9163388	1060.928	12715.62	9.832755E-21	23	459.9976	0.2383533	562.6671	207.3782	0.7317818	26	52.26585	0.8785788	1072.79	8486.072	1.159206E-09	27	722.9973	0.8509977	1466.187	8944.973	3.7081E-13	23	633.6222	0.9107655	977.2958	10995.35	4.4962E-12	31	565.1876	0.9046329	1156.539	11919.28	3.500319E-10	26	455.9741	0.8600601	1194.159	7953.802	7.482656E-09	24	669.3051	0.689717	611.491	1581.548	0.3764411	26	57.00484	MMP8	MMP8_E89_R	4505220	NM_002424.1	MMP8	4317	11	36.1	102100779	89	N	CTGCACATGGAGTAAGAGCAGAAATGGAAGCGTCTTCAGGGAGAACATGATCTTCT	HNC, CLG1, PMNL-CL	PMNL collagenase; matrix metalloproteinase 8 (neutrophil collagenase); neutrophil collagenase; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: metalloendopeptidase activity; go_function: neutrophil collagenase activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 8 preproprotein
MMP9_E88_R	935	0.4257309	1745.741	1368.329	0.0844317	36	88.24464	0.8975226	1178.479	11197.24	3.200985E-15	32	688.0828	0.9229559	1176.833	15295.93	3.319634E-30	31	760.971	0.5001515	343.5606	443.8294	0.7280198	30	28.5736	0.9037561	971.2028	10058.88	6.25842E-13	30	626.6869	0.9116604	1087.838	12258.44	4.198197E-22	30	898.8788	0.8749732	1543.019	11498.32	2.122766E-14	32	638.3944	0.908313	1238.167	13256.79	1.569322E-12	30	469.7283	0.8931911	951.3043	8791.55	4.531115E-10	34	488.4703	0.9182666	1181.052	14392.48	3.76438E-26	29	640.7769	MMP9	MMP9_E88_R	74272286	NM_004994.2	MMP9	4318	20	36.1	44071042	88	N	CTGCTTTGCTGCCCCCAGACAGCGCCAGTCCACCCTTGTGCTCTTCCC	GELB, CLG4B	type V collagenase; matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase); matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase); macrophage gelatinase; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: gelatinase B activity; go_function: collagenase activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 9 preproprotein
MMP9_P189_F	4158	0.2576607	5343.827	1889.513	2.18224E-07	35	241.5173	0.6996096	4508.865	10734.05	2.132868E-23	31	680.7908	0.6848238	5279.764	11689.3	3.72778E-32	33	662.3629	0.0411716	4566.916	200.395	0.02256444	36	150.4111	0.5422071	5213.841	6293.682	4.168852E-14	42	793.7538	0.6730921	5138.811	10786.53	4.775391E-32	18	1051.017	0.5245532	5267.115	5921.458	1.638184E-10	27	682.4709	0.6269078	6136.078	10478.5	1.489922E-16	26	857.9812	0.678373	3500.405	7593.943	3.555965E-13	33	423.0146	0.6988851	4990.683	11815.43	1.144852E-30	34	763.546	MMP9	MMP9_P189_F	74272286	NM_004994.2	MMP9	4318	20	36.1	44070765	-189	N	TTGCCTGACTTGGCAGTGGAGACTGCGGGCAGTGGAGAGAGGAGG	GELB, CLG4B	type V collagenase; matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase); matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase); macrophage gelatinase; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: gelatinase B activity; go_function: collagenase activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 9 preproprotein
MMP9_P237_R	4160	0.1046449	2533.581	307.8006	0.1287189	35	88.22166	0.1755598	7532.675	1625.335	2.709465E-08	30	455.5462	0.1841076	8884.003	2027.256	9.801398E-13	33	339.7302	0.2585291	588.9819	240.2277	0.7188427	30	42.17121	0.1408155	8183.945	1357.692	1.256701E-09	37	335.1824	0.1766305	8157.355	1771.381	6.2976E-12	29	413.9305	0.1610961	8149.246	1584.116	6.148422E-08	21	662.971	0.1580998	10223.71	1938.683	8.128827E-09	32	456.6635	0.1635454	7700.5	1525.17	5.249607E-09	33	514.488	0.1665677	9315.2	1881.699	3.544732E-13	29	346.3899	MMP9	MMP9_P237_R	74272286	NM_004994.2	MMP9	4318	20	36.1	44070717	-237	N	CCCTCCCCTGAGGGCCTGCGGTTTCCTGCGGGTCTGGGGTCTTGCCTGAC	GELB, CLG4B	type V collagenase; matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase); matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase); macrophage gelatinase; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: calcium ion binding; go_function: zinc ion binding; go_function: gelatinase B activity; go_function: collagenase activity; go_process: proteolysis; go_process: collagen catabolism; go_process: peptidoglycan metabolism	matrix metalloproteinase 9 preproprotein
MOS_E60_R	4133	0.09093527	7287.551	738.9891	4.20231E-09	32	258.9489	0.2374614	7115.506	2246.973	1.155916E-08	27	517.426	0.1731765	8825.659	1869.461	3.225895E-12	23	448.022	0.08011462	6422.518	568.0588	0.0002685256	34	202.9568	0.2171596	7312.703	2056.28	2.796993E-09	30	383.4259	0.4269868	6662.947	5039.48	8.779256E-17	31	381.7846	0.1821622	9407.609	2117.69	3.620439E-11	24	413.6826	0.2397499	9681.021	3084.51	1.049221E-09	28	518.2454	0.2446065	6957.014	2285.155	4.866846E-09	29	417.1573	0.1528541	9286.489	1693.644	1.170399E-12	30	380.1997	MOS	MOS_E60_R	4885488	NM_005372.1	MOS	4342	8	36.1	57189035	60	Y	GAGGGACTGCTGCAGGGCCGCGCGTCCACCGATGGGGAAAACTCG	MSV, MGC119962, MGC119963	Oncogene MOS, Moloney murine sarcoma virus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	v-mos Moloney murine sarcoma viral oncogene homolog
MOS_P27_R	2748	0.3161592	1491.081	735.6024	0.2796773	25	65.01399	0.1512174	5343.918	969.8774	0.0004015781	32	324.24	0.133202	6562.272	1023.8	4.237289E-06	24	473.3298	0.07302511	1867.76	155.0159	0.4194075	31	147.3134	0.1059854	5443.579	657.1913	0.0004384722	34	235.8192	0.1413376	5407.821	906.5988	7.570878E-05	22	374.3147	0.1643324	4791.551	961.9141	0.005167576	27	331.6386	0.1452766	6604.112	1139.492	0.0008450504	17	275.5454	0.1594495	4388.716	851.4939	0.004406978	27	234.4661	0.1217548	6920.483	973.2789	1.578052E-06	30	294.0994	MOS	MOS_P27_R	4885488	NM_005372.1	MOS	4342	8	36.1	57189122	-27	Y	GCACTTTGCAGGGGGACACCAGGGCCGCTGGAGTGAATGAAGAGACTAG	MSV, MGC119962, MGC119963	Oncogene MOS, Moloney murine sarcoma virus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	v-mos Moloney murine sarcoma viral oncogene homolog
MOS_P746_F	2749	0.3090563	2230.85	1042.58	0.0644938	34	107.0327	0.7846967	1929.814	7397.88	1.338241E-08	33	545.8902	0.8354869	1565.508	8458.357	1.093485E-10	25	632.0671	0.1727349	1876.689	412.7375	0.3526053	31	107.7893	0.8674172	910.8319	6613.32	5.011415E-06	28	698.6747	0.8033542	1400.57	6130.255	8.205343E-07	32	425.2924	0.8188295	1405.423	6804	1.088924E-05	27	562.794	0.8384024	1511.654	8361.603	6.849548E-06	25	396.572	0.8346006	841.5249	4750.906	0.001904995	21	652.8688	0.8271172	1648.938	8367.387	1.714517E-10	34	390.3624	MOS	MOS_P746_F	4885488	NM_005372.1	MOS	4342	8	36.1	57189841	-746	N	AATCCTTCCCTTCCAAGGCGATTTGGCCCAACCGGTCAGCTCA	MSV, MGC119962, MGC119963	Oncogene MOS, Moloney murine sarcoma virus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	v-mos Moloney murine sarcoma viral oncogene homolog
MPL_P62_F	5750	0.3337345	1157.926	630.0991	0.4237686	41	52.80438	0.6789486	2282.873	5039.219	2.147566E-05	32	383.2602	0.6660344	2607.368	5399.359	8.77335E-07	32	339.7646	0.07712156	2359.022	205.4914	0.2881779	35	79.01375	0.6441661	2560.536	4816.366	8.387544E-06	21	261.0158	0.5929666	2885.641	4349.484	2.694271E-06	28	307.1678	0.657237	2560.759	5101.919	5.40756E-05	34	237.3301	0.620696	2814.046	4768.568	0.001149887	8	616.9546	0.6342844	2032.945	3699.305	0.001339466	29	417.7494	0.7157032	2213.895	5825.115	9.161511E-07	45	204.6172	MPL	MPL_P62_F	4885490	NM_005373.1	MPL	4352	1	36.1	43576000	-62	N	AGGGGCAGGGACAGGGACAGGACGTGGGGCTGTATCTGACAGGA	MPLV, TPOR, C-MPL, CD110	thrombopoietin receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: cell proliferation; go_process: cell surface receptor linked signal transduction	myeloproliferative leukemia virus oncogene
MPL_P657_F	5754	0.07674812	2350.89	203.7377	0.1903744	37	68.67218	0.5008994	3709.829	3823.56	1.088487E-05	27	206.4099	0.5550597	3118.198	4014.678	2.060833E-05	29	268.3165	0.03262926	3734.564	129.3392	0.07913149	29	147.1733	0.6021478	2408.101	3796.001	0.0003291513	24	276.745	0.4240901	3969.287	2996.552	7.568386E-06	26	252.9945	0.5835423	2676.513	3890.462	0.0008999943	26	260.7508	0.6607333	2624.951	5306.936	0.0005836283	29	183.7272	0.5847685	2846.097	4148.975	3.363775E-05	29	215.7341	0.6477621	2305.521	4423.729	8.071026E-05	22	292.7169	MPL	MPL_P657_F	4885490	NM_005373.1	MPL	4352	1	36.1	43575405	-657	N	ATTTTGAGTAGCAAGGGATTAGAGGCAGCCGTGGAGGCCACCCATAATGGAGAG	MPLV, TPOR, C-MPL, CD110	thrombopoietin receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; go_process: cell proliferation; go_process: cell surface receptor linked signal transduction	myeloproliferative leukemia virus oncogene
MPO_E302_R	3028	0.5213194	937.0114	1129.384	0.3297041	26	70.00224	0.8193768	3012.294	14118.57	8.092369E-30	36	1102.122	0.8516101	2972.898	17635.37	3.678E-38	38	821.9705	0.4188444	2147.621	1619.882	0.08887559	33	156.8784	0.8183834	3065.65	14264.75	4.623278E-33	36	958.381	0.7288582	3901.178	10755.6	6.520905E-27	26	889.5305	0.8611807	2834.422	18204	3.678E-38	29	957.095	0.8483815	3474.682	20002.13	7.774123E-34	37	767.6409	0.7676002	2250.177	7762.468	1.185575E-10	22	606.4865	0.8797309	2539.376	19306.22	3.678E-38	28	910.0325	MPO	MPO_E302_R	4557758	NM_000250.1	MPO	4353	17	36.1	53712993	302	N	GGAGCAGCACCTTCAGAGGGCTGGGGCGTGGCCAGAATGGCCAGGAGCCC	.	go_component: nucleus; go_component: lysosome; go_function: iron ion binding; go_function: calcium ion binding; go_function: chromatin binding; go_function: oxidoreductase activity; go_function: peroxidase activity; go_process: anti-apoptosis; go_process: defense response; go_process: hydrogen peroxide catabolism; go_process: response to oxidative stress	myeloperoxidase
MPO_P883_R	2373	0.03172158	5464.317	182.2915	0.0001382922	25	209.8231	0.2138552	9637.532	2648.904	5.36404E-15	29	699.5822	0.2081784	10209.06	2710.363	4.055977E-18	28	871.5515	0.02994555	4620.494	145.7215	0.02260299	37	337.0962	0.1931574	9372.068	2267.605	1.924506E-14	31	599.1519	0.2057406	9627.841	2519.847	3.805499E-18	26	657.7985	0.1951123	9231.226	2261.977	4.190119E-11	32	663.5385	0.2124079	12130.52	3298.483	3.157112E-14	29	624.9895	0.2039751	6318.906	1644.794	1.068986E-06	28	509.1741	0.2026875	10916.77	2800.611	4.581669E-20	29	952.8729	MPO	MPO_P883_R	4557758	NM_000250.1	MPO	4353	17	36.1	53714178	-883	N	GGACAGGAAATCTGGCTGGAGACCGTTGGGCTTCACAGGAAGGAG	.	go_component: nucleus; go_component: lysosome; go_function: iron ion binding; go_function: calcium ion binding; go_function: chromatin binding; go_function: oxidoreductase activity; go_function: peroxidase activity; go_process: anti-apoptosis; go_process: defense response; go_process: hydrogen peroxide catabolism; go_process: response to oxidative stress	myeloperoxidase
MSH2_P1008_F	2768	0.3187211	1780.964	879.967	0.1656742	29	132.4092	0.9109579	1111.027	12389.58	3.337421E-18	28	820.7348	0.9008452	1578.523	15249.79	1.351768E-31	21	662.9213	0.6962243	476.2859	1320.791	0.4779171	29	79.72848	0.8812286	1526.195	12065.62	6.537729E-20	20	727.6277	0.8313339	2107.018	10878.12	7.239507E-21	32	759.988	0.8678508	1853.443	12828.66	2.044895E-18	36	808.6256	0.8511576	2756.78	16336.54	4.819553E-22	31	821.1525	0.8808622	1488.332	11743.57	4.728372E-19	24	789.975	0.9400018	869.1616	15184.02	7.297519E-28	27	785.7809	MSH2	MSH2_P1008_F	4557760	NM_000251.1	MSH2	4436	2	36.1	47482759	-1008	Y	ACTGGGATTATGGCGTGTGACACCACGCCTGGCGTCAAACGTTTGTCTT	FCC1, COCA1, HNPCC, HNPCC1	mutS (E. coli) homolog 2; mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1); go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: damaged DNA binding; go_process: cell cycle; go_process: mismatch repair; go_process: postreplication repair; go_process: negative regulation of progression through cell cycle	mutS homolog 2
MSH3_E3_F	4137	0.3066812	2247.263	1038.283	0.06314194	39	88.3771	0.8331608	1845.425	9715.056	3.051572E-13	24	976.4434	0.9123776	1614.319	17850.54	3.678E-38	24	615.6399	0.08633958	2037.06	201.949	0.3649613	27	147.7927	0.04374448	4107.35	192.4678	0.02566064	23	186.0045	0.8866897	1827.075	15079.98	2.398966E-36	29	687.9633	0.8981665	1668.871	15601.36	7.502738E-26	35	539.1122	0.9096012	1717.596	18288.81	2.795138E-24	21	527.5463	0.0904784	3028.336	311.204	0.1273516	27	284.3623	0.8062916	2587.059	11184.62	3.127847E-20	38	437.8761	MSH3	MSH3_E3_F	68303634	NM_002439.2	MSH3	4437	5	36.1	79986053	3	Y	TTCTGGGACACAGCGACGATGCAGTTTAGCGAACCAACCATGACAGCAGCGGGAGG	.	mutS (E. coli) homolog 3; go_function: ATP binding; go_function: nucleotide binding; go_function: damaged DNA binding; go_process: mismatch repair	mutS homolog 3
MSH3_P13_R	2787	0.191715	8109.258	1947.132	1.846885E-14	26	329.101	0.734	4589.934	12941.4	2.754052E-31	39	1117.378	0.8390075	4599.519	24491.4	3.678E-38	30	1487.661	0.3092507	6847.073	3110.226	3.205093E-08	29	329.2966	0.08400548	11781.89	1089.683	8.800346E-18	29	1079.403	0.7807103	6074.958	21983.96	3.678E-38	38	1445.722	0.8158682	5062.01	22872.31	3.678E-38	24	2037.863	0.8063908	6280.801	26576.32	3.678E-38	25	1191.244	0.106962	10769.04	1301.819	1.031635E-15	28	661.9807	0.7059157	8737.705	21213.9	3.678E-38	18	1658.093	MSH3	MSH3_P13_R	68303634	NM_002439.2	MSH3	4437	5	36.1	79986037	-13	Y	CGATGCCCATGTTCTGGGACACAGCGACGATGCAGTTTAGCGAACCAACCAT	.	mutS (E. coli) homolog 3; go_function: ATP binding; go_function: nucleotide binding; go_function: damaged DNA binding; go_process: mismatch repair	mutS homolog 3
MSSK1_seq_27_S45_F	6085	0.5748866	360.9823	623.3925	0.7002297	36	30.26027	0.9388482	437.2863	8248.825	1.780585E-07	32	365.3588	0.9470741	451.3951	9866.854	2.409926E-11	25	480.2174	0.3015253	288.1735	167.571	0.7951294	24	17.7494	0.9457703	473.2222	9997.045	1.26879E-11	26	636.4292	0.9374505	571.0901	10057.86	9.810424E-14	30	644.8295	0.9552619	457.4755	11903.41	6.827621E-13	37	732.538	0.9553904	640.1223	15850.98	2.657374E-16	26	860.1379	0.9296544	515.7822	8137.884	6.561384E-08	33	419.2116	0.9470006	404.0703	9006.807	3.002457E-09	24	331.6507	MSSK1	MSSK1_seq_27_S45_F	.	.	.	.	X	36.1	152700381	.	N	TCCTGCCAGGGCCACAGCCTACAAGGGTCTCGGTATTGCAGGCGCAAGCGCTTTGT	.	.	.
MST1R_E42_R	881	0.4955429	1813.605	1879.79	0.02918155	25	216.4137	0.8619674	1952.975	12820.15	6.289398E-22	30	796.0168	0.8318912	2552.851	13127.71	3.163862E-27	28	663.0676	0.522909	885.3646	1079.995	0.4341758	30	115.8122	0.8305998	2264.063	11591.43	1.007735E-20	29	425.9706	0.843924	1864.052	10619.9	3.255467E-19	26	960.6024	0.8292132	2244.509	11383.19	8.987401E-16	37	520.2134	0.8030146	2837.569	11975.05	4.287709E-13	32	816.6071	0.8389261	1694.369	9345.673	4.839771E-13	27	449.7973	0.8318785	2188.23	11322.35	1.930984E-19	33	558.4867	MST1R	MST1R_E42_R	4505264	NM_002447.1	MST1R	4486	3	36.1	49916032	42	Y	AGCAGCAACAGGAAGGACTGAGGCAGCGGCGGGAGGAGCTCCATCGAGGC	RON, PTK8, CDw136	PTK8 protein tyrosine kinase 8; c-met-related tyrosine kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: macrophage colony stimulating factor receptor activity; go_process: development; go_process: cell motility; go_process: defense response; go_process: signal transduction; go_process: fertilization (sensu Metazoa); go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation	macrophage stimulating 1 receptor
MST1R_P392_F	4161	0.2039671	1419.649	389.379	0.41644	24	93.90399	0.1851932	6575.532	1517.247	1.611723E-06	38	361.705	0.188443	8455.014	1986.468	1.260212E-11	31	532.6903	0.05758112	3999.069	250.4502	0.04807128	27	192.5057	0.179248	8247.572	1823.067	9.740198E-11	32	387.6412	0.2234337	7370.193	2149.325	6.160095E-11	30	477.7877	0.2070221	7233.51	1914.554	5.083478E-07	36	645.726	0.2209139	9929.175	2843.824	1.022227E-09	28	341.2269	0.2156296	5504.426	1540.701	2.852439E-05	39	263.8013	0.2032801	8877.498	2290.575	4.161396E-13	36	514.3087	MST1R	MST1R_P392_F	4505264	NM_002447.1	MST1R	4486	3	36.1	49916466	-392	Y	CCTGGCTCCTGTACCTTCACCTGGCGTCTTGGCGCCTTTTTCTCAGCGGCC	RON, PTK8, CDw136	PTK8 protein tyrosine kinase 8; c-met-related tyrosine kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: macrophage colony stimulating factor receptor activity; go_process: development; go_process: cell motility; go_process: defense response; go_process: signal transduction; go_process: fertilization (sensu Metazoa); go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation	macrophage stimulating 1 receptor
MST1R_P87_R	4162	0.1930504	4209.074	1030.88	0.0005313893	34	180.3578	0.8657377	2214.167	14921.99	7.742867E-30	28	906.8273	0.8559369	2933.414	18022.74	3.678E-38	30	1013.006	0.3765664	4405.354	2721.324	0.0001920189	35	191.2814	0.8832709	2191.829	17341.92	3.678E-38	24	898.319	0.8918517	1666.529	14567.8	2.272525E-33	44	996.8029	0.8821564	2040.987	16027.06	2.045927E-28	31	1025.344	0.8695777	2704.641	18699.66	6.285701E-28	32	1045.281	0.8663304	1886.19	12872.76	5.615552E-24	31	1054.959	0.8768674	2303.994	17119.62	3.678E-38	40	778.4782	MST1R	MST1R_P87_R	4505264	NM_002447.1	MST1R	4486	3	36.1	49916161	-87	Y	GGACTGGGCCAAATTTAAGCAGCGGTCCCGACAGCCCCAAGATAGCGGACCCCCGCC	RON, PTK8, CDw136	PTK8 protein tyrosine kinase 8; c-met-related tyrosine kinase; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: macrophage colony stimulating factor receptor activity; go_process: development; go_process: cell motility; go_process: defense response; go_process: signal transduction; go_process: fertilization (sensu Metazoa); go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation	macrophage stimulating 1 receptor
MT1A_E13_R	3695	0.2948862	1618.786	718.815	0.2473655	32	82.74757	0.2002224	10366.54	2620.273	8.346929E-17	24	938.4223	0.1867269	12044.25	2788.312	3.222276E-24	35	694.5533	0.3112995	2143.642	1014.149	0.1716093	26	158.1322	0.1794596	11318.06	2497.234	1.343649E-20	30	902.5383	0.2171217	10018	2806.102	2.505138E-20	27	684.8165	0.2055347	11882.61	3099.998	3.285081E-19	28	536.8902	0.17315	13830.1	2917.093	7.95997E-17	25	493.3141	0.2100961	8487.983	2284.204	2.157483E-12	34	742.4503	0.1854107	12100.83	2777.061	9.061348E-24	31	512.0814	MT1A	MT1A_E13_R	71274112	NM_005946.2	MT1A	4489	16	36.1	55230092	13	Y	GCCCTACCAAGCCTTCCACGTGCGCCTTATAGCCTCTCAACTTCTTGCTT	MT1, MTC, MT1S, MGC32848	metallothionein 1S; go_component: cytoplasm; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: cadmium ion binding; go_process: biological process unknown	metallothionein 1A
MT1A_P49_R	1564	0.06404568	3098.921	218.8964	0.05964911	21	151.3792	0.04922881	8319.113	435.9229	1.362309E-07	36	434.7398	0.06345421	11294.67	772.028	1.050212E-15	28	438.0729	0.04855661	3524.455	184.9729	0.09516181	25	111.466	0.05184652	9237.809	510.606	4.713766E-10	32	417.9439	0.08357058	8368.823	772.2847	4.594727E-10	23	489.1204	0.05236169	8754.544	489.2572	3.636764E-07	25	568.6669	0.06002527	11094.06	714.8346	2.559493E-08	33	555.5945	0.06612721	6820.317	490.0253	1.162205E-05	30	358.7901	0.04357398	9367.967	431.3528	4.899559E-10	28	478.4729	MT1A	MT1A_P49_R	71274112	NM_005946.2	MT1A	4489	16	36.1	55230030	-49	Y	GCAGGGCGGGTCCTTTGCGTCCGGCCCTCTTTCCCCTGACCATAA	MT1, MTC, MT1S, MGC32848	metallothionein 1S; go_component: cytoplasm; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: cadmium ion binding; go_process: biological process unknown	metallothionein 1A
MT1A_P600_F	1563	0.07594512	9724.606	807.453	6.438298E-16	38	517.9153	0.2217078	12944.27	3715.849	3.857416E-28	32	1033.662	0.1790456	16849.42	3696.574	3.678E-38	25	1164.62	0.02827735	6936.063	204.751	0.0001853661	21	374.7611	0.2890537	11712.95	4802.861	6.771908E-30	23	941.5776	0.3703939	11794.4	6997.412	3.678E-38	33	1172.658	0.1978345	13558.55	3368.548	8.681695E-25	34	1120.65	0.1540153	19464.53	3561.811	1.680624E-32	22	768.3134	0.2660503	9669.392	3541.319	5.480049E-19	40	1033.527	0.1307738	15795.45	2391.448	3.521422E-36	29	1075.958	MT1A	MT1A_P600_F	71274112	NM_005946.2	MT1A	4489	16	36.1	55229479	-600	Y	AGAGTGAGAGGCCGACCCGTGTTCCCGTGTTACTGTGTACGGAGTAGTGG	MT1, MTC, MT1S, MGC32848	metallothionein 1S; go_component: cytoplasm; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: cadmium ion binding; go_process: biological process unknown	metallothionein 1A
MTA1_P478_F	5764	0.1471221	2510.733	450.3535	0.1076145	29	122.0614	0.1257749	8120.984	1182.754	1.479721E-08	22	605.035	0.1663208	8907.741	1797.063	3.060037E-12	26	468.3335	0.04084504	6234.494	269.7506	0.0008372211	31	230.2006	0.2058015	7990.183	2096.418	8.994473E-11	27	347.0836	0.2106758	9137.877	2465.65	1.73122E-16	21	563.9649	0.1872228	9095.47	2118.172	1.466665E-10	30	404.7237	0.1670208	9982.716	2021.686	1.36383E-08	29	521.8565	0.1290175	8174.931	1225.755	2.332272E-09	25	459.9504	0.1847375	8423.386	1931.389	3.160406E-11	26	454.6323	MTA1	MTA1_P478_F	14141149	NM_004689.2	MTA1	9112	14	36.1	104956933	-478	Y	GCATCAGGAGGAACCCCTGGAGAGCTACGGCAGGACTCACCTGTGGGGCAC	.	metastasis associated gene 1; metastasis associated gene 1 protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	metastasis associated protein
MUC1_E18_R	1676	0.2002961	841.368	235.7777	0.6708478	34	47.82925	0.5516706	1635.235	2135.211	0.06854627	28	238.8905	0.5411913	2035.494	2518.939	0.01803867	28	192.6186	0.4693489	353.178	400.8257	0.7352377	32	34.37505	0.5553259	1665.41	2204.711	0.05263009	20	131.7322	0.5951763	1362.96	2150.86	0.07001622	24	186.298	0.5418819	1786.498	2231.432	0.0843941	30	230.0749	0.6142651	2128.559	3548.878	0.02458746	27	143.7128	0.4680536	1586.67	1484.082	0.1762695	26	222.9293	0.4377211	2172.508	1769.095	0.04969604	34	114.6871	MUC1	MUC1_E18_R	65301116	NM_002456.4	MUC1	4582	1	36.1	153429306	18	N	GGAGGGGGCAGAACAGATTCAGGCAGGCGCTGGCTGCTTGAGAGGTG	EMA, PEM, PUM, MAM6, PEMT, CD227, H23AG, mucin	isoform 1 precursor is encoded by transcript variant 1; peanut-reactive urinary mucin; episialin; polymorphic epithelial mucin; epithelial membrane antigen; DF3 antigen; H23 antigen; tumor associated epithelial mucin; tumor mucin antigen; breast carcinoma-associated antigen DF3; MUC1/ZD; MUC-1/X; MUC-1/Y; MUC-1/Z; MUC-1/SEC; epithelial mucin tandem repeat sequence; go_component: membrane; go_component: cytoskeleton; go_component: extracellular region; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: actin binding; go_function: hormone activity	MUC1 mucin isoform 1 precursor
MUC1_P191_F	5784	0.1837555	6975.051	1592.757	2.144723E-10	21	309.3416	0.22762	6375.81	1908.417	8.077084E-07	36	361.3707	0.2265173	7767.983	2304.169	8.562563E-11	32	437.0723	0.3066752	3225.309	1470.869	0.02518565	30	250.8878	0.2315214	7096.571	2168.128	4.497598E-09	23	294.533	0.2967127	5568.119	2391.345	1.322077E-07	18	356.8206	0.238332	6426.567	2042.214	4.858455E-06	27	333.5435	0.2052506	7872.255	2058.901	5.893538E-06	43	244.5178	0.1949578	5574.25	1374.138	3.917856E-05	28	349.5169	0.2552015	7135.867	2479.333	1.169415E-09	24	389.8574	MUC1	MUC1_P191_F	65301116	NM_002456.4	MUC1	4582	1	36.1	153429515	-191	Y	CTCAACCCCCTGACTACCCGTTTGTTCTCCAGCTGGCCTCCCC	EMA, PEM, PUM, MAM6, PEMT, CD227, H23AG, mucin	isoform 1 precursor is encoded by transcript variant 1; peanut-reactive urinary mucin; episialin; polymorphic epithelial mucin; epithelial membrane antigen; DF3 antigen; H23 antigen; tumor associated epithelial mucin; tumor mucin antigen; breast carcinoma-associated antigen DF3; MUC1/ZD; MUC-1/X; MUC-1/Y; MUC-1/Z; MUC-1/SEC; epithelial mucin tandem repeat sequence; go_component: membrane; go_component: cytoskeleton; go_component: extracellular region; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: actin binding; go_function: hormone activity	MUC1 mucin isoform 1 precursor
MUSK_P308_F	2390	0.1306272	7194.619	1096.049	1.012299E-09	30	275.4843	0.8939839	1044.994	9655.2	2.557935E-11	21	671.0178	0.9128577	1121.844	12799.41	3.406514E-21	28	417.1506	0.115805	4684.832	626.6803	0.009128301	25	201.2113	0.904889	949.3837	9983.873	1.066847E-12	28	570.1979	0.8758953	1406.136	10629.87	8.467255E-18	24	462.0948	0.9068701	1162.85	12297.24	2.255233E-15	31	505.8168	0.9027026	1209.011	12144.7	1.276282E-10	24	625.547	0.892544	1081.244	9811.579	1.106347E-12	24	545.5399	0.9137139	1014.036	11796.92	2.090776E-17	29	456.2097	MUSK	MUSK_P308_F	5031926	NM_005592.1	MUSK	4593	9	36.1	112470652	-308	N	GGAGAGGTGGGGTGCTGAATTCGAAGGTCAGGACACCTATACCTCTGGG	MGC126323, MGC126324	protein-tyrosine kinase; receptor tyrosine kinase; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: development; go_process: muscle development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	skeletal muscle receptor tyrosine kinase
MXI1_P1269_F	4166	0.216215	10212.21	2844.727	5.999264E-25	25	1026.488	0.7146345	3676.886	9458.375	3.340544E-17	29	870.0444	0.6405301	5262.02	9554.445	3.659888E-24	27	444.0817	0.260715	5447.452	1956.355	9.477333E-05	26	373.5143	0.6919507	4113.709	9464.976	7.167921E-20	26	542.3478	0.6773108	4149.074	8918.621	3.805148E-21	33	491.5678	0.4063419	6660.813	4627.582	1.052843E-10	38	640.59	0.6412736	5201.657	9477.453	7.425669E-13	30	437.7604	0.5657347	3753.392	5019.966	3.930047E-08	27	572.678	0.7232376	4008.386	10736.06	2.512923E-23	29	515.8679	MXI1	MXI1_P1269_F	57242781	NM_005962.4	MXI1	4601	10	36.1	111956084	-1269	Y	TGCCTTTGAGTAGGGTGGCTGCATCGCACACCTCCAGGGGGCAGCATTGTCT	MXI, MAD2, MXD2, MGC43220	isoform a is encoded by transcript variant 1; MAX-interacting protein 1; MAX dimerization protein 2; MAX interacting protein 1; Max-related transcription factor; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: transcription regulator activity; go_function: transcription corepressor activity; go_process: regulation of transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: cytoplasmic sequestering of transcription factor	MAX interactor 1 isoform a
MXI1_P75_R	4857	0.01017944	29801.06	307.5063	3.678E-38	19	662.8876	0.05636097	7034.163	426.104	1.380648E-05	36	294.6897	0.03855149	8663.17	351.3794	1.324802E-08	29	385.4823	0.01782153	19008.86	346.7283	2.959956E-31	32	1877.719	0.046359	6876.095	339.1263	1.455946E-05	40	262.666	0.05755746	7080.456	438.5294	8.614896E-07	27	495.2887	0.06061398	7316.72	478.5646	3.711271E-05	30	454.6118	0.06034229	9473.347	614.7746	3.900516E-06	23	484.8672	0.04835116	5787.47	299.1293	0.0005221665	22	400.7652	0.05127053	9132.069	498.9126	1.086207E-09	24	473.8174	MXI1	MXI1_P75_R	57242781	NM_005962.4	MXI1	4601	10	36.1	111957278	-75	Y	CCACCTTTTATTTTGACCGGTCCGATGGCGACAGGCTCGCACTAGGACCC	MXI, MAD2, MXD2, MGC43220	isoform a is encoded by transcript variant 1; MAX-interacting protein 1; MAX dimerization protein 2; MAX interacting protein 1; Max-related transcription factor; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: transcription regulator activity; go_function: transcription corepressor activity; go_process: regulation of transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: cytoplasmic sequestering of transcription factor	MAX interactor 1 isoform a
MYB_P673_R	5817	0.0823454	6075.999	554.201	3.179323E-06	29	250.7253	0.1268466	8816.625	1295.355	4.222599E-10	28	377.8295	0.1722665	10087.93	2120.295	4.302987E-16	35	423.7898	0.4291271	1170.322	954.9054	0.3933479	27	103.2415	0.152088	8838.432	1603.266	1.472285E-11	29	382.2372	0.1290372	9271.351	1388.41	8.107348E-14	20	500.1496	0.1501192	10047.67	1792.439	8.421921E-12	25	323.5495	0.1848407	10071.92	2306.524	3.95575E-09	25	602.1729	0.1363116	7657.291	1224.294	2.454543E-08	33	517.8903	0.1728832	8581.257	1814.549	2.56324E-11	49	298.3868	MYB	MYB_P673_R	46361979	NM_005375.2	MYB	4602	6	36.1	135543473	-673	Y	TCCGCTGGGGCGCTCCATTAGTGAGCGGTGATGGTTGCCGCCCACTTGTATTGAAGC	efg, c-myb, c-myb_CDS	Avian myeloblastosis viral (v-myb) oncogene homolog; v-myb avian myeloblastosis viral oncogene homolog; c-myb protein (140 AA); c-myb8B_CDS; c-myb10A_CDS; c-myb13A_CDS; c-myb14A_CDS; go_component: nucleus; go_component: nuclear matrix; go_function: DNA binding; go_function: protein binding; go_function: transcriptional activator activity; go_process: regulation of transcription; go_process: regulation of transcription, DNA-dependent	v-myb myeloblastosis viral oncogene homolog
MYBL2_P211_F	4173	0.03688241	5025.335	196.2738	0.0005630121	27	283.1843	0.02215235	9483.451	217.1054	2.694024E-09	33	418.543	0.01741258	11541.52	206.3012	7.505138E-15	23	733.049	0.02256029	5333.192	125.4035	0.007008297	33	138.4317	0.01911933	9670.087	190.4386	2.741791E-10	27	406.4706	0.02574738	9854.622	263.079	2.115595E-12	32	539.321	0.02028136	9816.105	205.2754	2.053613E-08	36	404.6615	0.02325352	13011.25	312.1411	1.426489E-10	31	593.5279	0.03541817	7544.637	280.7009	1.809044E-06	34	299.313	0.02055735	11027.93	233.5622	2.470319E-13	31	450.9653	MYBL2	MYBL2_P211_F	31652260	NM_002466.2	MYBL2	4605	20	36.1	41728912	-211	Y	CGCTATGTGGGATACTCCTGGGCCGCCCCGGACTGACACGTGAGCCAG	BMYB, MGC15600	v-myb avian myeloblastosis viral oncogene homolog-like 2; go_component: nucleus; go_component: chromatin; go_function: transcription factor activity; go_process: development; go_process: anti-apoptosis; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter; go_process: regulation of progression through cell cycle	MYB-related protein B
MYBL2_P354_F	4167	0.1687414	9818.196	2013.345	2.711312E-20	35	546.9481	0.04561428	16068.55	772.766	8.838705E-29	25	1330.16	0.03414246	17297.2	614.9801	4.893777E-36	36	694.6989	0.1322278	6438.083	996.2477	8.751432E-05	24	344.0127	0.06156998	13423.78	887.2895	3.623101E-22	22	840.4572	0.05543725	13446.71	795.0685	2.464028E-25	29	768.4741	0.09679101	14451.88	1559.43	4.576095E-22	22	953.6547	0.06302672	16158.06	1093.619	6.967868E-18	29	854.5697	0.07416743	9933.871	803.8024	2.6076E-12	34	406.8734	0.07067548	17608.21	1346.716	3.678E-38	30	998.8409	MYBL2	MYBL2_P354_F	31652260	NM_002466.2	MYBL2	4605	20	36.1	41728769	-354	Y	GAGAGGCACAGGTAGGGTGAGGAGCCGCTTTAGGGTGCGGCTCTAGG	BMYB, MGC15600	v-myb avian myeloblastosis viral oncogene homolog-like 2; go_component: nucleus; go_component: chromatin; go_function: transcription factor activity; go_process: development; go_process: anti-apoptosis; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter; go_process: regulation of progression through cell cycle	MYB-related protein B
MYCL1_P502_R	2798	0.1061105	4721.232	572.3118	0.0004481757	15	320.3754	0.06013121	10403.89	672.021	3.879106E-12	21	458.1909	0.1010643	10839.87	1229.933	1.029971E-15	24	540.5111	0.04948606	4245.45	226.2346	0.03518203	35	214.4076	0.1152941	8354.078	1101.729	1.874504E-09	30	433.0019	0.1536233	7802.974	1434.446	2.780233E-10	31	347.3954	0.09883538	9724.85	1077.542	8.679378E-10	27	470.6095	0.0747387	11550.18	941.0523	2.700198E-09	32	406.3191	0.114447	7516.001	984.2755	1.250023E-07	32	375.1289	0.1667216	9609.073	1942.582	4.736762E-14	24	426.8492	MYCL1	MYCL1_P502_R	74315994	NM_001033081.1	MYCL1	4610	1	36.1	40140776	-502	Y	GGCCCAAGCCTGGATGGCATCGAAGCGAAGATTCCGGGATTTAGAGCCC	LMYC, MYCL	isoform 1 is encoded by transcript variant 1; l-myc protein; myc-related gene from lung cancer; oncogene lmyc; v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived; go_component: nucleus; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent	l-myc-1 proto-oncogene isoform 1
MYCL2_E44_R	1550	0.1193432	4541.771	629.0349	0.0006598929	24	189.1743	0.1283208	8509.463	1267.408	1.923208E-09	40	394.8311	0.08567467	10730.13	1014.811	7.637596E-15	33	466.4156	0.04324694	5115.761	235.7617	0.008502177	33	246.0139	0.662106	4175.463	8377.805	6.980879E-17	24	1305.021	0.6182913	6439.45	10592.59	6.49149E-37	22	1205.957	0.6805611	5769.221	12504.31	4.26178E-29	27	899.4278	0.6234796	7726.527	12959.94	5.076092E-26	29	1221.501	0.4777944	5184.309	4834.903	1.146896E-10	23	983.257	0.648973	6463.684	12134.83	6.4728E-38	35	944.0193	MYCL2	MYCL2_E44_R	.	.	.	4611	X	36.1	106402512	44	Y	CCATCACTATTTCTACGACTATGACGGCGGGGAGGATTTCTACCGCTCCACGAC	.	.	.
MYCL2_P19_F	5898	0.03055646	5183.805	166.5433	0.0003732767	37	214.2818	0.2094477	7353.857	1974.814	1.332758E-08	31	316.655	0.181088	7786.827	1744.033	1.227433E-09	33	336.9047	0.02934946	4886.827	150.7862	0.0146016	19	237.806	0.5793065	4692.399	6599.265	1.442002E-13	32	636.9109	0.7103435	3954.583	9943.315	4.574559E-24	38	662.8955	0.4978812	5933.949	5983.025	5.858117E-12	29	613.4346	0.5976654	6399.249	9654.593	1.983692E-15	36	577.2232	0.7059621	3526.285	8706.43	3.707483E-16	32	597.7457	0.7150558	4699.922	12045.21	1.955086E-30	34	846.4532	MYCL2	MYCL2_P19_F	.	.	.	4611	X	36.1	106402449	-19	Y	GGAACTAGTCTGCTCCAGGTGGCAAGCTGCGTGAGCAAGCAAGCCAACATGGACCGCG	.	.	.
MYCN_E77_R	4150	0.03701	5594.683	218.8602	7.676677E-05	49	175.8076	0.05191091	12813.8	707.072	2.930939E-18	35	821.8658	0.03783558	16599.19	656.6688	2.603638E-33	23	1123.349	0.02880432	6593.98	198.5342	0.0004316317	23	252.1826	0.03790498	12901.67	512.2445	2.256461E-19	36	737.333	0.06759127	13563.72	990.4971	1.617437E-26	37	745.8964	0.04038351	14340.94	607.7178	4.047245E-19	34	913.3743	0.03709134	17635.83	683.186	3.084772E-20	28	769.4825	0.0697673	8290.061	629.2532	2.079705E-08	18	517.3527	0.03207969	13920.72	464.6876	3.715633E-22	28	834.3218	MYCN	MYCN_E77_R	62750358	NM_005378.4	MYCN	4613	2	36.1	15998211	77	Y	GCCGAGCAAGCGCTAGCCAGGCGCAAGCGCGCACAGACTGTAGCCATCC	NMYC, ODED, MODED, N-myc	neuroblastoma MYC oncogene; N-myc proto-oncogene protein; pp65/67; oncogene NMYC; neuroblastoma-derived v-myc avian myelocytomatosis viral related oncogene; v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived; go_component: nucleus; go_component: chromatin; go_function: protein binding; go_function: transcription factor activity; go_process: regulation of transcription from RNA polymerase II promoter	v-myc myelocytomatosis viral related oncogene, neuroblastoma derived
MYCN_P464_R	2802	0.09493884	5440.003	581.1337	3.585298E-05	28	248.1656	0.04735206	12343.45	618.5105	9.718925E-17	41	617.8564	0.03537577	13352.54	493.3464	5.9261E-21	32	1146.462	0.07686953	3731.873	319.0819	0.06256187	35	152.5263	0.04395035	12956.89	600.2353	8.335896E-20	24	631.6876	0.04446692	13251.21	621.3152	5.656908E-24	32	737.1068	0.04194052	12012.42	530.2395	2.758453E-13	26	767.7831	0.05102643	14647.35	792.9667	3.006172E-14	22	667.6861	0.04409817	7277.703	340.3521	3.896357E-06	14	1004.163	0.03994193	13980.75	585.8105	9.63462E-23	29	730.3709	MYCN	MYCN_P464_R	62750358	NM_005378.4	MYCN	4613	2	36.1	15997670	-464	Y	GGCCTTGCTCAACGTTGGCCTCGCGCTCAGCTGCACAACACGCAGTCAAA	NMYC, ODED, MODED, N-myc	neuroblastoma MYC oncogene; N-myc proto-oncogene protein; pp65/67; oncogene NMYC; neuroblastoma-derived v-myc avian myelocytomatosis viral related oncogene; v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived; go_component: nucleus; go_component: chromatin; go_function: protein binding; go_function: transcription factor activity; go_process: regulation of transcription from RNA polymerase II promoter	v-myc myelocytomatosis viral related oncogene, neuroblastoma derived
MYH11_P22_F	2152	0.05208211	6992.825	389.706	1.07739E-07	20	343.1926	0.0827463	8607.898	785.5476	1.014073E-08	22	414.6707	0.127809	3062.899	463.4845	0.09735171	32	104.8894	0.0282291	5853.744	172.9511	0.002331584	20	296.4442	0.07608142	7579.68	632.3943	3.843685E-07	30	405.3263	0.1462281	2992.414	529.6473	0.06910664	20	133.0854	0.1060198	8423.271	1010.8	1.846302E-07	14	667.2747	0.1214408	8526.947	1192.479	1.016095E-05	25	370.0062	0.4347557	5180.415	4061.412	4.874471E-09	26	492.8846	0.09677174	11225.2	1213.38	2.256693E-16	34	566.4648	MYH11	MYH11_P22_F	13124874	NM_022844.1	MYH11	4629	16	36.1	15858391	-22	Y	GGAGCGTCCAAATCTCCCTGCGCGTCCTCGGACGCCTCTCTTTATAGAC	AAT4, FAA4, SMHC, SMMHC, MGC32963, MGC126726, DKFZp686D10126	isoform SM2 is encoded by transcript variant SM2; smooth muscle myosin heavy chain 11, isoform SM2; smooth muscle myosin heavy chain isoform SM1; smooth muscle myosin heavy chain isoform SM2; go_component: myosin; go_component: muscle myosin; go_component: striated muscle thick filament; go_function: ATP binding; go_function: actin binding; go_function: motor activity; go_function: calmodulin binding; go_function: nucleotide binding; go_process: striated muscle contraction	smooth muscle myosin heavy chain 11 isoform SM2
MYH11_P236_R	2403	0.1854667	1651.953	398.9143	0.334737	27	60.67307	0.06541589	4969.843	354.8619	0.004314155	33	173.7671	0.04974198	5089.89	271.6688	0.003229201	22	326.1771	0.359278	384.2507	271.5383	0.7558914	32	23.89386	0.04130926	5006.295	220.0264	0.003930592	24	196.3404	0.05254081	4995.188	282.5508	0.001680901	25	202.2667	0.05488272	5630.221	332.7525	0.003385988	34	251.6464	0.07459987	5274.904	433.2905	0.02359834	28	213.1843	0.06579206	4777.938	343.5312	0.005756712	29	214.5794	0.05265009	5185.18	293.7301	0.002403279	39	192.4177	MYH11	MYH11_P236_R	13124874	NM_022844.1	MYH11	4629	16	36.1	15858605	-236	Y	GCACCGCACAAGGGCGCACGGAACAGGTGCGCACAGGGACGGGAGTCTCAGCCC	AAT4, FAA4, SMHC, SMMHC, MGC32963, MGC126726, DKFZp686D10126	isoform SM2 is encoded by transcript variant SM2; smooth muscle myosin heavy chain 11, isoform SM2; smooth muscle myosin heavy chain isoform SM1; smooth muscle myosin heavy chain isoform SM2; go_component: myosin; go_component: muscle myosin; go_component: striated muscle thick filament; go_function: ATP binding; go_function: actin binding; go_function: motor activity; go_function: calmodulin binding; go_function: nucleotide binding; go_process: striated muscle contraction	smooth muscle myosin heavy chain 11 isoform SM2
MYLK_E132_R	5669	0.0285466	8009.537	238.3024	1.279807E-09	26	521.1948	0.0596676	11221.9	718.4169	3.81363E-14	27	555.1802	0.05851078	12011.35	752.6849	1.153087E-17	29	783.4407	0.02708116	6700.421	189.2895	0.0003426262	34	202.3395	0.09077744	11866.04	1194.698	2.499898E-18	34	849.207	0.103098	12679.61	1469.004	5.480093E-25	30	857.9221	0.09496607	14413.33	1522.897	7.519059E-22	31	1049.885	0.09643983	16453.5	1766.808	5.170288E-20	26	645.7666	0.1160409	9293.009	1233.059	8.204677E-12	28	555.1685	0.06155293	12870.66	850.7484	4.454002E-20	24	830.2407	MYLK	MYLK_E132_R	47132560	NM_053025.2	MYLK	4638	3	36.1	125085707	132	Y	CCTCGGAGCCTTGACTTCCAGGGCCCGCGCCTGGACAAAAGCATGGGG	KRP, MLCK, MLCK108, MLCK210, FLJ12216, DKFZp686I10125	isoform 1 is encoded by transcript variant 1; myosin light chain kinase; go_function: ATP binding; go_function: kinase activity; go_function: calmodulin binding; go_function: nucleotide binding; go_function: calcium ion binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: signal transducer activity; go_function: protein-tyrosine kinase activity; go_function: myosin light chain kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	myosin light chain kinase isoform 1
MYLK_P469_R	5076	0.1641999	3440.911	695.6417	0.01105377	27	145.1683	0.2936332	10437.4	4380.346	4.583477E-22	31	1055.432	0.2271571	14911.34	4412.191	3.678E-38	32	816.0853	0.04527235	6855.642	329.8304	0.0001657364	25	325.433	0.2142423	11363.14	3125.506	9.593467E-23	22	1019.347	0.2491318	12651.41	4230.811	3.106629E-36	28	775.739	0.2433724	11662.32	3783.398	1.807746E-20	31	885.0697	0.2168197	14594.05	4067.978	5.004056E-21	28	571.8489	0.2881509	7234.857	2969.093	4.4637E-11	33	620.5664	0.2629293	12820.95	4609.186	4.235184E-33	34	1234.696	MYLK	MYLK_P469_R	47132560	NM_053025.2	MYLK	4638	3	36.1	125086308	-469	Y	TAGGTCGGGGTCTGATGCTAGCTTCGTGAGCGTGCATGAGACACTGGCT	KRP, MLCK, MLCK108, MLCK210, FLJ12216, DKFZp686I10125	isoform 1 is encoded by transcript variant 1; myosin light chain kinase; go_function: ATP binding; go_function: kinase activity; go_function: calmodulin binding; go_function: nucleotide binding; go_function: calcium ion binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: signal transducer activity; go_function: protein-tyrosine kinase activity; go_function: myosin light chain kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	myosin light chain kinase isoform 1
MYOD1_E156_F	3697	0.2743943	1345.247	546.533	0.3878713	26	57.18848	0.2574978	7046.129	2478.259	5.797538E-09	32	340.1347	0.2209736	8598.67	2467.409	4.104946E-13	39	430.965	0.03042762	6409.525	204.2853	0.0006534194	25	208.0212	0.2461959	6738.835	2233.595	1.647343E-08	23	432.1859	0.3387541	6426.823	3343.67	1.541436E-11	31	478.5583	0.2196353	8191.366	2333.623	2.756559E-09	20	462.4293	0.2414559	9095.735	2927.139	1.284282E-08	28	509.9994	0.2218588	7157.775	2069.292	5.216094E-09	19	671.9356	0.1931337	8069.337	1955.435	1.644965E-10	22	469.7086	MYOD1	MYOD1_E156_F	23111008	NM_002478.3	MYOD1	4654	11	36.1	17697891	156	Y	TGGGCGAAGCCAGGACCGTGCCGCGCCACCGCCAGGATATGGAGCTACTGTC	PUM, MYF3, MYOD	myoblast determination protein 1; myogenic factor 3; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: transcription regulator activity; go_function: transcription coactivator activity; go_function: RNA polymerase II transcription factor activity, enhancer binding; go_process: myogenesis; go_process: muscle development; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription from RNA polymerase II promoter	myogenic differentiation 1
MYOD1_P50_F	1565	0.1000201	1446.244	171.8432	0.4838158	21	85.49545	0.2102554	4628.793	1258.957	0.001185619	35	349.9053	0.1999414	6305.097	1600.688	1.292282E-06	26	385.6647	0.2276316	293.478	115.9654	0.8036459	28	10.04659	0.1446697	5701.364	981.2365	8.07739E-05	31	234.2672	0.2680225	6040.773	2248.519	2.987623E-08	35	388.5685	0.2094477	6073.756	1635.666	4.739849E-05	32	394.7087	0.189513	6705.504	1591.304	0.0002762802	24	508.5587	0.2083255	4394.24	1182.639	0.001979762	31	226.816	0.1868822	6471.773	1510.418	1.1349E-06	20	393.295	MYOD1	MYOD1_P50_F	23111008	NM_002478.3	MYOD1	4654	11	36.1	17697685	-50	Y	CTACGGATAAATAGCCCAGGGCGCCTGGCGAGAAGCTAGGGGTGAGGAA	PUM, MYF3, MYOD	myoblast determination protein 1; myogenic factor 3; go_component: nucleus; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: transcription regulator activity; go_function: transcription coactivator activity; go_function: RNA polymerase II transcription factor activity, enhancer binding; go_process: myogenesis; go_process: muscle development; go_process: cell differentiation; go_process: protein amino acid phosphorylation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription from RNA polymerase II promoter	myogenic differentiation 1
NAT2_P11_F	4177	0.52457	1623.876	1902.053	0.0406246	31	143.5318	0.8819928	1368.071	10972.44	3.92565E-15	27	678.6055	0.9067483	1224.228	12876.35	9.000948E-22	30	743.8616	0.07958861	2277.3	205.5668	0.3067209	32	106.5208	0.8968973	1181.636	11149.03	2.86946E-16	23	666.7522	0.8496408	1647.035	9872.044	3.075343E-16	25	720.9404	0.9118469	1117.664	12595.41	5.596762E-16	32	1101.665	0.9217307	1316.402	16680.12	1.648344E-19	32	764.1618	0.8825305	1219.434	9912.708	2.866445E-13	26	491.9739	0.9176604	1032.604	12622.66	7.076456E-20	26	1162.309	NAT2	NAT2_P11_F	4557782	NM_000015.1	NAT2	10	8	36.1	18293024	-11	N	AACTAGACTCTGGTGTCAGGGTGATACGGAATTCCAGTGAGATCACTTCCCT	AAC2	Arylamine N-acetyltransferase-2; arylamide acetylase 2 (N-acetyltransferase 2, isoniazid inactivation); arylamine N-acetyltransferase 2; go_function: transferase activity; go_function: acetyltransferase activity; go_function: arylamine N-acetyltransferase activity; go_process: metabolism	arylamide acetylase 2
NBL1_E205_R	3704	0.7632885	1218.926	4252.944	0.0002503843	21	467.5988	0.9101164	1339.568	14576.35	1.363712E-25	37	842.4022	0.9199284	1556.661	19033.11	3.678E-38	30	759.8475	0.7638484	286.5175	1250.217	0.545923	20	207.9432	0.9272002	939.5722	13240.3	9.5578E-22	37	693.2868	0.9247966	979.0369	13269.22	2.330301E-25	40	633.668	0.9213137	1259.374	15916.49	1.479216E-25	29	1130.601	0.8994169	1948.414	18316.98	6.179672E-25	39	826.8217	0.9162288	835.0719	10227.14	4.268433E-13	22	687.4296	0.8866439	1532.3	12767.46	6.987949E-22	30	699.0791	NBL1	NBL1_E205_R	33519445	NM_005380.3	NBL1	4681	1	36.1	19842518	205	N	AAATCCCCAAGTCCTACAATCGTGTCCCAGTGGTGTCCCTGGGCCAC	NB, DAN, NO3, DAND1, MGC8972, D1S1733E	neuroblastoma candidate region, suppression of tumorigenicity 1; zinc finger protein DAN; neuroblastoma suppressor of tumorigenicity 1; differential screening-selected gene aberrant in neuroblastoma; go_process: cell cycle; go_process: negative regulation of progression through cell cycle	neuroblastoma, suppression of tumorigenicity 1 precursor
NBL1_P24_F	1581	0.2313789	1502.828	482.5014	0.3562977	20	79.04823	0.9380512	671.9382	11688.98	3.48808E-15	32	385.4378	0.9416854	743.1644	13615.73	1.27921E-22	27	695.708	0.2570951	929.401	356.242	0.6102799	35	62.66209	0.9259771	622.397	9036.694	7.221607E-10	28	597.9482	0.9134112	721.1931	8662.63	1.280232E-10	36	481.497	0.9225127	771.1137	10370.91	2.010116E-10	29	616.9783	0.9185789	1020.16	12637.46	4.11807E-11	36	447.0757	0.8789472	611.4521	5165.752	0.001193264	18	316.6922	0.9222143	702.3315	9512.306	6.415873E-11	39	366.0373	NBL1	NBL1_P24_F	33519445	NM_005380.3	NBL1	4681	1	36.1	19842289	-24	N	GAATTCCGGGCAGAGGGAAGGGCGCAGGCAACAGCTAGGAGGCGCAGATGC	NB, DAN, NO3, DAND1, MGC8972, D1S1733E	neuroblastoma candidate region, suppression of tumorigenicity 1; zinc finger protein DAN; neuroblastoma suppressor of tumorigenicity 1; differential screening-selected gene aberrant in neuroblastoma; go_process: cell cycle; go_process: negative regulation of progression through cell cycle	neuroblastoma, suppression of tumorigenicity 1 precursor
NCL_P1102_F	1587	0.6482382	2288.336	4401.304	2.472083E-06	28	275.3698	0.9540782	938.2267	21570.35	3.678E-38	25	1714.391	0.9599528	1039.067	27304.06	3.678E-38	29	1208.197	0.7096845	1700.96	4402.497	0.001989837	22	250.4842	0.9374861	1238.868	20078.23	3.678E-38	34	1264.282	0.943928	1165.024	21295.68	3.678E-38	20	2036.948	0.9435109	1296.257	23321.05	3.678E-38	28	1507.159	0.9522256	1315.578	28214.89	3.678E-38	30	1142.086	0.9141325	1091.475	12684.26	9.778625E-21	29	1276.797	0.9638109	891.4218	26404.19	3.678E-38	25	1460.763	NCL	NCL_P1102_F	55956787	NM_005381.2	NCL	4691	2	36.1	232038551	-1102	Y	TAAAAATCACCTCAGGCCGGGCGCGGTGGCTCAGATCCGCAATCCCA	C23, FLJ45706	go_component: nucleus; go_component: nucleolus; go_function: DNA binding; go_function: RNA binding; go_function: nucleotide binding; go_function: nucleic acid binding	nucleolin
NCL_P840_R	1588	0.06623773	5549.425	400.7499	4.668156E-05	32	282.6333	0.04713905	11560.77	576.8709	1.256218E-14	24	622.6769	0.04197095	14394.07	634.9807	6.72755E-25	27	611.6863	0.03491051	4851.12	179.0985	0.01478202	29	214.9133	0.04240195	11874.69	530.2334	1.796325E-16	33	776.1567	0.04274379	11858.86	533.9918	6.385132E-19	26	826.1323	0.04637188	10619.29	521.2448	2.023265E-10	31	1049.524	0.04600754	14333.11	696.0558	1.738411E-13	28	596.077	0.05800482	6776.543	423.4338	1.697062E-05	34	496.035	0.03792534	15018.69	595.9844	2.698101E-26	38	781.9417	NCL	NCL_P840_R	55956787	NM_005381.2	NCL	4691	2	36.1	232038289	-840	Y	GGCTGCGAAGTCAGTGTCACCAGATGGCCCGGGAGCAGGTCGAGAGCCACCG	C23, FLJ45706	go_component: nucleus; go_component: nucleolus; go_function: DNA binding; go_function: RNA binding; go_function: nucleotide binding; go_function: nucleic acid binding	nucleolin
NDN_E131_R	3709	0.4890247	1943.832	1956.032	0.01888916	29	107.3168	0.8361077	2064.046	11040.03	4.053078E-17	29	675.1633	0.8331725	2842.202	14693.99	1.840686E-34	27	942.4763	0.1938214	4687.463	1151.001	0.003405206	27	190.1934	0.8217786	2509.439	12032.12	6.434228E-23	31	869.914	0.8476119	2304.759	13375.73	5.09357E-31	28	1064.836	0.834413	2568.242	13445.59	4.500078E-22	37	725.156	0.8332427	3473.097	17853.83	1.017093E-27	28	688.2557	0.8516693	1694.923	10305.89	1.598676E-15	38	652.282	0.7825043	3188.771	11832.31	2.998301E-24	27	591.1299	NDN	NDN_E131_R	10800414	NM_002487.2	NDN	4692	15	36.1	21483412	131	Y	GCACCTCGGAGTTGGGGGCCTCGGCTGCAAAGTTAGGGTCGCTCAGA	HsT16328	necdin (mouse) homolog; go_component: nucleus; go_function: DNA binding; go_process: transcription; go_process: regulation of cell growth; go_process: nervous system development; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: regulation of progression through cell cycle	necdin
NDN_P1110_F	1595	0.5121348	1296.719	1466.201	0.1440191	20	76.32973	0.9172698	1069.364	12965.3	1.01314E-19	30	802.7745	0.9485502	883.6992	18135.89	3.678E-38	23	1158.215	0.380698	533.8591	389.6465	0.6976179	33	26.55149	0.9313065	808.7055	12319.7	1.585746E-18	29	615.4078	0.924056	1013.607	13549.93	1.489687E-26	24	434.7206	0.9385385	777.9344	13406.36	3.85738E-17	29	746.73	0.9403698	912.4129	15965.79	4.261703E-17	35	792.4929	0.9215371	903.4746	11785.69	1.901303E-17	21	909.5035	0.9465492	779.6288	15577.15	5.616199E-29	35	654.8458	NDN	NDN_P1110_F	10800414	NM_002487.2	NDN	4692	15	36.1	21484653	-1110	N	CTGATGTGGTCCTTCAGCTCTTCCCGGGTTTCTTCTCATCAGCAGCTTCTTAAA	HsT16328	necdin (mouse) homolog; go_component: nucleus; go_function: DNA binding; go_process: transcription; go_process: regulation of cell growth; go_process: nervous system development; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of cell proliferation; go_process: regulation of progression through cell cycle	necdin
NEFL_E23_R	3711	0.975785	713.0427	32763.01	3.678E-38	26	1122.64	0.1764364	8079.549	1752.349	1.50543E-09	19	452.5029	0.1366735	11851.03	1891.971	1.254978E-20	25	554.7809	0.9761679	461.7271	23008.43	3.678E-38	42	1712.719	0.1388022	9413.574	1533.336	9.898763E-13	29	512.9292	0.4197495	7912.459	5796.161	2.207339E-23	32	645.2573	0.2084961	8702.165	2318.646	3.408583E-10	31	353.6359	0.3462766	9782.896	5234.958	1.823027E-13	36	474.0058	0.1907352	7376.241	1762.071	7.817395E-09	20	586.8119	0.1813642	11592.47	2590.402	1.643487E-21	30	471.1646	NEFL	NEFL_E23_R	5453761	NM_006158.1	NEFL	4747	8	36.1	24869923	23	Y	CGCCGCTTGTAGGAGGTCGAGTAGTACGGCTCGTAGCTGAAGGAACTCATG	NFL, NF-L, NF68, CMT1F, CMT2E	neurofilament, light polypeptide (68kD); go_component: axon; go_component: neurofilament; go_component: intermediate filament; go_function: protein binding; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton	neurofilament, light polypeptide 68kDa
NEFL_P209_R	1596	0.382361	1292.724	862.1919	0.3016216	40	74.32964	0.1717243	5129.094	1084.135	0.0005227911	25	347.8801	0.2053638	5350.765	1408.682	6.94081E-05	28	229.6124	0.1230382	1756.714	260.4981	0.4208339	34	67.38628	0.2039458	4234.685	1110.528	0.002989069	21	320.1586	0.3100497	5187.241	2375.979	7.178159E-07	28	234.1112	0.207768	5145.281	1375.609	0.001001325	24	277.3535	0.2063636	6364.816	1681	0.0004641042	29	263.5651	0.1986199	4725.011	1195.866	0.0008184472	23	304.5474	0.1503451	7058.565	1266.697	3.030589E-07	21	414.6413	NEFL	NEFL_P209_R	5453761	NM_006158.1	NEFL	4747	8	36.1	24870155	-209	Y	GGGGCAGCGCGCTGCTGCAGCCAAGGCGAGGATTCTGCGCAAAAGGGA	NFL, NF-L, NF68, CMT1F, CMT2E	neurofilament, light polypeptide (68kD); go_component: axon; go_component: neurofilament; go_component: intermediate filament; go_function: protein binding; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton	neurofilament, light polypeptide 68kDa
NEO1_P1067_F	4885	0.118638	1221.49	177.8825	0.5614484	37	47.7844	0.1342788	5787.651	913.212	0.0001387132	30	271.1757	0.144253	6645.246	1137.044	2.058856E-06	34	266.5518	0.06966677	1775.255	140.426	0.4470294	32	54.19273	0.1616358	5389.752	1058.419	0.0001633291	36	201.9803	0.2737508	5473.851	2100.995	6.840601E-07	32	240.6198	0.2371461	5362.196	1698.016	0.0002710115	29	341.204	0.1581307	6010.235	1147.703	0.002496706	35	226.9346	0.1960357	4466.49	1113.476	0.001964713	28	316.4036	0.1108769	6983.373	883.3229	1.744059E-06	26	200.1382	NEO1	NEO1_P1067_F	4505374	NM_002499.1	NEO1	4756	15	36.1	71130861	-1067	Y	GAAAGACGTGATTCCCAGGTAGGAAAACGCCAAGTGTCCCGCAAAGGTACAGGTAA	NGN, HsT17534	neogenin (chicken) homolog 1; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: protein binding; go_function: vascular endothelial growth factor receptor activity; go_process: development; go_process: cell motility; go_process: cell adhesion; go_process: cell-cell signaling; go_process: protein amino acid phosphorylation	neogenin homolog 1
NES_P239_R	5911	0.4184225	2092.739	1577.591	0.03057749	23	182.2032	0.4877098	4310.255	4198.645	3.50447E-07	35	289.3783	0.3194585	6379.78	3041.725	2.058284E-09	32	387.9283	0.185204	1860.136	445.541	0.3486552	45	51.85305	0.3268731	5960.039	2942.779	2.22821E-08	30	293.9465	0.3632887	5159.318	3000.812	5.395061E-08	36	211.5536	0.2936445	6286.632	2655.036	1.0318E-06	22	367.259	0.3527474	5877.801	3257.853	4.247273E-05	31	395.5765	0.3452998	5047.635	2714.948	2.288102E-06	27	369.5272	0.258716	6855.275	2427.466	5.358616E-09	33	243.8377	NES	NES_P239_R	38176299	NM_006617.1	NES	10763	1	36.1	154914052	-239	N	GAGGCTGTGAAGAAGGGTCACAATCCCCGAAAAAGGCAGATAATGCACAGAACTGA	FLJ21841, Nbla00170	go_component: intermediate filament; go_component: intermediate filament; go_function: structural molecule activity; go_process: central nervous system development	nestin
NEU1_P745_F	1601	0.09687683	2839.681	315.3357	0.07891423	32	92.55511	0.3316531	5899.418	2977.085	8.447476E-08	28	404.7139	0.2530526	8128.753	2787.756	9.518557E-13	31	455.5122	0.4128029	360.6283	323.8243	0.7499549	27	20.56209	0.2830974	7044.082	2821.123	2.68006E-10	36	367.8844	0.3097927	6591.278	3003.313	4.088153E-11	31	496.6571	0.3085261	6624.93	3000.571	9.181156E-08	24	554.6216	0.2716894	8296.489	3132.231	8.41238E-08	45	393.9708	0.3040253	6200.211	2752.145	1.797515E-08	19	327.7016	0.3495704	7097.332	3868.173	1.267422E-12	24	554.0475	NEU1	NEU1_P745_F	40806202	NM_000434.2	NEU1	4758	6	36.1	31939407	-745	Y	TCACTTCTTCCTCTTCTTGTTGTCCGGGGGCGCCTCGTTCTTCTTGCCCA	NEU, SIAL1	exo-alpha-sialidase; neuraminidase 1; lysosomal sialidase; neurominidase; go_component: lysosome; go_function: exo-alpha-sialidase activity; go_function: hydrolase activity, acting on glycosyl bonds; go_process: carbohydrate metabolism	neuraminidase precursor
NFKB1_P336_R	4183	0.228857	3260.634	997.3565	0.008267037	30	180.1239	0.2825534	480.2604	228.5251	0.7758965	26	19.86183	0.04237349	11269.2	503.0694	6.468697E-15	32	459.5541	0.07651202	4506.816	381.6799	0.01862869	31	239.7502	0.05290942	5886.006	334.4095	0.0003144121	26	333.7622	0.06595036	7309.348	523.1512	2.299229E-07	21	411.6009	0.06435454	5993.287	419.1018	0.001282555	27	346.6793	0.05151726	11519.04	631.0936	8.464186E-09	26	721.3801	0.08809541	4466.668	441.1674	0.009128924	15	363.6592	0.049274	6488.734	341.4794	5.911583E-05	25	225.3389	NFKB1	NFKB1_P336_R	34577121	NM_003998.2	NFKB1	4790	4	36.1	103641182	-336	Y	CTCCGTGCTGCCTGCGTTCCCCGACCATTGATTGGGCCCGGCAGGCGC	KBF1, EBP-1, MGC54151, NFKB-p50, NFKB-p105, NF-kappa-B, DKFZp686C01211	nuclear factor kappa-B DNA binding subunit; nuclear factor NF-kappa-B p50 subunit; DNA binding factor KBF1; go_component: nucleus; go_function: protein binding; go_function: transcription factor activity; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	nuclear factor kappa-B, subunit 1
NFKB1_P496_F	4185	0.3951544	1944.582	1335.755	0.0637204	36	98.80865	0.4712203	3786.932	3463.827	2.687398E-05	22	361.2647	0.5389916	3821.062	4584.34	1.793318E-07	38	338.5164	0.05555564	2832.125	172.4783	0.1983987	31	129.3205	0.5470469	3083.231	3844.496	3.744044E-05	25	383.1829	0.5123057	4029.691	4338.096	2.074905E-08	32	365.7296	0.5464585	3420.996	4242.341	5.397563E-05	35	272.9478	0.5677255	3731.431	5031.99	0.0001001124	30	400.8429	0.5346469	3148.915	3732.697	4.862091E-05	38	262.5213	0.6173186	3186.694	5301.896	1.579251E-07	20	289.9993	NFKB1	NFKB1_P496_F	34577121	NM_003998.2	NFKB1	4790	4	36.1	103641022	-496	Y	GTGAAGAGATGTGAATGTAACTGAGACACGCTTAAATGGAATATACAGATGAGCTTT	KBF1, EBP-1, MGC54151, NFKB-p50, NFKB-p105, NF-kappa-B, DKFZp686C01211	nuclear factor kappa-B DNA binding subunit; nuclear factor NF-kappa-B p50 subunit; DNA binding factor KBF1; go_component: nucleus; go_function: protein binding; go_function: transcription factor activity; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	nuclear factor kappa-B, subunit 1
NFKB2_P709_R	4186	0.2191229	3598.02	1037.706	0.003127919	49	105.8562	0.1267242	9895.749	1450.519	9.534376E-13	34	567.6809	0.1382137	11677.46	1888.875	4.484804E-20	32	634.8352	0.101962	2947.597	346.02	0.1498895	30	156.0367	0.1700178	7621.377	1581.687	5.937972E-09	32	530.9764	0.1888426	8828.882	2078.701	1.709099E-14	29	671.7736	0.1667229	8759.592	1772.636	2.675862E-09	41	660.4778	0.1498144	12308.64	2186.573	1.567682E-12	21	334.4561	0.1649524	7841.446	1568.726	2.230786E-09	17	685.3914	0.1924497	10323.77	2484.118	2.132807E-17	27	536.1182	NFKB2	NFKB2_P709_R	19923222	NM_002502.2	NFKB2	4791	10	36.1	104144744	-709	Y	GGGATTCACCTATCTACACACATGCTCGCTTGCACACTCATGTTGACGCCATGGACAC	LYT10, LYT-10	Nuclear factor of kappa light chain gene enhancer in B-cells 2; go_component: nucleus; go_component: nucleus; go_component: cytoplasm; go_function: protein binding; go_function: protein binding; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
NGFB_E353_F	3030	0.1362315	6340.665	1015.806	1.220267E-07	21	219.7105	0.09096531	8659.412	876.5371	5.515909E-09	25	372.4577	0.09296121	10234.23	1059.142	1.114793E-13	23	530.7263	0.06036487	3714.655	245.0645	0.07027041	27	147.4939	0.08841126	9483.125	929.4281	1.71271E-11	32	555.2519	0.1537201	8895.837	1634.023	1.803565E-13	27	500.977	0.1090326	8175.504	1012.719	4.419466E-07	23	834.5034	0.0834648	11854.17	1088.614	5.624938E-10	29	610.2411	0.09413951	7182.64	756.832	1.173087E-06	36	412.6111	0.0865513	10181.48	974.1935	4.457896E-13	16	1286.001	NGFB	NGFB_E353_F	70995318	NM_002506.2	NGFB	4803	1	36.1	115682027	353	Y	CGCGTTATCCACTTCTAGCCCTCGAGCTAGACCCTGGCATGGCCGTGGGCTTCT	NGF, HSAN5, Beta-NGF	nerve growth factor, beta subunit; beta-nerve growth factor; go_function: growth factor activity; go_function: signal transducer activity; go_process: development; go_process: cell-cell signaling	nerve growth factor, beta polypeptide precursor
NGFB_P13_F	2157	0.04355499	9383.933	431.8833	9.426416E-14	21	476.1826	0.3367358	11494.07	5886.251	9.952386E-31	28	1394.862	0.2337458	17934.44	5501.405	3.678E-38	30	1230.95	0.04058053	7996.381	342.4523	6.941168E-06	27	286.0096	0.3155166	12613.75	5860.477	8.641924E-38	26	879.4545	0.2584082	14943	5241.743	3.678E-38	29	984.9844	0.2686757	12593.98	4663.545	8.222603E-26	30	1411.639	0.3013204	16089.17	6981.922	1.242042E-32	29	788.9246	0.2622737	10671.33	3829.384	4.216762E-23	25	977.5834	0.3327942	13239.38	6653.522	3.678E-38	31	1097.574	NGFB	NGFB_P13_F	70995318	NM_002506.2	NGFB	4803	1	36.1	115682393	-13	Y	CCAGCGCTCTCTGCTGTGCCGGAGCGCCGAGCTGCTCTCACACAGGCTTCTTGAA	NGF, HSAN5, Beta-NGF	nerve growth factor, beta subunit; beta-nerve growth factor; go_function: growth factor activity; go_function: signal transducer activity; go_process: development; go_process: cell-cell signaling	nerve growth factor, beta polypeptide precursor
NGFR_E328_F	940	0.2470752	463.9238	185.0538	0.7951526	31	15.38634	0.2941616	6093.799	2581.296	1.858019E-07	27	366.5204	0.2190864	8157.844	2316.749	1.057124E-11	31	347.0224	0.06110558	3408.345	228.3318	0.103491	26	115.5453	0.2305718	6556.122	1994.616	9.841349E-08	22	372.2059	0.2154603	7424.416	2066.452	7.196325E-11	26	418.2075	0.2152893	7399.797	2057.607	1.6971E-07	26	294.4764	0.2156839	8813.574	2451.198	1.385869E-07	27	301.805	0.3064715	5974.144	2684.176	6.432951E-08	23	345.3663	0.2135235	7994.453	2197.593	7.18415E-11	23	369.8391	NGFR	NGFR_E328_F	4505392	NM_002507.1	NGFR	4804	17	36.1	44927994	328	Y	AAGGACCTCTGATGCCGGGACCACGAAGGAGGGTCTAGGGTTC	CD271, TNFRSF16, p75(NTR)	go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: signal transduction; go_process: cell differentiation; go_process: nervous system development	nerve growth factor receptor precursor
NGFR_P355_F	4197	0.3281269	5587.628	2777.703	6.703468E-10	33	250.4226	0.1684051	9833.518	2011.622	6.46791E-14	35	581.2632	0.1733708	11779.04	2491.418	2.506016E-22	26	415.2217	0.1548937	7489.138	1390.961	1.296737E-06	40	406.2468	0.1875219	8734.915	2039.12	2.534696E-12	25	446.0538	0.1953969	10710.42	2625.299	4.568102E-22	31	538.9419	0.1957857	10257.5	2521.53	8.297464E-14	28	733.9293	0.202679	12546.2	3214.664	7.37367E-15	27	551.9278	0.1805112	10121.7	2251.563	1.505303E-16	19	1034.024	0.2057252	12098.33	3159.491	4.693557E-25	30	636.0253	NGFR	NGFR_P355_F	4505392	NM_002507.1	NGFR	4804	17	36.1	44927311	-355	Y	CTCCAGGGAGAAGGTGAAGCCAGAGGCGGAGGAAGATGGGTAAGAGA	CD271, TNFRSF16, p75(NTR)	go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: signal transduction; go_process: cell differentiation; go_process: nervous system development	nerve growth factor receptor precursor
NID1_E20_F	5670	0.7450693	436.4589	1567.874	0.349995	21	75.83837	0.957516	432.5859	12003.55	2.251818E-15	24	901.9549	0.9700652	453.3481	17931.74	4.527353E-38	26	976.7949	0.8691669	344.3306	2951.832	0.1495006	34	154.5591	0.2653613	847.8324	342.3697	0.6669417	26	61.07982	0.9599841	456.8016	13357.72	9.17765E-24	21	1073.608	0.9652486	449.1538	15253.18	3.472971E-21	26	997.4756	0.9684665	507.1128	18645.8	3.47174E-22	18	1077.18	0.958038	427.6028	12045.76	7.864868E-17	25	690.3605	0.9573141	464.4286	12658.41	2.681598E-18	25	456.671	NID1	NID1_E20_F	4505394	NM_002508.1	NID1	4811	1	36.1	234303686	20	N	CTCTCTTTATAACCACAGTGTACTAATCGTACGTAGCAAACACAATTCTATTGTCTAAA	NID, enactin, ENTACTIN	Nidogen; nidogen (entactin); go_component: membrane; go_component: basement membrane; go_function: protein binding; go_function: calcium ion binding; go_function: extracellular matrix structural constituent; go_process: cell-matrix adhesion	nidogen (enactin)
NID1_P677_F	5082	0.8354363	407.9301	2578.596	0.1034705	31	115.7502	0.9611206	533.1501	15651.84	1.690889E-26	32	988.8173	0.972112	472.2708	19948.05	3.678E-38	26	1087.541	0.2918916	1222.273	545.0583	0.4856919	39	62.2827	0.9664544	405.6425	14567.66	2.325374E-24	30	624.374	0.9562901	558.452	14405.69	4.106514E-28	29	696.5723	0.9600955	506.3914	14589.68	1.629227E-19	26	737.764	0.9672468	546.7122	19098.32	2.215107E-23	20	1097.258	0.9405673	579.1183	10747.55	9.325606E-14	23	882.2775	0.9774088	388.1695	21120.68	3.678E-38	22	662.8997	NID1	NID1_P677_F	4505394	NM_002508.1	NID1	4811	1	36.1	234304383	-677	N	AACTCACGGGGTGTCCTTCTCAGCGCATCTCATCAGGAGATCCATGATGCCA	NID, enactin, ENTACTIN	Nidogen; nidogen (entactin); go_component: membrane; go_component: basement membrane; go_function: protein binding; go_function: calcium ion binding; go_function: extracellular matrix structural constituent; go_process: cell-matrix adhesion	nidogen (enactin)
NID1_P714_R	5078	0.6745025	561.6784	1371.143	0.373914	21	94.89284	0.9496377	696.8727	15025.94	5.957193E-25	21	1006.445	0.9502786	822.9293	17639.08	3.678E-38	27	1138.62	0.845649	421.7622	2858.6	0.1519245	28	133.6918	0.9562151	638.0084	16117.3	8.266397E-31	30	898.3576	0.9499723	744.451	16035.21	8.993431E-36	34	778.5371	0.9498671	730.0278	15726.54	2.281527E-23	23	790.398	0.9542227	880.3299	20434.86	1.093944E-27	37	743.2777	0.9291577	803.8777	11855.14	2.322316E-17	27	809.5107	0.9656797	643.9997	20934.11	3.678E-38	30	620.4131	NID1	NID1_P714_R	4505394	NM_002508.1	NID1	4811	1	36.1	234304420	-714	N	ATCAGGAGATCCATGATGCCACTGTGTCCCGTTACTGCTGCAGTTAATGTTGATTGAT	NID, enactin, ENTACTIN	Nidogen; nidogen (entactin); go_component: membrane; go_component: basement membrane; go_function: protein binding; go_function: calcium ion binding; go_function: extracellular matrix structural constituent; go_process: cell-matrix adhesion	nidogen (enactin)
NKX3-1_P146_F	1610	0.179191	4360.05	973.6744	0.000393895	34	151.6225	0.1093091	9255.156	1148.101	1.077615E-10	31	345.2419	0.1303032	9899.916	1498.247	6.049393E-14	28	526.9633	0.2059701	1644.549	452.5333	0.4004648	24	77.08916	0.08793132	8136.94	794.1124	1.971957E-08	26	405.5533	0.1224712	9131.743	1288.416	3.512067E-13	28	410.5768	0.1178018	9112.813	1230.206	5.771633E-09	23	411.4125	0.1427637	10792.97	1814.11	1.816599E-09	29	456.3604	0.1252754	8106.405	1175.297	4.056745E-09	28	322.1124	0.1462198	9772.778	1690.828	7.858544E-14	29	466.8924	NKX3-1	NKX3-1_P146_F	19923351	NM_006167.2	NKX3-1	4824	8	36.1	23596541	-146	Y	CGAGCCCTGAGCACTGCCCCGCTCCGCTCCTCCCTAGGGGATTC	NKX3A, NKX3.1	NK homeo box, family 3, subunit A, Drosophila, homolog of; NK3 transcription factor homolog A (Drosophila); NK homeobox (Drosophila), family 3, A; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	NK3 transcription factor related, locus 1
NKX3-1_P871_R	1617	0.2684253	2666.509	1015.072	0.02988975	23	197.6418	0.9564617	659.4143	16683.02	1.371147E-30	32	1107.667	0.956142	679.7383	16998.96	4.701544E-35	29	1248.225	0.1538222	617.15	130.3669	0.7366287	30	41.15074	0.9456136	700.9988	13926.93	3.340259E-23	24	1053.413	0.9598057	711.206	19370.92	3.678E-38	16	854.5924	0.9559025	622.6091	15664.01	7.244238E-23	28	1102.39	0.9615352	682.9421	19571.81	6.578103E-25	33	749.8477	0.9285589	639.3091	9609.213	3.544035E-11	25	624.8695	0.9608029	644.589	18251.45	3.678E-38	34	943.9663	NKX3-1	NKX3-1_P871_R	19923351	NM_006167.2	NKX3-1	4824	8	36.1	23597266	-871	N	GGACTGGACGGTACCGTGACAACAGACGAAAGTGGAACAGAGATGATGG	NKX3A, NKX3.1	NK homeo box, family 3, subunit A, Drosophila, homolog of; NK3 transcription factor homolog A (Drosophila); NK homeobox (Drosophila), family 3, A; go_component: nucleus; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription, DNA-dependent	NK3 transcription factor related, locus 1
NNAT_P544_R	1634	0.4290749	3213.88	2490.524	0.0001130653	37	146.9729	0.9079814	1475.868	15549.67	1.940986E-29	30	1140.565	0.9057584	2107.094	21212.44	3.678E-38	34	771.5403	0.312903	3318.146	1556.619	0.01904306	25	222.0132	0.8547323	1981.836	12249.2	6.555572E-22	28	575.4792	0.9087058	1630.743	17227.13	3.678E-38	23	955.0787	0.8613663	2211.93	14364.61	1.001186E-23	33	1120.406	0.9116864	2016.549	21849.75	5.173604E-35	21	865.9771	0.8733537	1447.903	10674.35	7.466885E-16	30	804.1696	0.8838343	2156.55	17168.72	3.678E-38	36	635.0379	NNAT	NNAT_P544_R	32307135	NM_181689.1	NNAT	4826	20	36.1	35582477	-544	Y	CCTACAGTAGCGACCTCCACCGCAGATTCTCATCTCCTCGCTACCGTAA	Peg5, MGC1439	isoform beta is encoded by transcript variant 2; go_function: auxiliary transport protein activity; go_process: development; go_process: brain development; go_process: protein-lipoylation	neuronatin isoform beta
NOS2A_E117_R	2838	0.4022026	3106.55	2157.391	0.0004925176	24	186.0927	0.8854074	1682.336	13771.35	4.498217E-24	27	1035.913	0.908294	1847.307	19286.93	3.678E-38	39	1040.848	0.30629	2967.395	1354.33	0.04352151	41	138.1187	0.9105061	1502.712	16305.9	5.350087E-35	32	1075.293	0.8840524	1900.927	15256.24	1.735599E-37	36	1166.679	0.922561	1269.029	16309.79	7.917739E-27	22	1539.451	0.9219152	1783.724	22240.37	1.702202E-35	26	860.2584	0.8850775	1287.49	10685.78	1.897638E-15	31	789.4033	0.9297343	1410.294	19983.75	3.678E-38	32	1103.207	NOS2A	NOS2A_E117_R	24041028	NM_000625.3	NOS2A	4843	17	36.1	23151565	117	N	GGAAGAGACCTGTGCCTTGAGAACTTCGGGACTGTCTAGAACTGCCCAGTCC	NOS, INOS, NOS2, HEP-NOS	isoform 1 is encoded by transcript variant 1; NOS, type II; nitric oxide synthase, macrophage; go_component: cytosol; go_function: FAD binding; go_function: FMN binding; go_function: NADP binding; go_function: heme binding; go_function: iron ion binding; go_function: zinc ion binding; go_function: calmodulin binding; go_function: calcium ion binding; go_function: oxidoreductase activity; go_function: electron transporter activity; go_function: nitric-oxide synthase activity; go_process: electron transport; go_process: inflammatory response; go_process: superoxide metabolism; go_process: nitric oxide biosynthesis; go_process: defense response to bacteria	nitric oxide synthase 2A isoform 1
NOS2A_P288_R	2161	0.4292654	1830.109	1451.689	0.06355774	35	101.2274	0.8308726	1685.315	8770.722	8.373727E-11	31	596.5962	0.8428484	1963.033	11064.63	1.94244E-18	27	587.0935	0.3187973	2224.482	1087.839	0.1470488	29	77.8603	0.8402412	1719.54	9569.756	1.461544E-13	21	595.5468	0.7923744	2206.582	8802.752	8.912232E-15	35	580.2186	0.8395165	1815.621	10020.94	8.563442E-12	29	415.5334	0.8428125	1891.251	10676.75	2.077477E-09	38	524.6799	0.7742979	1849.189	6686.923	1.076611E-07	35	449.9921	0.8683845	1833.837	12759.25	7.894183E-23	24	514.5886	NOS2A	NOS2A_P288_R	24041028	NM_000625.3	NOS2A	4843	17	36.1	23151970	-288	N	AGGGTGGCTGCTAAGATAGAGGCACCACGGAGCCAGGTTTTATTTGGCCAAGCC	NOS, INOS, NOS2, HEP-NOS	isoform 1 is encoded by transcript variant 1; NOS, type II; nitric oxide synthase, macrophage; go_component: cytosol; go_function: FAD binding; go_function: FMN binding; go_function: NADP binding; go_function: heme binding; go_function: iron ion binding; go_function: zinc ion binding; go_function: calmodulin binding; go_function: calcium ion binding; go_function: oxidoreductase activity; go_function: electron transporter activity; go_function: nitric-oxide synthase activity; go_process: electron transport; go_process: inflammatory response; go_process: superoxide metabolism; go_process: nitric oxide biosynthesis; go_process: defense response to bacteria	nitric oxide synthase 2A isoform 1
NOS3_P38_F	4201	0.3435336	4370.511	2339.45	2.266911E-06	35	191.5767	0.8690984	2130.547	14809.33	3.936895E-29	16	972.8512	0.8916188	2120.046	18263.63	3.678E-38	29	692.5518	0.3214062	3128.852	1529.299	0.02668859	30	216.6996	0.8730167	1711.655	12455.21	1.051697E-21	25	1407.326	0.842424	2577.529	14314.46	2.806451E-36	39	864.47	0.8731197	1985.261	14349.6	5.225835E-23	29	1448.609	0.8793172	2639.429	19959.97	2.914346E-31	36	813.743	0.8217825	2096.267	10127.25	3.931009E-16	35	936.0103	0.8890172	1666.723	14152.17	5.091665E-27	31	1253.186	NOS3	NOS3_P38_F	48762674	NM_000603.3	NOS3	4846	7	36.1	150319042	-38	N	TCAGAGCAGGTGACCAGTGGTGACTCAGTTCGGAGCAGGTGATAGAAGCTAGGAG	eNOS, ECNOS, NOS III	endothelial nitric oxide synthase; endothelial nitric oxidase synthase; go_component: cytoplasm; go_function: FAD binding; go_function: FMN binding; go_function: NADP binding; go_function: heme binding; go_function: iron ion binding; go_function: zinc ion binding; go_function: calmodulin binding; go_function: calcium ion binding; go_function: oxidoreductase activity; go_function: electron transporter activity; go_function: nitric-oxide synthase activity; go_function: nitric-oxide synthase activity; go_process: cell motility; go_process: electron transport; go_process: amino acid metabolism; go_process: nitric oxide biosynthesis	nitric oxide synthase 3 (endothelial cell)
NOTCH1_E452_R	958	0.2531324	662.7933	258.53	0.7194943	26	21.74035	0.137112	6010.023	970.8763	6.130674E-05	26	196.1756	0.1203822	6377.871	886.5449	1.318158E-05	27	215.7466	0.05615196	2396.154	148.5027	0.2926387	26	108.6214	0.1289694	5908.632	889.6702	5.642392E-05	15	233.8873	0.1557662	5070.438	953.9767	0.0001931791	37	232.9229	0.1618716	5617.225	1104.194	0.0006251921	29	238.7184	0.1439521	6363.137	1086.834	0.001473454	27	201.4903	0.1529334	5471.796	1005.959	0.000169902	28	238.2173	0.1653073	5664.272	1141.589	6.375913E-05	19	225.8695	NOTCH1	NOTCH1_E452_R	27894367	NM_017617.2	NOTCH1	4851	9	36.1	138559607	452	Y	GGCGAAGAAGAAAGAAGATAAATGGCCCGGAGAAGCAACAGGAAACCAAAACCGA	hN1, TAN1	Notch (Drosophila) homolog 1 (translocation-associated); translocation-associated notch protein TAN-1; neurogenic locus notch homolog protein 1; go_component: membrane; go_component: nucleus; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: calcium ion binding; go_function: protein binding; go_process: transcription; go_process: immune response; go_process: cell differentiation; go_process: Notch signaling pathway; go_process: regulation of development; go_process: Notch signaling pathway; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of myoblast differentiation	notch1 preproprotein
NOTCH1_P1198_F	4204	0.0405515	3711.814	161.1079	0.0200264	33	135.8998	0.1239575	8697.125	1244.768	9.182819E-10	32	501.3269	0.1145381	10844.97	1415.776	3.080699E-16	27	616.8783	0.2124898	3407.537	946.4203	0.04160591	31	188.2937	0.1094017	7997.312	994.679	1.512555E-08	44	569.112	0.1373529	8364.164	1347.686	2.138669E-11	20	820.9212	0.11236	8787.163	1124.962	3.12683E-08	21	445.763	0.179217	11023.19	2428.735	8.883245E-11	25	590.5355	0.175043	6253.796	1348.176	4.131013E-06	23	372.2471	0.1840546	8506.172	1941.313	1.966257E-11	28	566.6616	NOTCH1	NOTCH1_P1198_F	27894367	NM_017617.2	NOTCH1	4851	9	36.1	138561257	-1198	Y	CAAAATGCCTGCCATAGTCCCTGCGCAAAGTTCACGGCCTCGTGCCAGGG	hN1, TAN1	Notch (Drosophila) homolog 1 (translocation-associated); translocation-associated notch protein TAN-1; neurogenic locus notch homolog protein 1; go_component: membrane; go_component: nucleus; go_component: integral to membrane; go_component: integral to membrane; go_function: receptor activity; go_function: calcium ion binding; go_function: protein binding; go_process: transcription; go_process: immune response; go_process: cell differentiation; go_process: Notch signaling pathway; go_process: regulation of development; go_process: Notch signaling pathway; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of myoblast differentiation	notch1 preproprotein
NOTCH2_P312_R	4206	0.02271505	14010.91	327.9799	2.276893E-30	34	919.7992	0.03256486	17968.89	608.2174	2.696661E-35	22	2260.5	0.02304986	28162.52	666.8171	3.678E-38	21	1614.518	0.02510495	10667.15	277.2697	7.056103E-10	30	812.9083	0.02566286	24226.41	640.7282	3.678E-38	26	1524.581	0.02702473	24935.77	695.3772	3.678E-38	32	1157.431	0.01960715	28039.72	562.7741	3.678E-38	30	843.5472	0.02121822	30697.53	667.6348	3.678E-38	26	832.9809	0.04586831	11212.96	543.8518	7.186698E-15	23	1135.061	0.02158008	28895.42	639.5246	3.678E-38	29	635.1257	NOTCH2	NOTCH2_P312_R	24041034	NM_024408.2	NOTCH2	4853	1	36.1	120414111	-312	Y	TTCAAGCACTGGAGTTTGCCGGGATCGTGAACTTGCAGGGAGAGGCG	hN2	Notch (Drosophila) homolog 2; go_component: membrane; go_component: nucleus; go_component: cell surface; go_component: integral to plasma membrane; go_function: calcium ion binding; go_function: protein binding; go_function: receptor activity; go_function: protein heterodimerization activity; go_function: ligand-regulated transcription factor activity; go_process: transcription; go_process: cell growth; go_process: hemopoiesis; go_process: anti-apoptosis; go_process: cell differentiation; go_process: cell cycle arrest; go_process: Notch signaling pathway; go_process: organ morphogenesis; go_process: regulation of development; go_process: stem cell maintenance; go_process: induction of apoptosis; go_process: cell fate determination; go_process: nervous system development; go_process: negative regulation of cell proliferation; go_process: regulation of transcription, DNA-dependent; go_process: positive regulation of Ras protein signal transduction	notch 2 preproprotein
NOTCH3_E403_F	5672	0.56634	428.4911	690.1851	0.6573297	34	30.49489	0.2159209	6755.513	1887.881	2.099402E-07	32	296.3777	0.2083296	9264.453	2464.274	8.426895E-15	35	503.1049	0.06102371	4085.734	272.0292	0.04138432	33	200.0954	0.2350826	6234.036	1946.644	4.346791E-07	25	566.8937	0.2705977	6420.413	2418.979	2.13007E-09	20	535.2107	0.2471738	7432.979	2473.287	3.197628E-08	26	405.4436	0.2284877	9121.403	2730.97	2.227421E-08	33	484.612	0.2069551	5750.603	1526.789	1.302244E-05	26	490.8249	0.2791935	7777.07	3051.064	2.661637E-12	28	424.0069	NOTCH3	NOTCH3_E403_F	4557798	NM_000435.1	NOTCH3	4854	19	36.1	15172389	403	Y	TCCCTTCATCTTCAGCTCTAATCGCTCAAGGGTCCCTGTTCCTTGGGCC	CASIL, CADASIL	Notch (Drosophila) homolog 3; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: calcium ion binding; go_process: transcription; go_process: morphogenesis; go_process: cell differentiation; go_process: Notch signaling pathway; go_process: regulation of development; go_process: regulation of transcription, DNA-dependent	Notch homolog 3
NOTCH3_P198_R	5088	0.4109651	2169.106	1583.137	0.02585814	40	101.3026	0.350639	5319.799	2926.559	9.273777E-07	21	485.8252	0.3095719	5616.134	2562.981	4.466455E-07	32	281.4565	0.7287865	311.4776	1105.695	0.5768272	31	37.46705	0.3351317	5342.705	2743.435	6.27448E-07	22	229.892	0.3589649	4884.107	2790.985	4.499045E-07	43	205.6529	0.316922	5610.606	2649.502	9.322504E-06	24	279.6217	0.3837286	5256.946	3335.565	0.0001463208	24	335.2934	0.3505944	4899.012	2698.815	4.193665E-06	34	292.0164	0.1648046	5130.705	1032.147	0.0004172751	33	162.0997	NOTCH3	NOTCH3_P198_R	4557798	NM_000435.1	NOTCH3	4854	19	36.1	15172990	-198	Y	GAGCATGCAGTGAGACGCGGGCAGAACCCGGAGTGGCGGGCACACCCAACCT	CASIL, CADASIL	Notch (Drosophila) homolog 3; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: calcium ion binding; go_process: transcription; go_process: morphogenesis; go_process: cell differentiation; go_process: Notch signaling pathway; go_process: regulation of development; go_process: regulation of transcription, DNA-dependent	Notch homolog 3
NOTCH4_E4_F	913	0.1044003	3190.031	383.5198	0.03705043	38	172.0556	0.3795217	5290.53	3297.171	2.598592E-07	31	540.937	0.05198562	8694.891	482.2794	6.369248E-09	27	497.2196	0.09081086	1704.283	180.2139	0.4551271	29	49.03711	0.3372256	5668.305	2934.965	7.920371E-08	39	564.478	0.5301048	4876.716	5614.401	2.284282E-13	30	479.9344	0.3835661	6475.337	4091.398	2.321745E-09	32	357.684	0.5183267	5725.379	6268.667	1.410496E-08	25	629.2727	0.6485031	2405.036	4621.729	3.030817E-05	26	434.3452	0.6395836	4160.384	7560.344	1.769744E-14	22	747.7178	NOTCH4	NOTCH4_E4_F	55770875	NM_004557.3	NOTCH4	4855	6	36.1	32299818	4	N	CCTCGGCCTGCTGCAAGCCTCACGTCTGAGCTGTTTCCTGAGTCACACAATGTC	INT3, NOTCH3, MGC74442	Notch (Drosophila) homolog 4; go_component: membrane; go_component: nucleus; go_component: cell surface; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: calcium ion binding; go_function: protein binding; go_function: receptor activity; go_function: calcium ion binding; go_function: protein heterodimerization activity; go_process: transcription; go_process: hemopoiesis; go_process: cell differentiation; go_process: embryonic development; go_process: Notch signaling pathway; go_process: Notch signaling pathway; go_process: cell differentiation; go_process: regulation of development; go_process: cell fate determination; go_process: patterning of blood vessels; go_process: mammary gland development; go_process: negative regulation of endothelial cell differentiation; go_process: positive regulation of transcription, DNA-dependent	notch4 preproprotein
NOTCH4_P938_F	4208	0.3517995	1328.322	775.1971	0.3177976	36	53.89713	0.7071426	3288.684	8182.422	4.923028E-13	23	741.0433	0.6998246	3701.994	8863.915	4.27926E-17	37	464.0192	0.0744276	1669.617	142.2993	0.4740414	30	73.07291	0.731564	2818.488	7953.708	2.559939E-12	27	585.4355	0.6395965	3727.805	6793.081	1.905202E-13	32	852.6445	0.6859134	3850.869	8628.049	3.796923E-13	25	571.0886	0.6514355	4939.601	9418.557	2.717098E-12	23	573.5968	0.6685992	2827.193	5905.596	4.680119E-08	31	354.9382	0.7263621	3119.444	8545.899	2.447688E-14	22	736.4368	NOTCH4	NOTCH4_P938_F	55770875	NM_004557.3	NOTCH4	4855	6	36.1	32300760	-938	N	CCTGAGAGCCTTCCCCTACCGGGGAATATACTTCACCAGCACCACTTT	INT3, NOTCH3, MGC74442	Notch (Drosophila) homolog 4; go_component: membrane; go_component: nucleus; go_component: cell surface; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: calcium ion binding; go_function: protein binding; go_function: receptor activity; go_function: calcium ion binding; go_function: protein heterodimerization activity; go_process: transcription; go_process: hemopoiesis; go_process: cell differentiation; go_process: embryonic development; go_process: Notch signaling pathway; go_process: Notch signaling pathway; go_process: cell differentiation; go_process: regulation of development; go_process: cell fate determination; go_process: patterning of blood vessels; go_process: mammary gland development; go_process: negative regulation of endothelial cell differentiation; go_process: positive regulation of transcription, DNA-dependent	notch4 preproprotein
NPR2_P1093_F	2418	0.2790247	4786.851	1891.26	2.59626E-06	29	204.7618	0.9420487	860.947	15621.02	1.614478E-27	41	810.3405	0.9267275	1442.008	19502.83	3.678E-38	35	957.1573	0.427604	4110.314	3145.283	0.0001387955	36	217.1034	0.9380295	922.9331	15483.84	1.744717E-29	32	871.9726	0.9389943	971.0068	16484.85	3.678E-38	28	1023.965	0.9372439	1010.117	16579.29	7.323932E-27	30	1006.92	0.9431811	1227.637	22038.47	3.299981E-33	32	928.0358	0.9133438	955.3353	11123.08	9.83873E-16	26	666.1978	0.9296715	1174.529	16847.97	1.690677E-35	29	742.353	NPR2	NPR2_P1093_F	73915098	NM_003995.3	NPR2	4882	9	36.1	35781313	-1093	Y	AGGACAAACCCTGGGGTCGCTGGCGTGTGTGAGATGGAAATGGA	AMDM, NPRB, ANPRB, GUC2B, NPRBi, GUCY2B	guanylate cyclase B; atrial natriuretic peptide B-type receptor; atrionatriuretic peptide receptor B; go_component: plasma membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: protein kinase activity; go_function: guanylate cyclase activity; go_function: phosphorus-oxygen lyase activity; go_function: transmembrane receptor activity; go_function: peptide receptor activity, G-protein coupled; go_process: cGMP biosynthesis; go_process: blood pressure regulation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction	natriuretic peptide receptor B precursor
NPR2_P618_F	2439	0.3269563	3557.424	1776.731	0.0003933476	23	247.4068	0.5211018	3349.902	3753.93	4.230096E-05	35	304.8724	0.2604546	6213.435	2223.478	1.575576E-07	17	503.3892	0.2125024	2793.437	780.7798	0.1110538	23	163.5222	0.3831328	3809.718	2428.304	0.0002991947	32	291.5601	0.3879654	4173.421	2708.899	1.032621E-05	28	292.5224	0.324413	4905.51	2403.617	0.0001419892	32	276.5835	0.4105542	5184.954	3681.017	7.93842E-05	32	285.0352	0.2936355	4484.932	1905.954	0.0002196674	28	238.4795	0.2382684	5501.568	1752.162	1.5059E-05	19	240.6458	NPR2	NPR2_P618_F	73915098	NM_003995.3	NPR2	4882	9	36.1	35781788	-618	Y	CGCCGTAGCTCCGGATGGGACCAGCGCCCGGGCCCGTTAGTCCAAGCAGG	AMDM, NPRB, ANPRB, GUC2B, NPRBi, GUCY2B	guanylate cyclase B; atrial natriuretic peptide B-type receptor; atrionatriuretic peptide receptor B; go_component: plasma membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: protein kinase activity; go_function: guanylate cyclase activity; go_function: phosphorus-oxygen lyase activity; go_function: transmembrane receptor activity; go_function: peptide receptor activity, G-protein coupled; go_process: cGMP biosynthesis; go_process: blood pressure regulation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction	natriuretic peptide receptor B precursor
NPY_E31_R	3730	0.03147789	6403.678	211.3758	3.388371E-06	20	129.2365	0.1219857	9098.292	1277.952	1.225417E-10	34	762.8628	0.1054413	13027.33	1547.314	2.431931E-23	30	843.215	0.03741549	4346.579	172.8377	0.03282062	31	182.5341	0.128473	12594.77	1871.354	1.136687E-22	32	692.7137	0.1720321	12200.47	2555.746	2.684317E-27	26	1051.076	0.1621678	12415.73	2422.5	7.949773E-19	31	945.3557	0.1844449	12464.65	2841.606	5.358822E-14	28	913.8892	0.201447	7239.748	1851.562	9.667157E-09	34	626.8613	0.08026799	15535.12	1364.528	5.016973E-31	21	1167.421	NPY	NPY_E31_R	31542152	NM_000905.2	NPY	4852	7	36.1	24290365	31	Y	TGGCTCTCACCCCTCGGAGACGCTCGCCCGACAGCATAGTACTTGCCG	PYY4	go_component: cell; go_component: extracellular region; go_function: neuropeptide hormone activity; go_function: calcium channel regulator activity; go_function: G-protein coupled receptor activity; go_process: digestion; go_process: circulation; go_process: cell motility; go_process: feeding behavior; go_process: cell proliferation; go_process: calcium ion transport; go_process: synaptic transmission; go_process: neuropeptide signaling pathway; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	neuropeptide Y
NPY_P295_F	1644	0.1455202	3153.096	554.0108	0.02837705	21	202.9364	0.06951018	10227.82	771.5172	5.731794E-12	29	901.3101	0.06475832	11281.42	788.0761	1.031949E-15	29	473.0352	0.06908664	4471.164	339.2435	0.02109119	26	215.2468	0.117517	9547.679	1284.746	1.848576E-12	27	495.011	0.1233916	11851.02	1682.228	9.285419E-23	29	689.3303	0.06068875	10737.12	700.1846	5.398382E-11	36	577.7589	0.06910983	11768.49	881.1232	1.568966E-09	34	474.563	0.1264789	8261.797	1210.721	1.662989E-09	34	459.5483	0.04849106	13071.38	671.2432	3.837613E-20	21	748.1088	NPY	NPY_P295_F	31542152	NM_000905.2	NPY	4852	7	36.1	24290039	-295	Y	GAAGGAAAGAAGGAAAGCAGGGATCGGGCACTGCCCGAGGGCAGATACT	PYY4	go_component: cell; go_component: extracellular region; go_function: neuropeptide hormone activity; go_function: calcium channel regulator activity; go_function: G-protein coupled receptor activity; go_process: digestion; go_process: circulation; go_process: cell motility; go_process: feeding behavior; go_process: cell proliferation; go_process: calcium ion transport; go_process: synaptic transmission; go_process: neuropeptide signaling pathway; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	neuropeptide Y
NPY_P91_F	1640	0.1367745	6056.345	975.4469	5.510412E-07	28	298.0505	0.08721508	10909.2	1051.911	3.395855E-14	30	745.2505	0.07522229	12652.71	1037.317	1.842223E-20	30	676.1914	0.08795118	5187.837	509.9195	0.004478483	26	219.3103	0.08077365	10987.59	974.2816	2.802333E-15	25	515.876	0.08076485	11909.64	1055.178	8.475023E-21	32	766.4573	0.0767488	13060.09	1093.983	4.593305E-17	21	751.2149	0.100756	14337.23	1617.623	3.10066E-15	31	736.2321	0.09391022	10145.88	1061.917	1.857162E-13	24	875.5898	0.06743085	12541.6	914.0701	2.817566E-19	26	439.0882	NPY	NPY_P91_F	31542152	NM_000905.2	NPY	4852	7	36.1	24290243	-91	Y	CGCCACTCAGGGGCGGGAAGTGGCGGGTGGGAGTCACCCAAGCGT	PYY4	go_component: cell; go_component: extracellular region; go_function: neuropeptide hormone activity; go_function: calcium channel regulator activity; go_function: G-protein coupled receptor activity; go_process: digestion; go_process: circulation; go_process: cell motility; go_process: feeding behavior; go_process: cell proliferation; go_process: calcium ion transport; go_process: synaptic transmission; go_process: neuropeptide signaling pathway; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	neuropeptide Y
NQO1_E74_R	974	0.08280351	2041.581	193.3396	0.2772091	28	62.30807	0.05805474	7087.32	442.9748	1.099558E-05	24	287.9243	0.04850442	7776.895	401.5407	4.478526E-07	28	367.1483	0.5560948	2347.212	3065.703	0.00761468	20	131.5489	0.07221355	5592.97	443.1079	0.0005231406	37	237.8954	0.05541773	6461.862	384.9781	1.176697E-05	28	254.1634	0.06309313	6051.716	414.2686	0.001135672	31	288.7874	0.06400115	6331.697	439.7826	0.00482544	24	399.4338	0.07763711	4814.837	413.6915	0.004525916	22	262.8907	0.06648441	8495.739	612.1833	1.163539E-08	34	279.4637	NQO1	NQO1_E74_R	70995421	NM_001025434.1	NQO1	1728	16	36.1	68317960	74	Y	CGGCTGCAACCTTGTGGGAGTCGCGTGTGTAGTGCACGGTGCATTCTCT	DTD, QR1, DHQU, DIA4, NMOR1, NMORI	isoform c is encoded by transcript variant 3; diaphorase (NADH/NADPH) (cytochrome b-5 reductase); quinone reductase 1; DT-diaphorase; azoreductase; phylloquinone reductase; menadione reductase; diaphorase-4; NAD(P)H:quinone oxireductase; NAD(P)H:Quinone acceptor oxidoreductase type 1; NAD(P)H:menadione oxidoreductase 1; dioxin-inducible 1; go_component: cytoplasm; go_function: oxidoreductase activity; go_function: cytochrome-b5 reductase activity; go_function: NAD(P)H dehydrogenase (quinone) activity; go_function: NAD(P)H dehydrogenase (quinone) activity; go_process: electron transport; go_process: response to toxin; go_process: xenobiotic metabolism; go_process: nitric oxide biosynthesis; go_process: synaptic transmission, cholinergic	NAD(P)H menadione oxidoreductase 1, dioxin-inducible isoform c
NQO1_P345_R	4893	0.04173401	4513.613	200.9302	0.002520438	27	298.9956	0.1109812	13877.6	1744.901	1.271313E-24	23	1406.515	0.1021927	15865.27	1817.242	4.532304E-35	36	700.7676	0.02425538	5864.588	148.2697	0.002398564	27	339.3576	0.1084943	12279.29	1506.533	1.658137E-20	25	863.9569	0.1271065	12790.31	1877.023	5.936587E-27	34	839.8659	0.09336413	12287.25	1275.622	1.284808E-15	26	922.8201	0.08627899	15518.66	1474.807	2.448569E-17	33	691.4261	0.1424881	8872.239	1490.869	1.947881E-11	24	855.7189	0.09320805	16712.39	1728.126	3.036216E-37	28	1265.201	NQO1	NQO1_P345_R	70995421	NM_001025434.1	NQO1	1728	16	36.1	68318379	-345	N	AAATGGAGCAGAAAAAGAGCCGGATGCGGATTACTGTGGTGCCCTAGGCT	DTD, QR1, DHQU, DIA4, NMOR1, NMORI	isoform c is encoded by transcript variant 3; diaphorase (NADH/NADPH) (cytochrome b-5 reductase); quinone reductase 1; DT-diaphorase; azoreductase; phylloquinone reductase; menadione reductase; diaphorase-4; NAD(P)H:quinone oxireductase; NAD(P)H:Quinone acceptor oxidoreductase type 1; NAD(P)H:menadione oxidoreductase 1; dioxin-inducible 1; go_component: cytoplasm; go_function: oxidoreductase activity; go_function: cytochrome-b5 reductase activity; go_function: NAD(P)H dehydrogenase (quinone) activity; go_function: NAD(P)H dehydrogenase (quinone) activity; go_process: electron transport; go_process: response to toxin; go_process: xenobiotic metabolism; go_process: nitric oxide biosynthesis; go_process: synaptic transmission, cholinergic	NAD(P)H menadione oxidoreductase 1, dioxin-inducible isoform c
NR2F6_E375_R	2843	0.04198709	6872.42	305.5821	2.822972E-07	19	395.9904	0.1612162	7218.521	1406.637	2.251685E-07	30	520.0834	0.1549179	9086.071	1683.963	2.141374E-12	31	492.0143	0.06916688	4454.874	338.4564	0.02166492	40	217.1009	0.1492124	7377.59	1311.431	5.537761E-08	23	528.3082	0.182039	7850.635	1769.431	3.554142E-11	33	355.866	0.1336497	8810.845	1374.653	1.080971E-08	22	723.5712	0.1167479	11362.15	1515.062	7.092305E-10	32	402.1459	0.1504324	5783.002	1041.699	5.832566E-05	25	589.0781	0.135758	8666.609	1377.088	1.498988E-10	34	302.9469	NR2F6	NR2F6_E375_R	46411186	NM_005234.3	NR2F6	2063	19	36.1	17216776	375	Y	CGGCAGGTGTAGCTGAGGTTGCGGCGGATGCTTCGCTTGAAAAAGCTC	EAR2, EAR-2, ERBAL2	ERBA-related gene-2; v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 2; go_component: nucleus; go_function: metal ion binding; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: thyroid hormone receptor activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	nuclear receptor subfamily 2, group F, member 6
NRAS_P103_R	4900	0.06154008	1818.592	125.8128	0.3700038	40	62.4727	0.044908	6440.555	307.534	0.0001212082	24	316.8195	0.03417156	7033.983	252.4043	1.22216E-05	29	252.02	0.3572234	2063.271	1202.239	0.1542265	25	116.597	0.05324632	6425.638	367.0081	5.743211E-05	21	470.6758	0.05670754	7119.189	433.9932	7.482427E-07	37	346.6653	0.04661577	6110.568	303.666	0.001277221	27	361.5007	0.04440495	7508.768	353.5671	0.0006699719	28	368.3957	0.08925609	4876.259	487.6908	0.003308283	28	266.9454	0.05494856	6331.103	373.9266	8.689748E-05	31	235.0634	NRAS	NRAS_P103_R	6006027	NM_002524.2	NRAS	4893	1	36.1	115061141	-103	Y	AACAGAAAACTGGAGAAAGCAAAAATGTTTCGTGTTTACAAAGATAAACGGCCTCTTT	N-ras, NRAS1	v-ras neuroblastoma RAS viral oncogene homolog; N-ras protein part 4; go_component: membrane; go_component: Golgi stack; go_function: GTP binding; go_function: GTPase activity; go_function: nucleotide binding; go_process: small GTPase mediated signal transduction; go_process: regulation of progression through cell cycle	neuroblastoma RAS viral (v-ras) oncogene homolog
NRAS_P12_R	4215	0.154847	1650.833	320.7837	0.3608706	37	59.81284	0.1373827	4593.439	747.4897	0.004165689	30	227.4213	0.1718784	4374.639	928.7208	0.003699781	35	161.4963	0.03920108	2977.92	125.5807	0.180827	22	207.7633	0.1553788	3957.628	746.4522	0.01196574	31	199.7295	0.1682022	4396.037	909.1674	0.001562109	19	225.179	0.1552665	4285.113	806.0069	0.01738994	37	188.6496	0.1656901	4792.306	971.5892	0.02189219	32	146.9945	0.1479065	4288.855	761.8182	0.006725796	34	168.5382	0.183622	4595.467	1056.118	0.00158195	36	179.1075	NRAS	NRAS_P12_R	6006027	NM_002524.2	NRAS	4893	1	36.1	115061050	-12	Y	TCCCACACGGGACGTTTCAATAATGAAAGCGCTAGGTGCTAGTGTCTCAAAAATCAGT	N-ras, NRAS1	v-ras neuroblastoma RAS viral oncogene homolog; N-ras protein part 4; go_component: membrane; go_component: Golgi stack; go_function: GTP binding; go_function: GTPase activity; go_function: nucleotide binding; go_process: small GTPase mediated signal transduction; go_process: regulation of progression through cell cycle	neuroblastoma RAS viral (v-ras) oncogene homolog
NRG1_E74_F	5678	0.08687388	4686.256	455.3595	0.000722298	25	179.6988	0.1003337	8408.651	948.9119	1.180136E-08	29	276.0875	0.08530737	10408.22	980.0323	6.411399E-14	29	477.0013	0.1155125	3927.663	526.0059	0.03610878	23	131.6305	0.09562576	8844.015	945.7126	3.86377E-10	31	555.3181	0.1533569	8816.229	1615.043	3.284006E-13	34	521.8247	0.09951737	8981.473	1003.644	2.362564E-08	33	509.1278	0.1097054	12303.99	1528.465	2.12008E-11	30	495.0414	0.1098252	8242.136	1029.21	4.255287E-09	32	407.7137	0.07672761	10280.13	862.6302	4.788874E-13	28	505.5963	NRG1	NRG1_E74_F	7669515	NM_013958.1	NRG1	3084	8	36.1	32525369	74	Y	GAAAAAGAGCCGGCGAGGAGTTCCCCGAAACTTGTTGGAACTCCGG	GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF	isoform HRG-beta3 is encoded by transcript variant HRG-beta3; heregulin, alpha (45kD, ERBB2 p185-activator); glial growth factor; neu differentiation factor; sensory and motor neuron derived factor; go_component: membrane; go_component: membrane; go_component: integral to membrane; go_component: extracellular region; go_component: extracellular region; go_component: extracellular region; go_function: receptor binding; go_function: growth factor activity; go_function: growth factor activity; go_function: transcription cofactor activity; go_function: receptor tyrosine kinase binding; go_function: receptor tyrosine kinase binding; go_function: transmembrane receptor protein tyrosine kinase activator activity; go_function: transmembrane receptor protein tyrosine kinase activator activity; go_process: embryonic development; go_process: cell differentiation; go_process: nervous system development; go_process: negative regulation of transcription	neuregulin 1 isoform HRG-beta3
NRG1_P558_R	5093	0.05930341	5841.827	374.5847	1.700367E-05	28	273.8168	0.14758	11103.8	1939.722	5.890959E-17	23	702.4564	0.1433425	13123.52	2212.661	5.550492E-26	25	835.9468	0.03407282	5540.17	198.9555	0.004135228	24	222.6428	0.1613017	11336.35	2199.482	9.673512E-20	43	778.9547	0.2439926	12310.48	4005.337	1.007098E-33	28	744.2786	0.1628519	12074.24	2368.276	8.52745E-18	30	1187.136	0.135562	16555.86	2611.99	3.197192E-22	27	879.0867	0.19242	9040.146	2177.799	1.751632E-13	31	574.3184	0.1264859	15750.52	2295.175	1.356218E-35	29	862.8388	NRG1	NRG1_P558_R	7669515	NM_013958.1	NRG1	3084	8	36.1	32524737	-558	Y	AGCGCAACCTAGCATCTTTAAGGTTCGCTTAGCCCTTCCTGTGCACCTGGAAGG	GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF	isoform HRG-beta3 is encoded by transcript variant HRG-beta3; heregulin, alpha (45kD, ERBB2 p185-activator); glial growth factor; neu differentiation factor; sensory and motor neuron derived factor; go_component: membrane; go_component: membrane; go_component: integral to membrane; go_component: extracellular region; go_component: extracellular region; go_component: extracellular region; go_function: receptor binding; go_function: growth factor activity; go_function: growth factor activity; go_function: transcription cofactor activity; go_function: receptor tyrosine kinase binding; go_function: receptor tyrosine kinase binding; go_function: transmembrane receptor protein tyrosine kinase activator activity; go_function: transmembrane receptor protein tyrosine kinase activator activity; go_process: embryonic development; go_process: cell differentiation; go_process: nervous system development; go_process: negative regulation of transcription	neuregulin 1 isoform HRG-beta3
NTRK1_E74_F	989	0.8891832	773.5336	7009.145	1.490645E-08	28	305.1393	0.6201348	541.3526	1047.016	0.545147	34	90.63214	0.9654547	667.7195	21455.84	3.678E-38	37	1557.346	0.8903059	449.5882	4460.604	0.01798962	28	189.469	0.9492034	603.6094	13147.9	2.116815E-20	34	511.2456	0.9178335	1096.351	13363.73	3.70017E-26	28	1084.994	0.9610413	696.0729	19637.68	2.124791E-36	33	1295.141	0.9674858	803.5322	26885.34	3.678E-38	30	960.3372	0.9120556	945.2608	10840.21	6.034559E-15	38	494.5106	0.6493443	447.0219	1012.975	0.5963733	29	51.93442	NTRK1	NTRK1_E74_F	56118209	NM_001007792.1	NTRK1	4914	1	36.1	155052240	74	N	GAGCAGTAAGGGAGTGAGTGGGCAACTCGGCGCATGAAGGAGGTACTCCTC	MTC, TRK, TRK1, TRKA, p140-TrkA	isoform 3 is encoded by transcript variant 3; Oncogene TRK; tyrosine kinase receptor; tyrosine kinase receptor A; high affinity nerve growth factor receptor; go_component: membrane; go_component: cytoplasm; go_component: integral to membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: neurotrophin binding; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell differentiation; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	neurotrophic tyrosine kinase, receptor, type 1 isoform 3
NTRK2_P10_F	4909	0.0433714	3800.119	176.8227	0.01593451	29	126.4218	0.06936812	7807.94	589.4479	5.321439E-07	28	493.816	0.0563507	9757.973	588.676	2.077123E-11	31	406.892	0.224502	4075.003	1208.638	0.009587977	29	317.8434	0.05848593	7819.585	491.9569	2.593524E-07	31	343.9926	0.131646	8277.266	1270.028	5.295422E-11	37	257.337	0.08067083	8614.731	764.7148	2.246747E-07	25	322.8199	0.07034039	8842.405	676.605	1.680053E-05	25	408.0273	0.07503353	7625.069	626.6597	3.449545E-07	33	284.9042	0.07891645	9284.98	804.0849	1.198638E-10	36	297.1462	NTRK2	NTRK2_P10_F	89029866	XM_933004.1	LOC653648	653648	9	36.1	86473276	-271	Y	TGACTGCGGAAAAACAGATTCCGAGCCGCAAAAGGGAAGACGGATTCTCAG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_938097
NTRK2_P395_R	4919	0.07962767	1760.68	160.9801	0.3776941	31	73.572	0.04937627	8350.385	438.9207	1.191401E-07	30	426.1681	0.05394411	9401.141	541.7551	1.642737E-10	24	452.4627	0.05059996	2350.509	130.6042	0.307125	24	108.7241	0.0622347	7192.778	483.9845	2.901064E-06	32	746.2633	0.09956312	7894.731	883.9935	2.878464E-09	28	725.9125	0.05309256	8309.998	471.5438	1.76341E-06	26	596.0759	0.07963681	9966.651	871.0431	4.891039E-07	33	299.4003	0.08798041	6124.843	600.4962	7.978323E-05	28	331.6872	0.05507876	10391.27	611.5286	1.034252E-12	19	775.2145	NTRK2	NTRK2_P395_R	89029866	XM_933004.1	LOC653648	653648	9	36.1	86472891	-656	Y	TCCGAGCATTCACTCTAACGTTCGGTTTCTTGATCCTTCCCATCCC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_938097
NTRK3_E131_F	991	0.05658564	2812.421	174.6859	0.1033773	38	134.6229	0.0352253	10231.04	377.2011	4.01284E-11	28	588.6116	0.03615714	11003.7	416.5388	5.31413E-14	26	544.7235	0.04673061	4974.154	248.7422	0.01066046	27	215.4673	0.0405797	9188.848	392.8817	1.041094E-09	27	809.8552	0.03835066	10630.6	427.9371	6.488946E-15	24	945.6904	0.04566918	10426.84	503.7584	5.027791E-10	21	742.7953	0.03971046	12847.45	535.4105	1.146535E-10	33	533.0335	0.06281937	6722.709	457.3273	1.815836E-05	35	389.6022	0.03614023	9765.691	369.9172	9.517769E-11	32	323.3857	NTRK3	NTRK3_E131_F	59889559	NM_002530.2	NTRK3	4916	15	36.1	86600534	131	Y	CCTCTGCCTTTGAAACGCCGAGCGATCAGATGCAAAATCCTTCAGCGTCTG	TRKC, gp145(trkC)	isoform b precursor is encoded by transcript variant 2; tyrosine kinase receptor C; neurotrophin 3 receptor; NT-3 growth factor receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein kinase activity; go_function: neurotrophin binding; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell differentiation; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	neurotrophic tyrosine kinase, receptor, type 3 isoform b precursor
NTRK3_P636_R	4224	0.4251252	4804.061	3626.597	4.657227E-10	31	314.4449	0.08229705	7493.498	680.9638	1.203057E-06	18	410.9625	0.0406758	9033.79	387.277	2.062526E-09	31	413.046	0.436224	2127.636	1723.643	0.08035947	25	108.6211	0.03990619	7333.344	308.9661	3.285867E-06	28	347.8815	0.07054675	8023.865	616.6122	5.664804E-09	39	330.6257	0.05095584	8182.156	444.6834	2.927222E-06	24	455.2359	0.07906815	8205.41	713.0749	7.040439E-05	32	321.8268	0.09410054	7398.826	778.9425	4.633482E-07	20	353.8326	0.04015506	8880.837	375.7128	6.02531E-09	31	346.0762	NTRK3	NTRK3_P636_R	59889559	NM_002530.2	NTRK3	4916	15	36.1	86601301	-636	Y	CGCTAGCCGCAGCCCGGGGGAAACCGAGACCGAAGGGAAAAAGTTGCA	TRKC, gp145(trkC)	isoform b precursor is encoded by transcript variant 2; tyrosine kinase receptor C; neurotrophin 3 receptor; NT-3 growth factor receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein kinase activity; go_function: neurotrophin binding; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell differentiation; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	neurotrophic tyrosine kinase, receptor, type 3 isoform b precursor
NTRK3_P752_F	4957	0.1078695	2255.73	284.8366	0.193803	26	101.6495	0.1260357	7816.929	1141.712	6.088173E-08	32	414.295	0.09008373	9710.271	971.2386	3.473968E-12	20	583.0908	0.3635084	278.8192	216.3485	0.7877077	37	21.88643	0.08426595	7917.794	737.7983	6.369908E-08	38	364.2289	0.1476751	8706.707	1525.863	1.077412E-12	28	516.6777	0.1522857	7926.835	1441.962	2.334025E-07	42	341.0121	0.1106999	9649.596	1213.628	4.543136E-07	30	500.9012	0.1108171	6852.004	866.4144	2.695761E-06	31	408.84	0.1036677	8115.985	950.2418	1.396325E-08	29	303.5982	NTRK3	NTRK3_P752_F	59889559	NM_002530.2	NTRK3	4916	15	36.1	86601417	-752	Y	CCTTTCCACTTTTTGGCCCTCGCGCTACCCGGTTTTGCTGCAATCCGGA	TRKC, gp145(trkC)	isoform b precursor is encoded by transcript variant 2; tyrosine kinase receptor C; neurotrophin 3 receptor; NT-3 growth factor receptor; go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein kinase activity; go_function: neurotrophin binding; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell differentiation; go_process: nervous system development; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	neurotrophic tyrosine kinase, receptor, type 3 isoform b precursor
NTSR1_E109_F	3041	0.04616688	5969.067	293.7515	1.418063E-05	26	218.8856	0.06977795	10413.44	788.6353	2.02499E-12	41	343.9128	0.05761652	13295.08	818.9639	8.138296E-22	21	761.3997	0.04020799	5711.531	243.459	0.002697942	25	310.3777	0.05925417	11053.36	702.5098	9.672397E-15	28	566.6932	0.05639213	12202.77	735.2412	1.04294E-20	24	744.1809	0.08368415	10447.31	963.2513	6.091102E-11	26	635.3467	0.07481408	13124.3	1069.368	5.216117E-12	32	599.8179	0.07341152	8203.77	657.8889	2.678146E-08	25	585.0359	0.07830239	10663.43	914.4025	4.07131E-14	25	431.5201	NTSR1	NTSR1_E109_F	4505476	NM_002531.1	NTSR1	4923	20	36.1	60810743	109	Y	TGGAACCCGTGGCAAGCGCCGAGCCGGGAGACAGCCCGAGGAACCACG	NTR	go_component: Golgi apparatus; go_component: endoplasmic reticulum; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: neurotensin receptor activity, G-protein coupled; go_process: signal transduction; go_process: synaptic transmission; go_process: G-protein coupled receptor protein signaling pathway	neurotensin receptor 1
NTSR1_P318_F	2450	0.4026455	2861.031	1995.876	0.001686774	36	146.7197	0.09290103	6708.79	697.3259	1.64355E-05	27	400.5262	0.08248624	8006.042	728.7487	4.503374E-08	32	446.689	0.2716989	3994.261	1527.399	0.006241302	26	355.1954	0.1110048	6431.447	815.5524	1.307893E-05	32	441.2586	0.1588649	6065.196	1164.419	2.753138E-06	26	473.1975	0.08624534	7254.466	694.1561	2.378134E-05	27	522.131	0.08160954	8855.471	795.7964	1.207283E-05	24	389.8716	0.09986901	4675.19	529.8046	0.004774269	35	396.7924	0.08109523	6311.005	565.7844	5.110904E-05	28	283.0923	NTSR1	NTSR1_P318_F	4505476	NM_002531.1	NTSR1	4923	20	36.1	60810316	-318	Y	AAGGGTCTGGTGCACGATACCCGCCGCGCCCGCTCGGAATCCTGGTTC	NTR	go_component: Golgi apparatus; go_component: endoplasmic reticulum; go_component: integral to plasma membrane; go_function: receptor activity; go_function: rhodopsin-like receptor activity; go_function: neurotensin receptor activity, G-protein coupled; go_process: signal transduction; go_process: synaptic transmission; go_process: G-protein coupled receptor protein signaling pathway	neurotensin receptor 1
OAT_P465_F	1647	0.09962802	5675.287	639.0474	1.157005E-05	29	206.561	0.1660735	10253.21	2061.804	4.549207E-15	21	642.6925	0.1597303	11818.34	2265.607	1.019149E-21	20	848.7944	0.3749229	3471.989	2142.489	0.005247576	23	275.3058	0.1482948	9937.245	1747.636	1.473925E-14	23	525.0065	0.1753808	11526.25	2472.681	1.955239E-24	25	624.069	0.1995922	11344	2853.712	3.569044E-17	23	555.6083	0.1692866	13298.91	2730.49	2.215645E-15	19	855.8752	0.2156614	9588.523	2663.952	3.268519E-16	32	510.9932	0.1651758	12816.37	2555.593	1.897673E-25	24	614.7923	OAT	OAT_P465_F	4557808	NM_000274.1	OAT	4942	10	36.1	126097906	-465	Y	CTCTGCCCCAGCCACAGCTGCGGGAGCCCCATGCCCTTGAACCC	HOGA, DKFZp781A11155	go_component: mitochondrial matrix; go_function: transferase activity; go_function: pyridoxal phosphate binding; go_function: ornithine-oxo-acid transaminase activity; go_process: ornithine metabolism; go_process: amino acid metabolism; go_process: visual perception	ornithine aminotransferase precursor
ODC1_P424_F	5104	0.09343215	5368.784	563.6205	4.98414E-05	30	255.6936	0.1202925	8834.725	1221.748	5.450203E-10	32	583.8712	0.1297396	11396.88	1713.97	1.097792E-18	27	918.956	0.05775134	2935.889	186.0726	0.1776585	29	117.8844	0.1273187	8948.965	1320.187	3.579581E-11	33	470.8158	0.138807	8650.928	1410.473	2.935375E-12	26	580.2037	0.1489808	9155.904	1620.354	9.692157E-10	33	535.3693	0.1273605	13730.64	2018.562	7.765037E-15	17	1181.394	0.1579776	7478.952	1421.939	2.255221E-08	25	357.6183	0.1381852	9802.639	1587.81	1.192765E-13	28	508.4634	ODC1	ODC1_P424_F	4505488	NM_002539.1	ODC1	4953	2	36.1	10506328	-424	Y	AGCTGCACAGCTGTGCTTCCACCTGGCGTTCAGTACCTCGTGCCCGAGAGCG	.	go_component: cellular component unknown; go_function: lyase activity; go_function: ornithine decarboxylase activity; go_process: polyamine biosynthesis	ornithine decarboxylase 1
OGG1_E400_F	936	0.4382038	3363.107	2701.241	3.04732E-05	26	139.9021	0.8318124	2955.453	15111.48	2.620337E-33	30	1373.654	0.8261863	4134.454	20127.57	3.678E-38	30	1597.174	0.5072571	2872.122	3059.668	0.002827153	21	233.9079	0.7660407	4521.941	15133.38	3.678E-38	31	1013.082	0.8530958	3020.416	18120.74	3.678E-38	41	933.7398	0.7672462	3939.674	13316.33	8.313775E-26	30	1855.036	0.8005168	4853.89	19879.73	1.040836E-37	36	1245.438	0.8376186	2070.48	11196.08	3.71252E-19	25	1333.984	0.8449829	3708.919	20762.04	3.678E-38	36	755.9958	OGG1	OGG1_E400_F	8670539	NM_016828.1	OGG1	4968	3	36.1	9766105	400	Y	GATGGAGTATGGAAGAAATGCCCAAGACGGCAGGCAGCAGCTGTGGCGGCC	HMMH, MUTM, OGH1, HOGG1	isoform 2d is encoded by transcript variant 2d; 8-hydroxyguanine DNA glycosylase; OGG1 type 1e; go_component: nucleus; go_component: mitochondrion; go_component: nucleoplasm; go_function: DNA binding; go_function: lyase activity; go_function: damaged DNA binding; go_function: endonuclease activity; go_function: hydrolase activity, acting on glycosyl bonds; go_function: purine-specific oxidized base lesion DNA N-glycosylase activity; go_function: purine-specific oxidized base lesion DNA N-glycosylase activity; go_function: purine-specific oxidized base lesion DNA N-glycosylase activity; go_process: base-excision repair; go_process: carbohydrate metabolism; go_process: base-excision repair	8-oxoguanine DNA glycosylase isoform 2d
ONECUT2_E96_F	1768	0.08888344	1812.76	186.5981	0.3516411	30	79.55655	0.1875504	7741.009	1810.062	5.167549E-09	25	382.0844	0.1717966	9777.604	2048.939	4.644608E-15	29	445.0597	0.06060241	2378.976	159.9237	0.2939381	31	86.66986	0.2084407	7349.855	1961.765	3.634949E-09	18	531.2235	0.2405689	8240.781	2642.153	1.999012E-14	29	416.82	0.1889026	7155.322	1689.747	1.427623E-06	32	368.5406	0.2181714	9459.984	2667.74	9.112496E-09	35	536.2623	0.1905113	7337.363	1750.366	9.824305E-09	29	442.6372	0.131006	9044.055	1378.521	2.234722E-11	18	528.9169	ONECUT2	ONECUT2_E96_F	4758847	NM_004852.1	ONECUT2	9480	18	36.1	53254011	96	Y	CCAAAGACCTAGAAGGCTGCGCCATGAACCCGGAGCTGACAATGGAAAGTCTG	OC2, OC-2, MGC120377, MGC120378	onecut 2; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: organ morphogenesis; go_process: regulation of transcription, DNA-dependent	one cut domain, family member 2
ONECUT2_P315_R	6117	0.3078012	939.1517	462.0814	0.5607935	31	49.13583	0.0581274	4417.867	278.8189	0.01515871	38	201.1184	0.024341	5883.452	149.2768	0.0005865685	28	254.117	0.0654235	2388.355	174.1932	0.288618	32	100.1887	0.0340536	4964.926	178.5596	0.00473549	27	219.1513	0.0441001	5112.949	240.4975	0.001371832	26	264.5777	0.03403287	5252.63	188.5834	0.009371166	40	221.9544	0.08166082	6798.489	613.4294	0.001580543	23	320.8592	0.05901638	4454.827	285.6685	0.0128728	32	268.811	0.03346877	4378.881	155.0934	0.01789145	42	154.7205	ONECUT2	ONECUT2_P315_R	4758847	NM_004852.1	ONECUT2	9480	18	36.1	53253600	-315	Y	GGTAGGTTGGCTGCCCCGGCGAGCGGCAGAGCCCTTCTGGACAGCTCCC	OC2, OC-2, MGC120377, MGC120378	onecut 2; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: organ morphogenesis; go_process: regulation of transcription, DNA-dependent	one cut domain, family member 2
OPCML_E219_R	3737	0.1104248	6874.872	865.8049	1.845287E-08	22	320.3877	0.08036292	10521.32	928.1487	5.523953E-13	30	484.2725	0.08210593	12164.14	1097.032	3.8736E-19	30	633.3918	0.07102861	4860.892	379.3069	0.01034481	33	205.8673	0.07719178	8849.001	748.573	9.662187E-10	30	835.5751	0.08063532	9926.76	879.4235	3.247643E-14	26	1209.316	0.07739116	10585.92	896.3662	4.403257E-11	26	854.1089	0.102075	11590.62	1328.976	6.106335E-10	25	650.9993	0.1131744	8441.404	1090.032	1.257244E-09	27	422.8719	0.0578955	12430.43	770.0373	1.5945E-18	28	637.2701	OPCML	OPCML_E219_R	59939898	NM_002545.3	OPCML	4978	11	36.1	132907394	219	Y	TGGGATGAAGAGCAGGGCAGTTGTCGCCGAGAAGACGACCCAGTAGGCAGG	OPCM, OBCAM	isoform a preproprotein is encoded by transcript variant 1; opiate binding-cell adhesion molecule; opioid-binding protein/cell adhesion molecule-like; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: opioid receptor activity; go_process: cell adhesion; go_process: neuron recognition	opioid binding protein/cell adhesion molecule-like isoform a preproprotein
OPCML_P71_F	1651	0.3540992	4199.339	2357.007	4.329832E-06	23	332.5461	0.1378877	7038.354	1141.72	1.178977E-06	24	557.177	0.2331603	8761.518	2694.375	4.307691E-14	24	564.1364	0.4406895	2902.341	2365.592	0.009855866	33	351.0925	0.1771451	6971.052	1522.264	1.245567E-07	28	482.2704	0.2415036	8852.253	2850.377	8.766932E-17	19	574.9542	0.1390921	8730.942	1426.766	1.206095E-08	25	663.6391	0.2412191	8992.607	2890.572	2.01784E-08	27	632.2412	0.2021763	6507.591	1674.428	4.555962E-07	26	469.3853	0.1584523	8742.958	1665.012	2.408485E-11	33	555.5473	OPCML	OPCML_P71_F	59939898	NM_002545.3	OPCML	4978	11	36.1	132907684	-71	N	CAGAGCAGTCCTCCAAGGCACGCATTGGCTCCACTCTCCTGAGCGACGG	OPCM, OBCAM	isoform a preproprotein is encoded by transcript variant 1; opiate binding-cell adhesion molecule; opioid-binding protein/cell adhesion molecule-like; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: opioid receptor activity; go_process: cell adhesion; go_process: neuron recognition	opioid binding protein/cell adhesion molecule-like isoform a preproprotein
OSM_P188_F	5910	0.05777446	6491.319	404.16	1.012902E-06	30	247.525	0.06786492	13113.78	962.0411	7.69051E-20	27	901.7451	0.05074092	17911.39	962.7665	3.678E-38	14	1205.034	0.06422886	6091.086	424.9398	0.00081539	26	338.0066	0.06669404	13904.87	1000.788	3.940322E-24	35	825.6181	0.07286039	15708.32	1242.316	1.522677E-36	20	932.6612	0.07604527	15878.95	1315.134	1.297933E-25	28	914.3877	0.04103264	18834.53	810.1776	2.219152E-23	29	1059.398	0.08936204	10925.3	1081.927	1.536029E-15	29	758.1206	0.06639199	18398.67	1315.502	3.678E-38	27	952.981	OSM	OSM_P188_F	28178862	NM_020530.3	OSM	5008	22	36.1	28993028	-188	Y	CGCTCCTCCTCCTGTTTTCTTCGAATTCGTTCTTCGAGGTCAGCCCTAC	MGC20461	go_component: extracellular space; go_function: cytokine activity; go_function: oncostatin-M receptor binding; go_process: development; go_process: immune response; go_process: cell-cell signaling; go_process: cell proliferation; go_process: regulation of cell growth; go_process: negative regulation of cell proliferation	oncostatin M precursor
OSM_P34_F	5894	0.2555568	5325.139	1862.374	2.701251E-07	24	294.0103	0.0879601	7856.97	767.3961	2.258529E-07	28	335.5873	0.09991124	8636.989	969.8192	8.536318E-10	26	410.1609	0.2286079	3134.09	958.447	0.05927486	26	334.7039	0.1083924	7694.102	947.5261	6.752293E-08	26	375.0352	0.1205859	7768.486	1078.933	2.046501E-09	19	373.7309	0.1036434	8262.55	966.9402	3.824471E-07	29	332.5038	0.07962917	9240.104	808.0925	4.3354E-06	31	527.8326	0.1268431	7244.071	1066.87	2.717472E-07	31	452.4344	0.08891656	8246.75	814.5953	1.426366E-08	24	434.9017	OSM	OSM_P34_F	28178862	NM_020530.3	OSM	5008	22	36.1	28992874	-34	N	CAGGCTGGCAGCCACTTTATGCCCGCTGGGGCGATTGGCCAACACCTCATGA	MGC20461	go_component: extracellular space; go_function: cytokine activity; go_function: oncostatin-M receptor binding; go_process: development; go_process: immune response; go_process: cell-cell signaling; go_process: cell proliferation; go_process: regulation of cell growth; go_process: negative regulation of cell proliferation	oncostatin M precursor
p16_seq_47_S188_R	6140	0.04949062	3650.993	195.3047	0.02120679	28	133.2285	0.04284987	7533.01	341.716	3.459304E-06	20	315.1639	0.06833524	7869.376	584.5335	1.468967E-07	26	306.0186	0.08072907	3556.023	321.0667	0.07786416	22	217.5325	0.04903543	6124.192	320.9435	0.0001647921	24	364.2829	0.0700091	7093.387	541.5135	5.326276E-07	33	369.052	0.05631936	7381.227	446.4835	3.380877E-05	30	289.3377	0.09057639	6934.638	700.6329	0.001040573	27	668.4751	0.08738095	6113.043	594.883	8.423664E-05	25	369.6784	0.05310032	7436.979	422.6594	1.790017E-06	30	373.8812	p16	p16_seq_47_S188_R	.	.	.	.	9	36.1	21964709	.	Y	GAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCC	.	.	.
p16_seq_47_S85_F	6139	0.3805589	9222.597	5727.417	3.754902E-33	23	786.7319	0.35848	5789.321	3290.94	3.724533E-08	28	336.6749	0.3191969	6894.222	3279.265	5.102328E-11	21	384.4476	0.3692615	4914.592	2935.759	2.844063E-05	30	392.7751	0.4157236	5185.545	3760.764	1.845636E-08	23	527.4118	0.4185221	7356.438	5366.816	5.402168E-20	31	680.848	0.5151232	5015.628	5434.739	3.739094E-09	35	784.6976	0.5247374	6195.109	6950.428	2.723782E-10	35	553.7649	0.5222915	4425.706	4948.076	2.645175E-09	23	554.0815	0.2892081	6878.586	2839.458	7.210441E-10	35	439.4288	p16	p16_seq_47_S85_F	.	.	.	.	9	36.1	21964812	.	Y	GGGGAGCAGCATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCG	.	.	.
P2RX7_E323_R	2854	0.06721997	8315.783	606.476	2.701456E-11	29	322.0968	0.131954	13125.59	2010.457	4.653281E-23	23	845.4448	0.1355598	14682.97	2318.236	2.773263E-32	26	961.1326	0.2777484	4961.801	1946.561	0.000327631	23	276.6656	0.1550524	12753.91	2358.761	7.779988E-25	29	673.1076	0.1882387	12612.12	2947.803	1.609723E-30	35	624.0226	0.1696645	12014.48	2475.381	6.444486E-18	32	883.782	0.1613823	14121.21	2736.709	4.696192E-17	30	849.6055	0.1406758	9167.868	1517.198	3.476035E-12	32	588.8637	0.1447223	16723.8	2846.77	3.678E-38	35	701.6635	P2RX7	P2RX7_E323_R	34335274	NM_177427.2	P2RX7	5027	12	36.1	120055384	323	Y	GCACATTCTGAATCTCACATGGTTTTCGAATCTGAGACGTGCTCTCACAGCCAGCT	P2X7, MGC20089	isoform b is encoded by transcript variant 2; P2X purinoceptor 7; ATP receptor; P2Z receptor; P2X7 receptor; P2X7 isoform B; P2X7 isoform C; P2X7 isoform D; P2X7 isoform E; P2X7 isoform F; P2X7 isoform G; P2X7 isoform H; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: ion channel activity; go_function: receptor activity; go_function: ATP-gated cation channel activity; go_process: ion transport; go_process: signal transduction	purinergic receptor P2X7 isoform b
P2RX7_P119_R	2170	0.1121934	5728.966	736.6149	6.292724E-06	27	289.8889	0.4289351	7647.185	5819.022	4.158273E-18	30	649.99	0.3353302	8975.387	4578.591	4.89934E-20	27	553.6874	0.06864493	5230.571	392.8864	0.005159335	25	259.9821	0.3968461	6804.414	4542.77	1.050652E-13	38	401.9731	0.3327307	8505.401	4291.044	3.094868E-20	31	561.2464	0.3757254	7974.071	4859.454	6.267286E-14	25	573.2726	0.3511182	9647.95	5274.74	2.714809E-13	35	362.5291	0.296299	8140.764	3469.841	1.738832E-14	26	890.3077	0.3429754	9835.909	5186.674	2.963478E-24	35	508.6125	P2RX7	P2RX7_P119_R	34335274	NM_177427.2	P2RX7	5027	12	36.1	120054942	-119	N	GTCATCTGCCAGCCAGGCCCGTAGGACTTGGCGCTTCTTGTTTATCACAGC	P2X7, MGC20089	isoform b is encoded by transcript variant 2; P2X purinoceptor 7; ATP receptor; P2Z receptor; P2X7 receptor; P2X7 isoform B; P2X7 isoform C; P2X7 isoform D; P2X7 isoform E; P2X7 isoform F; P2X7 isoform G; P2X7 isoform H; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: ion channel activity; go_function: receptor activity; go_function: ATP-gated cation channel activity; go_process: ion transport; go_process: signal transduction	purinergic receptor P2X7 isoform b
P2RX7_P597_F	2173	0.8344105	990.8591	5496.871	5.747374E-06	34	240.3908	0.9603201	653.0239	18224.45	1.707861E-36	36	1185.112	0.9755188	620.2815	28701.57	3.678E-38	35	1142.554	0.7935452	740.7509	3231.573	0.06916392	32	106.8921	0.9592053	688.9005	18549.43	3.678E-38	23	1372.895	0.9598644	682.4487	18712.7	3.678E-38	25	1305.902	0.9651687	719.9501	22720.63	3.678E-38	18	2065.841	0.9664204	815.0795	26335.98	3.678E-38	25	1416.47	0.9260328	871.3403	12160.7	1.881058E-18	24	906.5587	0.9744824	596.2774	26589.82	3.678E-38	23	1219.235	P2RX7	P2RX7_P597_F	34335274	NM_177427.2	P2RX7	5027	12	36.1	120054464	-597	N	TTTGGCTGATTGGTCTAGGTCATAGATCGACCTGCCGGGGTGCAGAGG	P2X7, MGC20089	isoform b is encoded by transcript variant 2; P2X purinoceptor 7; ATP receptor; P2Z receptor; P2X7 receptor; P2X7 isoform B; P2X7 isoform C; P2X7 isoform D; P2X7 isoform E; P2X7 isoform F; P2X7 isoform G; P2X7 isoform H; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: ion channel activity; go_function: receptor activity; go_function: ATP-gated cation channel activity; go_process: ion transport; go_process: signal transduction	purinergic receptor P2X7 isoform b
PADI4_E24_F	3740	0.1334395	3151.677	500.7176	0.03170083	35	130.9396	0.533669	5089.989	5939.421	4.918841E-12	37	348.0944	0.6177377	4712.547	7777.097	7.044975E-17	28	570.7753	0.3613235	2819.233	1651.521	0.03522941	22	246.4947	0.5691679	4170.733	5642.021	3.456959E-10	28	338.5119	0.6011595	3952.271	6107.857	2.957132E-12	26	431.4452	0.5635247	4991.599	6573.662	3.016183E-11	25	504.1766	0.5318174	5415.955	6265.676	3.831123E-08	19	460.2188	0.5939864	3984.029	5974.818	1.554295E-10	25	567.7015	0.5421697	4942.147	5970.99	1.683872E-12	27	410.5725	PADI4	PADI4_E24_F	6912575	NM_012387.1	PADI4	23569	1	36.1	17507303	24	N	TCCTACAGCCAGAGGGACGAGCTAGCCCGACGATGGCCCAGGGGACATTGATC	PAD, PDI4, PDI5, PADI5	protein-arginine deiminase; peptidyl arginine deiminase, type V; PADI-H protein; go_function: hydrolase activity; go_function: calcium ion binding; go_function: protein-arginine deiminase activity; go_function: protein-arginine deiminase activity; go_process: protein modification; go_process: protein modification	peptidyl arginine deiminase, type IV
PADI4_P1011_R	1655	0.2228931	3829.714	1127.137	0.001261034	24	239.4613	0.6004406	4422.165	6795.714	1.865489E-12	26	641.5458	0.693761	3785.386	8802.044	3.715355E-17	27	653.4161	0.506008	848.2275	971.2926	0.4720563	26	90.55084	0.6790349	3284.187	7159.6	1.456374E-11	24	605.4081	0.5549507	5560.662	7058.517	1.185438E-19	37	412.1875	0.7127453	3935.533	10013.09	1.488761E-16	27	602.921	0.7373768	3941.631	11347.84	5.758862E-14	30	443.4582	0.5861539	3781.985	5498.278	4.083759E-09	29	508.6787	0.6568965	4298.34	8420.943	3.783074E-17	19	482.2642	PADI4	PADI4_P1011_R	6912575	NM_012387.1	PADI4	23569	1	36.1	17506268	-1011	N	CATGGGCATCCCCCTGGCAGGCGTGGCCCACACCTGCACTGTCTGGTCTGAC	PAD, PDI4, PDI5, PADI5	protein-arginine deiminase; peptidyl arginine deiminase, type V; PADI-H protein; go_function: hydrolase activity; go_function: calcium ion binding; go_function: protein-arginine deiminase activity; go_function: protein-arginine deiminase activity; go_process: protein modification; go_process: protein modification	peptidyl arginine deiminase, type IV
PADI4_P1158_R	1658	0.03404258	15135.77	536.944	1.312752E-36	28	1351.637	0.6159219	5379.112	8786.506	4.201992E-20	21	1009.831	0.7912368	2972.43	11644.87	1.745779E-23	23	1663.471	0.06984217	9511.025	721.6569	1.151622E-08	29	520.8191	0.7179055	4502.463	11712.86	9.040245E-29	19	824.0811	0.6404099	5080.037	9225.357	1.422724E-25	34	907.7118	0.7532807	3719.243	11660.87	2.742657E-20	38	860.5974	0.7093498	5465.579	13583.14	6.156189E-22	34	747.9945	0.5812011	4789.736	6785.882	2.144186E-14	26	727.8837	0.6568337	6561.008	12749.43	3.678E-38	29	1159.934	PADI4	PADI4_P1158_R	6912575	NM_012387.1	PADI4	23569	1	36.1	17506121	-1158	N	ACCCACGAAACGCTCTATGTTCACGCCAGACTCCCATGCATGCACCCTT	PAD, PDI4, PDI5, PADI5	protein-arginine deiminase; peptidyl arginine deiminase, type V; PADI-H protein; go_function: hydrolase activity; go_function: calcium ion binding; go_function: protein-arginine deiminase activity; go_function: protein-arginine deiminase activity; go_process: protein modification; go_process: protein modification	peptidyl arginine deiminase, type IV
PALM2-AKAP2_P183_R	5117	0.1712668	6611.946	1387.097	4.858396E-09	34	285.0381	0.2486984	8223.243	2755.188	6.373283E-12	21	498.7741	0.2456464	9161.337	3015.846	5.238542E-16	30	773.5779	0.06736452	5403.894	397.5478	0.003662518	17	369.4897	0.223617	9113.637	2653.749	9.031129E-15	27	424.6317	0.2740296	8228.401	3143.694	8.265368E-16	32	487.5295	0.2191961	9245.507	2623.576	7.347139E-12	32	531.1952	0.2584827	11562.28	4065.31	1.327872E-14	27	546.5861	0.2421734	7640.584	2473.605	7.078176E-11	36	655.4635	0.1921794	8313.813	2001.634	3.859526E-11	17	412.7068	PALM2-AKAP2	PALM2-AKAP2_P183_R	51783964	NM_053016.3	PALM2	114299	9	36.1	111582227	-313	Y	GGTCCATCACACTCCAGGGGCGGAGCGAGGCACCGAGACGTCAGGGC	AKAP2	A kinase (PRKA) anchor protein 2; go_component: membrane; go_function: kinase activity; go_process: regulation of cell shape	paralemmin 2
PALM2-AKAP2_P420_R	5114	0.1006737	2499.05	290.9465	0.1386061	27	120.5233	0.146117	5881.365	1023.535	7.681787E-05	38	396.2615	0.1251018	6543.098	949.8972	5.920889E-06	37	363.5971	0.1828447	400.2774	111.9409	0.7844498	32	16.20345	0.1226794	5775.857	821.6456	0.0001046655	26	373.5185	0.187508	5933.083	1392.324	1.885547E-06	27	448.53	0.128641	6490.311	972.9447	9.385333E-05	31	443.3508	0.1464489	6829.066	1188.862	0.0004910593	20	478.7542	0.1158048	2734.542	371.2456	0.1692938	25	193.2639	0.1091348	3947.6	495.8484	0.02115919	35	342.6038	PALM2-AKAP2	PALM2-AKAP2_P420_R	51783964	NM_053016.3	PALM2	114299	9	36.1	111581990	-550	Y	GGGTCCCACATTCGGTCAGACGCCCCTCTCCACTGGCATCTGCCC	AKAP2	A kinase (PRKA) anchor protein 2; go_component: membrane; go_function: kinase activity; go_process: regulation of cell shape	paralemmin 2
PARP1_P610_R	5915	0.2127682	2117.038	599.2076	0.1536806	24	93.23441	0.9234786	880.4291	11832.05	4.396732E-16	25	771.6967	0.6510275	1848.057	3634.208	0.002420763	27	162.1064	0.04623235	4093.497	203.273	0.04505296	36	167.6676	0.6569691	1671.708	3393.157	0.005632172	37	208.3286	0.8847067	1307.39	10799.65	5.096161E-18	27	652.5154	0.9115646	1105.696	12427.94	1.508597E-15	26	676.9762	0.6241313	2457.283	4246.377	0.005392379	23	253.2331	0.8973874	821.7653	8061.203	2.439709E-08	30	667.3889	0.9606544	686.4249	19201.22	3.678E-38	24	694.1459	PARP1	PARP1_P610_R	11496989	NM_001618.2	PARP1	142	1	36.1	224663024	-610	Y	TCCGGGAAGCGCAGGCCCCCGCCTCGGGAATATAGTTGATTGGCCCGA	PARP, PPOL, ADPRT, ADPRT1, PARP-1, pADPRT-1	poly(ADP-ribose) synthetase; ADP-ribosyltransferase NAD(+); ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase); poly(ADP-ribosyl)transferase; poly(ADP-ribose) polymerase; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: identical protein binding; go_function: NAD+ ADP-ribosyltransferase activity; go_function: transferase activity, transferring glycosyl groups; go_process: DNA repair; go_process: protein amino acid ADP-ribosylation; go_process: transcription from RNA polymerase II promoter	poly (ADP-ribose) polymerase family, member 1
PAX6_E129_F	3741	0.04370598	8056.322	372.7724	4.698202E-10	29	435.8265	0.07321044	11561.51	921.1849	1.714876E-15	41	721.7728	0.06299295	14264.04	965.6635	1.326602E-25	26	1147.859	0.1030083	4314.83	506.988	0.02071503	29	270.8645	0.06450276	14411.89	1000.598	7.103298E-26	24	633.0042	0.08930295	13701.56	1353.381	1.792243E-28	34	902.8105	0.06639588	13501.83	967.3322	7.284846E-18	28	909.9105	0.093666	17930.27	1863.356	9.504437E-24	29	921.1721	0.104874	8025.046	951.9398	1.611706E-08	23	476.2295	0.0686177	13239.36	982.7501	1.234461E-21	33	617.2014	PAX6	PAX6_E129_F	71482587	NM_001604.3	PAX6	5080	11	36.1	31789326	129	Y	CGCTCCTCACTGGCCCATTAGCGAAGCCTGACCTCTGTCATCATCCTCC	AN, AN2, MGDA, WAGR, D11S812E, MGC17209	isoform b is encoded by transcript variant 2; paired box homeotic gene 6 (aniridia, keratitis); paired box homeotic gene-6; go_component: nucleus; go_function: DNA binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: development; go_process: transcription; go_process: eye development; go_process: cell differentiation; go_process: visual perception; go_process: organ morphogenesis; go_process: central nervous system development; go_process: regulation of transcription, DNA-dependent	paired box gene 6 isoform b
PAX6_P1121_F	1661	0.1501647	3112.363	567.6201	0.02998669	36	187.1003	0.08386161	9580.537	886.1384	7.957225E-11	25	603.6174	0.05928893	11588.63	736.6833	2.038429E-16	33	800.7081	0.04232535	4505.844	203.5597	0.02467982	29	244.8939	0.06857955	10856.15	806.6902	1.678892E-14	21	652.5948	0.07243028	12203.66	960.7445	1.78082E-21	34	613.0579	0.06880406	9170.869	685.0045	3.874274E-08	39	638.2355	0.07943782	13768.04	1196.711	2.277497E-13	30	411.0786	0.1051208	7534.252	896.7899	1.664559E-07	23	517.8054	0.0602311	11742.33	758.9914	1.519883E-16	22	628.1924	PAX6	PAX6_P1121_F	71482587	NM_001604.3	PAX6	5080	11	36.1	31790576	-1121	Y	CTCTCCTGGGTCTGCTCAGTCCACGGAGGCAGCTCCCCTTCAGCTGTTGCC	AN, AN2, MGDA, WAGR, D11S812E, MGC17209	isoform b is encoded by transcript variant 2; paired box homeotic gene 6 (aniridia, keratitis); paired box homeotic gene-6; go_component: nucleus; go_function: DNA binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: development; go_process: transcription; go_process: eye development; go_process: cell differentiation; go_process: visual perception; go_process: organ morphogenesis; go_process: central nervous system development; go_process: regulation of transcription, DNA-dependent	paired box gene 6 isoform b
PAX6_P50_R	1665	0.1243782	15480.38	2213.124	3.678E-38	33	907.4734	0.04901017	7368.897	384.9168	5.227821E-06	31	584.8551	0.0331981	9720.954	337.2325	9.191445E-11	26	361.0208	0.1275275	7027.594	1041.826	1.529384E-05	29	482.7064	0.07558851	6804.112	564.5446	8.62984E-06	35	357.7769	0.06517339	8049.992	568.1937	6.310717E-09	16	510.322	0.04865035	7575.875	392.5308	2.243702E-05	26	478.3961	0.05984579	8560.834	551.3079	4.489272E-05	23	661.801	0.07250252	6131.681	487.1307	0.0001109268	25	445.5963	0.03066188	8727.751	279.2374	1.806267E-08	23	293.1107	PAX6	PAX6_P50_R	71482587	NM_001604.3	PAX6	5080	11	36.1	31789505	-50	Y	GCTTTATGCAAAGCAGCGCCGGGGCCTCGCGCCAGCCGATTGGATGCTCCC	AN, AN2, MGDA, WAGR, D11S812E, MGC17209	isoform b is encoded by transcript variant 2; paired box homeotic gene 6 (aniridia, keratitis); paired box homeotic gene-6; go_component: nucleus; go_function: DNA binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: development; go_process: transcription; go_process: eye development; go_process: cell differentiation; go_process: visual perception; go_process: organ morphogenesis; go_process: central nervous system development; go_process: regulation of transcription, DNA-dependent	paired box gene 6 isoform b
PCDH1_E22_F	2856	0.03987053	6365.022	268.4678	3.135571E-06	28	254.2389	0.03588035	10722.24	402.7569	3.01523E-12	29	609.515	0.02897681	13549.73	407.3288	2.615539E-21	25	683.1317	0.05541473	4535.033	271.9173	0.02120629	28	172.2075	0.03465016	11141	403.4833	3.361696E-14	21	540.7314	0.03991078	11833.53	496.075	1.015923E-18	35	545.6652	0.03031608	12551.16	395.5244	3.484409E-14	20	859.9644	0.03334962	15438.78	536.091	2.833519E-15	19	916.1998	0.04369477	8450.417	390.6792	2.929541E-08	29	599.3029	0.03826255	9260.175	372.3929	1.078172E-09	28	413.3876	PCDH1	PCDH1_E22_F	27754772	NM_032420.2	PCDH1	5097	5	36.1	141238106	22	Y	GCTCCGGCTCCGGCTGGCTCTGGGCGCAGCAGCCCGGCGGCTTTGCGTCC	PC42, PCDH42, MGC45991	isoform 2 precursor is encoded by transcript variant 2; protocadherin 42; cadherin-like protein 1; go_component: membrane; go_component: plasma membrane; go_component: intercellular junction; go_component: integral to plasma membrane; go_function: DNA binding; go_function: protein binding; go_function: calcium ion binding; go_function: transcriptional elongation regulator activity; go_process: cell adhesion; go_process: cell-cell signaling; go_process: homophilic cell adhesion; go_process: nervous system development; go_process: regulation of transcription, DNA-dependent	protocadherin 1 isoform 2 precursor
PCDH1_P264_F	2174	0.08353035	2646.681	250.3424	0.1185765	28	127.3046	0.127298	10731.75	1579.99	4.635788E-15	33	779.7261	0.24087	13658.09	4365.405	1.645032E-36	36	927.3647	0.0323859	5954.768	202.6522	0.001777533	25	407.7789	0.1229359	11898.88	1681.854	7.065733E-20	21	924.0289	0.3274046	10434.38	5127.904	1.574077E-30	19	985.9679	0.1369024	11539.53	1846.234	3.377391E-15	24	1001.508	0.1569048	15950.74	2987.134	1.127931E-21	31	644.0426	0.3430076	7310.972	3869.176	2.177219E-13	27	759.7855	0.1769679	12847.1	2783.879	2.363894E-26	32	676.2933	PCDH1	PCDH1_P264_F	27754772	NM_032420.2	PCDH1	5097	5	36.1	141238392	-264	Y	CTCTGCCATCTCTTCACTGCCCGAGGCCCAGTACACAGGCCGTGCC	PC42, PCDH42, MGC45991	isoform 2 precursor is encoded by transcript variant 2; protocadherin 42; cadherin-like protein 1; go_component: membrane; go_component: plasma membrane; go_component: intercellular junction; go_component: integral to plasma membrane; go_function: DNA binding; go_function: protein binding; go_function: calcium ion binding; go_function: transcriptional elongation regulator activity; go_process: cell adhesion; go_process: cell-cell signaling; go_process: homophilic cell adhesion; go_process: nervous system development; go_process: regulation of transcription, DNA-dependent	protocadherin 1 isoform 2 precursor
PCGF4_P760_R	2182	0.04270241	5673.11	257.5226	5.016727E-05	25	221.6147	0.05513904	8205.543	484.6848	1.752461E-07	26	736.5978	0.04424447	10611.02	495.8416	3.256196E-13	24	690.8518	0.0509109	3283.087	181.4751	0.125273	26	149.986	0.08061825	7791.633	691.9973	1.295819E-07	33	491.8619	0.07243705	9054.338	714.8983	1.552324E-11	40	440.7754	0.1040584	8518.904	1001.036	1.352377E-07	29	536.3707	0.07129561	11637.13	901.0464	2.300732E-09	31	498.9052	0.1036927	7372.686	864.5059	3.656446E-07	30	488.0701	0.07311335	9898.495	788.6871	5.635365E-12	32	462.8135	PCGF4	PCGF4_P760_R	39725706	NM_005180.5	PCGF4	648	10	36.1	22649386	-760	Y	GAAACGATGCGATCTCCTGGGTTTGTCGCAGACCCCTGCTTCGGGGCTCCG	BMI1, RNF51, MGC12685	murine leukemia viral (bmi-1) oncogene homolog; B lymphoma Mo-MLV insertion region (mouse); oncogene BMI-1; go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: chromatin modification; go_process: segment specification; go_process: regulation of transcription, DNA-dependent	polycomb group ring finger 4
PCGF4_P92_R	2555	0.04584773	5905.293	288.5588	1.856153E-05	26	259.011	0.2049102	6217.308	1628.094	3.826333E-06	27	266.9969	0.2420436	6220.334	2018.317	3.523341E-07	22	344.5857	0.09029513	2539.691	262.0094	0.2375277	30	172.9401	0.2280678	5670.022	1704.757	8.44931E-06	27	394.0355	0.2546265	5742.983	1996.017	3.432486E-07	40	326.2955	0.2607113	6349.575	2274.453	2.954021E-06	23	396.6166	0.228241	7468.23	2238.238	1.050067E-05	37	306.1161	0.2842581	5540.835	2240.267	2.135358E-06	30	443.5262	0.2851602	5919.194	2401.146	3.089993E-07	25	329.1945	PCGF4	PCGF4_P92_R	39725706	NM_005180.5	PCGF4	648	10	36.1	22650054	-92	Y	CAGTTTCCACTCTGCCTTCAGCGGTGCATTTTTTTCCACCCTCCC	BMI1, RNF51, MGC12685	murine leukemia viral (bmi-1) oncogene homolog; B lymphoma Mo-MLV insertion region (mouse); oncogene BMI-1; go_component: nucleus; go_function: protein binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: chromatin modification; go_process: segment specification; go_process: regulation of transcription, DNA-dependent	polycomb group ring finger 4
PCTK1_E77_R	1679	0.9629865	1131.01	32027.42	3.678E-38	27	837.6488	0.6410439	6243.744	11329.01	1.931868E-31	29	1218.783	0.6584475	6448.056	12623.39	3.678E-38	29	722.8547	0.9201001	2079.958	25103.64	3.678E-38	20	1388.628	0.6016141	6907.029	10581.52	1.073748E-33	37	880.1238	0.5256763	8346.798	9361.288	3.678E-38	24	2178.198	0.600798	7150.375	10911.79	2.13916E-28	30	1364.046	0.6488345	8356.204	15624.19	2.31776E-35	23	1133.266	0.5751449	6201.452	8530.552	6.943454E-24	28	1498.572	0.6174101	8558.327	13972.5	3.678E-38	28	829.2797	PCTK1	PCTK1_E77_R	53729342	NM_006201.3	PCTK1	5127	X	36.1	46962653	77	Y	ATAACTCTTCAGGCTGCCTCTCCTCGAAAAGTCATCTTCTCGCGAACCTTTAA	PCTAIRE, FLJ16665, PCTAIRE1, PCTGAIRE	serine/threonine-protein kinase; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	PCTAIRE protein kinase 1
PDE1B_E141_F	2862	0.1142355	6031.898	790.8199	1.393649E-06	23	264.4313	0.09458335	8927.653	943.0638	1.265344E-09	33	457.206	0.1173274	11407	1529.543	3.611994E-18	36	543.5757	0.04991094	6940.19	369.8416	0.0001207736	20	348.0172	0.1088814	9915.443	1223.738	3.40924E-13	36	443.6809	0.1233842	9444.176	1343.349	3.652122E-14	38	735.782	0.09418551	10236.91	1074.819	9.488545E-11	33	560.2604	0.1281767	12497.7	1852.132	2.808835E-12	22	676.2598	0.1211465	7447.474	1040.39	1.316157E-07	29	675.6318	0.07955475	11803.26	1028.807	1.82261E-17	13	800.5139	PDE1B	PDE1B_E141_F	24431942	NM_000924.2	PDE1B	5153	12	36.1	53229812	141	Y	CTAGAGACACCGGCCTGGCTGGTCCACGCCAGCCGCAGGTGGGAAGGG	PDE1B1, PDES1B	Phosphodiesterase-1B; phosphodiesterase IB; phosphodiesterase IB, calmodulin-dependent; calcium/calmodulin-stimulated cyclic nucleotide phosphodiesterase; presumed 63kDa form of the type 1 cyclic nucleotide phosphodiesterase family known as PDE1B; calmodulin-stimulated phosphodiesterase PDE1B1; go_function: calmodulin binding; go_function: hydrolase activity; go_function: calmodulin-dependent cyclic-nucleotide phosphodiesterase activity; go_process: apoptosis; go_process: signal transduction	phosphodiesterase 1B, calmodulin-dependent
PDE1B_P263_R	2612	0.03229037	8204.348	277.098	3.500786E-10	28	286.5056	0.03631861	14675.75	556.8591	2.300049E-23	25	1346.671	0.04448025	17303.52	810.1485	6.764763E-37	30	1016.128	0.06833026	7860.705	583.8517	5.04953E-06	25	469.0922	0.04202853	12798.17	565.874	3.182782E-19	22	1641.01	0.05097122	16255.22	878.4197	2.225937E-37	20	1752.607	0.04178842	15125.65	664.0036	1.967411E-21	28	1064.321	0.04409343	18405.22	853.5966	1.932816E-22	23	799.3937	0.05135531	10021.53	547.9335	6.50006E-12	29	1123.881	0.04170872	19437.85	850.3663	3.678E-38	33	719.8235	PDE1B	PDE1B_P263_R	24431942	NM_000924.2	PDE1B	5153	12	36.1	53229408	-263	Y	CGCCTCCGCTGCACTCTGTAAACACGCACTCACATCCGCCAGTACAGGGC	PDE1B1, PDES1B	Phosphodiesterase-1B; phosphodiesterase IB; phosphodiesterase IB, calmodulin-dependent; calcium/calmodulin-stimulated cyclic nucleotide phosphodiesterase; presumed 63kDa form of the type 1 cyclic nucleotide phosphodiesterase family known as PDE1B; calmodulin-stimulated phosphodiesterase PDE1B1; go_function: calmodulin binding; go_function: hydrolase activity; go_function: calmodulin-dependent cyclic-nucleotide phosphodiesterase activity; go_process: apoptosis; go_process: signal transduction	phosphodiesterase 1B, calmodulin-dependent
PDGFA_P78_F	5926	0.2501966	6751.577	2286.254	1.345945E-11	42	284.9789	0.1306657	10870.3	1648.896	1.384064E-15	19	700.3403	0.1340398	12050.29	1880.713	3.17027E-21	13	673.1556	0.1718564	6653.458	1401.478	1.594391E-05	31	337.9527	0.2898045	8451.553	3489.572	3.178287E-15	25	564.3214	0.352183	8097.199	4456.374	1.938221E-19	37	549.3638	0.3294447	8994.587	4468.183	2.222579E-15	29	599.43	0.2746597	14819.19	5649.349	1.863666E-25	25	999.5176	0.3337546	6542.648	3327.624	2.418464E-10	30	598.3705	0.232546	6883.988	2116.216	1.860077E-08	30	382.5367	PDGFA	PDGFA_P78_F	89024648	XM_926001.1	PDGFA	5154	7	36.1	525644	-78	Y	CACCTGCCTGGACGCCTGGCCCGGCCCCGGCTGCGAGCTGCGAGCC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	platelet-derived growth factor alpha isoform 1
PDGFA_P841_R	5930	0.148787	3206.565	577.9681	0.02417327	37	116.6616	0.03095143	11888.61	382.9164	5.844619E-15	36	653.8071	0.02059392	15378.49	325.4653	2.597682E-27	22	718.9165	0.06629449	1809.599	135.5844	0.4393885	29	89.55934	0.02169353	14314.32	319.6314	3.190541E-23	23	955.4467	0.02893799	12981.84	389.8436	3.424564E-22	28	1030.495	0.0257015	12018.89	319.6902	7.62266E-13	34	1079.499	0.02420981	17349.65	432.9339	4.919666E-19	29	681.5532	0.0404738	9311.525	396.9879	5.357697E-10	23	937.5058	0.02663862	11363.05	313.7167	2.2897E-14	26	912.9888	PDGFA	PDGFA_P841_R	89024648	XM_926001.1	PDGFA	5154	7	36.1	526407	-841	Y	GGCAGCGGGCAGCGCCCAGAGCTGCTGCGCCAAAAAGGGCCAGAGAGCCGGT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	platelet-derived growth factor alpha isoform 1
PDGFB_E25_R	1680	0.7729221	2916.583	10267.77	1.83881E-25	31	647.9868	0.1815227	2958.302	678.2731	0.08248658	30	201.8873	0.165455	3822.74	777.7134	0.01651029	27	99.13833	0.5294407	2599.142	3036.888	0.005038015	34	248.0135	0.2164453	2896.406	827.7123	0.06576306	32	139.4165	0.2190684	3481.248	1004.618	0.01134752	24	189.1708	0.1906699	3082.183	749.6895	0.1058845	27	302.6272	0.2439522	4393.861	1450.024	0.01962505	29	188.4924	0.2235132	2579.003	771.156	0.1256351	30	239.4822	0.2116953	2553.502	712.5845	0.1286392	29	229.706	PDGFB	PDGFB_E25_R	4505680	NM_002608.1	PDGFB	5155	22	36.1	37970911	25	Y	CGCAGGGAGGCAGGCAGGCCGCTCCCGGCTGCAGGAGGAGAAGTTGCCA	SIS, SSV, PDGF2, c-sis, FLJ12858	isoform 1, preproprotein is encoded by transcript variant 1; Platelet-derived growth factor, beta polypeptide (oncogene SIS); platelet-derived growth factor, B chain; PDGF, B chain; becaplermin; v-sis platelet-derived growth factor beta polypeptide (simian sarcoma viral oncogene homolog); PDGF-B VORLAEUFERSEQUENZ; HUMANES PDGF-B GEN AUS PGEM2-PDGF-B, FLANKIERT VON 5'-ECORI UND 3'-HINDIII RESTRIKTIONSSCHNITTSTELLEN; platelet-derived growth factor 2; go_component: membrane; go_component: extracellular region; go_function: growth factor activity; go_function: platelet-derived growth factor receptor binding; go_process: cell proliferation; go_process: response to wounding; go_process: regulation of progression through cell cycle	platelet-derived growth factor beta isoform 1, preproprotein
PDGFB_P719_F	5934	0.438722	733.6027	651.5841	0.5664345	40	55.28919	0.7891836	2538.201	9876.011	2.558953E-15	29	659.1213	0.7936886	2957.976	11764.16	7.693256E-24	21	857.4131	0.4080973	2791.273	1993.437	0.02195952	31	160.0406	0.8033307	2274.187	9697.785	2.635577E-15	20	410.1206	0.789104	2578.205	10020.97	1.377534E-19	41	415.5649	0.8301144	1996.316	10243.26	1.239589E-12	27	546.9009	0.7892638	2883.49	11173.98	8.893786E-12	35	472.6934	0.7319502	2800.832	7921.157	2.84144E-12	26	645.5643	0.8226209	1830.875	8954.705	3.342106E-12	24	505.7205	PDGFB	PDGFB_P719_F	4505680	NM_002608.1	PDGFB	5155	22	36.1	37971655	-719	N	AGGGCTACCAACATGATCTTCCCGTCAGTCACCCTGCTGTTTACTATCTCCC	SIS, SSV, PDGF2, c-sis, FLJ12858	isoform 1, preproprotein is encoded by transcript variant 1; Platelet-derived growth factor, beta polypeptide (oncogene SIS); platelet-derived growth factor, B chain; PDGF, B chain; becaplermin; v-sis platelet-derived growth factor beta polypeptide (simian sarcoma viral oncogene homolog); PDGF-B VORLAEUFERSEQUENZ; HUMANES PDGF-B GEN AUS PGEM2-PDGF-B, FLANKIERT VON 5'-ECORI UND 3'-HINDIII RESTRIKTIONSSCHNITTSTELLEN; platelet-derived growth factor 2; go_component: membrane; go_component: extracellular region; go_function: growth factor activity; go_function: platelet-derived growth factor receptor binding; go_process: cell proliferation; go_process: response to wounding; go_process: regulation of progression through cell cycle	platelet-derived growth factor beta isoform 1, preproprotein
PDGFRA_E125_F	992	0.5002112	2275.544	2377.552	0.002983724	38	300.2391	0.6128136	4261.396	6902.935	2.461817E-12	26	648.4301	0.5783044	5329.802	7446.313	1.063705E-17	33	541.0616	0.157283	3448.129	662.2158	0.05790923	26	253.1244	0.5276828	4964.943	5658.661	5.664837E-12	31	476.5766	0.6623801	3829.373	7709.08	2.696677E-16	25	542.3849	0.5527665	5056.694	6373.512	5.574348E-11	29	508.8162	0.5747721	5786.854	7957.144	2.969998E-11	30	461.7986	0.5916112	4482.38	6638.25	3.06124E-13	31	545.5815	0.5535515	5103.29	6451.559	4.650199E-14	42	300.319	PDGFRA	PDGFRA_E125_F	61699224	NM_006206.3	PDGFRA	5156	4	36.1	54790329	125	N	GTGTGGGACATTCATTGCGGAATAACATCGGAGGAGAAGGTAAGGGAA	CD140A, PDGFR2, MGC74795	go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_function: platelet-derived growth factor alpha-receptor activity; go_process: cell proliferation; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	platelet-derived growth factor receptor alpha precursor
PDGFRA_P1429_F	4234	0.07667097	3385.501	289.4274	0.03029486	31	146.4182	0.119221	8743.441	1197.036	9.241774E-10	33	448.5248	0.09586696	10536.2	1127.777	1.246118E-14	29	480.2192	0.05296301	4130.562	236.5941	0.04084149	36	178.6842	0.1155856	7968.255	1054.454	1.322208E-08	31	411.0977	0.2956338	6364.334	2713.184	6.380289E-10	29	525.205	0.09456281	8932.74	943.3689	3.587369E-08	29	428.4572	0.1106885	9591.704	1206.281	5.48366E-07	23	472.8201	0.1442477	7249.159	1238.792	1.315682E-07	20	530.2305	0.09242796	9799.939	1008.219	2.962213E-12	31	409.6908	PDGFRA	PDGFRA_P1429_F	61699224	NM_006206.3	PDGFRA	5156	4	36.1	54788775	-1429	Y	GCTGAAGATGCACGAGAGCGGGTCGCGTAGAAGAACTGCGGCAATGGG	CD140A, PDGFR2, MGC74795	go_component: membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: vascular endothelial growth factor receptor activity; go_function: platelet-derived growth factor alpha-receptor activity; go_process: cell proliferation; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	platelet-derived growth factor receptor alpha precursor
PDGFRB_E195_R	4153	0.1605357	3445.903	678.1038	0.01138366	28	157.9834	0.2031293	9799.942	2523.581	4.330939E-15	24	790.7318	0.1582082	11278.5	2138.501	1.297118E-19	22	682.7089	0.05013113	6472.52	346.8772	0.0004050793	32	319.7414	0.2085905	8491.126	2264.349	2.801058E-12	28	448.4365	0.2149475	9947.89	2751.114	6.492022E-20	35	846.2281	0.1301188	10636.9	1606.049	1.219311E-12	30	796.2485	0.1824206	12284.07	2763.168	1.611201E-13	33	569.8546	0.2513411	6622.665	2256.946	2.475864E-08	35	490.716	0.1867015	9550.499	2215.376	1.356868E-14	36	382.2551	PDGFRB	PDGFRB_E195_R	68216043	NM_002609.3	PDGFRB	5159	5	36.1	149515420	195	N	AAGCATCCTTCGGGAGGAGCAGAGCCGCCAGAGGGGCCGCCCTGG	JTK12, PDGFR, CD140B, PDGFR1, PDGF-R-beta	beta platelet-derived growth factor receptor; platelet-derived growth factor receptor beta; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: platelet activating factor receptor activity; go_function: platelet-derived growth factor receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: signal transduction; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	platelet-derived growth factor receptor beta precursor
PDGFRB_P273_F	2810	0.1875997	8441.852	1972.486	1.502102E-15	33	366.8596	0.2939476	7976.644	3362.513	9.897742E-13	23	615.1289	0.2770966	8898.002	3449.03	1.772972E-16	30	293.7128	0.1720569	6549.917	1381.936	2.263099E-05	40	240.044	0.2868738	7600.288	3097.644	3.813483E-12	31	369.6229	0.2804224	8342.983	3290.266	1.412626E-16	26	807.8645	0.2866456	8532.066	3468.604	3.933374E-12	24	693.4528	0.2940111	9372.721	3944.941	1.456758E-10	32	491.0604	0.2909389	7145.6	2972.983	6.920979E-11	30	488.1231	0.2876188	9386.569	3830.134	1.429636E-18	23	530.7401	PDGFRB	PDGFRB_P273_F	68216043	NM_002609.3	PDGFRB	5159	5	36.1	149515888	-273	Y	CTTAGAAATTCCACAGCCCACGCCAGCCGCCAGCTGCTGAGTCACTTTT	JTK12, PDGFR, CD140B, PDGFR1, PDGF-R-beta	beta platelet-derived growth factor receptor; platelet-derived growth factor receptor beta; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: platelet activating factor receptor activity; go_function: platelet-derived growth factor receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: signal transduction; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	platelet-derived growth factor receptor beta precursor
PDGFRB_P343_F	2808	0.07339768	14380.92	1147.057	6.680732E-36	26	813.4494	0.06141097	12285.53	810.3732	4.263429E-17	29	982.1364	0.0427538	15543.84	698.7061	2.533313E-29	28	755.6434	0.1482982	12589.39	2209.474	4.689556E-18	22	516.9305	0.03935768	11919	492.4207	1.723943E-16	27	1271.9	0.05861838	15126.41	948.1249	1.106501E-32	24	1072.495	0.05713763	13870.23	846.5983	1.658982E-18	27	811.2274	0.05139998	17068.31	930.2663	1.63103E-19	29	643.697	0.05059643	12100.71	650.211	1.259927E-17	27	773.4089	0.04858249	16697.23	857.7215	1.345058E-33	27	824.248	PDGFRB	PDGFRB_P343_F	68216043	NM_002609.3	PDGFRB	5159	5	36.1	149515958	-343	Y	CACTTTCCCGATGCCCATGTCGGGTGGCGGCCTCCCCTTGCCATGGC	JTK12, PDGFR, CD140B, PDGFR1, PDGF-R-beta	beta platelet-derived growth factor receptor; platelet-derived growth factor receptor beta; go_component: membrane; go_component: integral to membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: platelet activating factor receptor activity; go_function: platelet-derived growth factor receptor activity; go_function: vascular endothelial growth factor receptor activity; go_process: signal transduction; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	platelet-derived growth factor receptor beta precursor
PECAM1_E32_R	5686	0.13248	7177.341	1111.332	1.023452E-09	28	580.0381	0.6931202	4129.178	9552.041	1.041072E-18	23	942.1345	0.6396303	6438.133	11604.71	1.359938E-36	35	911.6313	0.0445678	5131.736	244.0434	0.008141221	28	320.4892	0.6341224	5343.421	9434.289	1.060673E-23	36	603.9606	0.6681959	4227.643	8715.122	1.005297E-20	27	1303.523	0.6609054	5868.848	11633.46	1.388443E-26	24	1049.158	0.6207115	5665.968	9436.096	1.278558E-13	29	877.2717	0.7167516	3304.924	8616.058	2.624412E-15	35	662.0422	0.7397757	4854.609	14085.16	3.678E-38	41	654.3365	PECAM1	PECAM1_E32_R	21314616	NM_000442.2	PECAM1	5175	17	36.1	59817691	32	Y	GCGCCTGCAGAGAGACCGGCTGTGGCGCTGGTCAGGTAATGGCAGCCATGG	CD31, PECAM-1	adhesion molecule; PECAM-1, CD31/EndoCAM; go_component: plasma membrane; go_component: integral to membrane; go_component: intercellular junction; go_function: protein binding; go_process: cell motility; go_process: cell adhesion; go_process: cell recognition; go_process: signal transduction	platelet/endothelial cell adhesion molecule (CD31 antigen)
PECAM1_P135_F	5123	0.08918766	4160.983	417.2398	0.003651121	24	160.7541	0.5787641	4023.179	5665.111	2.843186E-09	24	619.6284	0.5441753	5705.14	6930.325	2.70766E-17	26	749.6934	0.420411	2909.53	2182.994	0.01332021	32	228.9153	0.5282842	4082.297	4683.84	3.99965E-08	27	439.8643	0.5952273	3722.186	5620.61	1.593283E-10	27	471.4658	0.5691126	4318.523	5835.95	1.221547E-08	29	504.7573	0.4745108	5834.12	5358.443	1.72209E-07	34	481.9037	0.6737186	2659.628	5698.189	2.24657E-07	24	468.023	0.5634854	4975.697	6552.088	5.435952E-14	16	595.6002	PECAM1	PECAM1_P135_F	21314616	NM_000442.2	PECAM1	5175	17	36.1	59817858	-135	Y	CAAGGCACAAGTGACATTTGCCTTGGCGTTCTTGACCCTCCCTCTGTCTCGC	CD31, PECAM-1	adhesion molecule; PECAM-1, CD31/EndoCAM; go_component: plasma membrane; go_component: integral to membrane; go_component: intercellular junction; go_function: protein binding; go_process: cell motility; go_process: cell adhesion; go_process: cell recognition; go_process: signal transduction	platelet/endothelial cell adhesion molecule (CD31 antigen)
PEG10_P978_R	1671	0.1987824	3902.578	993.0411	0.001508362	29	145.5806	0.2859097	6634.104	2696.222	1.32352E-08	19	638.2358	0.2659183	8340.168	3057.418	6.06989E-14	21	511.2813	0.6375349	760.8192	1514.083	0.3561496	25	86.11476	0.2489061	7345.759	2467.461	3.44916E-10	29	466.2191	0.3293193	7421.598	3693.274	4.502918E-15	27	621.8928	0.225382	8176.735	2408.19	2.15388E-09	36	476.8265	0.2530606	9068.883	3106.387	7.79054E-09	21	482.3584	0.2592748	5782.03	2058.877	1.70601E-06	32	379.6281	0.2445861	10212.04	3338.809	1.461997E-19	32	310.5692	PEG10	PEG10_P978_R	89026228	XM_940371.1	PEG10	23089	7	36.1	94122646	-978	Y	CTCCCAGCATTTCATGATTCCGCTTCCCTGCTCCGTAAAACCGAA	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to paternally expressed 10
PEG3_E496_F	3746	0.3561264	4180.329	2367.449	4.486566E-06	34	272.6299	0.7956225	1704.683	7025.466	1.501025E-07	28	446.9077	0.7957805	1754.715	7227.255	1.531298E-08	30	392.8648	0.5569272	2329.219	3053.445	0.008041254	21	232.2858	0.7897736	1868.497	7395.205	4.517938E-09	18	371.7239	0.7218098	2503.792	6755.962	2.472317E-10	28	409.6116	0.7575839	2286.302	7457.527	5.912104E-08	29	350.8451	0.7036852	2894.614	7111.575	4.842851E-06	22	399.1825	0.708246	2284.592	5788.704	6.99116E-07	37	481.399	0.7425669	1880.839	5713.74	4.660304E-06	24	299.0039	PEG3	PEG3_E496_F	33354284	NM_006210.1	PEG3	5178	19	36.1	62043380	496	Y	CATTGGTGTCGACCTTGCTGGACTTGCCGTGGCAGAGCCCCCGGCTGTCTGCC	PW1, ZSCAN24, KIAA0287, DKFZp781A095	paternally expressed gene 3; Human putative imprinted ZNF gene; maternally imprinted; Kruppel-type zinc finger protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent	paternally expressed 3
PENK_E26_F	3752	0.3367369	6115.836	3155.764	3.185464E-12	24	769.062	0.3366396	8888.895	4561.649	4.595267E-18	36	882.1052	0.2590541	10980.81	3874.143	2.698683E-24	21	1396.535	0.2070575	4143.877	1108.184	0.01013314	14	578.5314	0.2234062	10669.04	3097.978	1.895702E-20	36	797.2914	0.4395418	8652.356	6864.073	2.432164E-30	30	1354.404	0.2578499	10136.14	3556.408	6.273474E-16	28	1427.873	0.2456798	14505.44	4756.948	1.894866E-22	23	1214.276	0.2527182	8797.592	3009.017	5.303426E-15	26	916.8245	0.1553981	13018.77	2413.72	1.170395E-25	27	880.0107	PENK	PENK_E26_F	40254835	NM_006211.2	PENK	5179	8	36.1	57521117	26	Y	TTCGAGCCTGCCTGGGCGCAGAACGGGGTCCCTCGGCAGGACCCTC	.	go_component: soluble fraction; go_function: opioid peptide activity; go_function: neuropeptide hormone activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: neuropeptide signaling pathway	proenkephalin
PENK_P447_R	1678	0.05747658	4576.77	285.1969	0.001662412	23	205.1873	0.218468	7213.688	2044.454	1.790169E-08	23	416.5452	0.2230583	7516.687	2186.735	5.351744E-10	26	419.54	0.04920099	4666.894	246.6725	0.01789193	22	207.7147	0.2290313	7299.37	2198.127	1.544417E-09	25	314.3144	0.3364976	6940.23	3570.478	2.027277E-13	23	503.5053	0.2148072	7614.837	2110.568	6.334134E-08	26	404.9481	0.2306664	8538.028	2589.907	2.088749E-07	25	290.5217	0.2360059	6652.78	2086.006	4.561105E-08	20	340.3917	0.1849189	8721.434	2001.334	4.668102E-12	31	423.0125	PENK	PENK_P447_R	40254835	NM_006211.2	PENK	5179	8	36.1	57521590	-447	Y	CCAATTGGAAAAGCCGGGTTCAGACACGACTCTAGAGGGAAGAGAAGAAG	.	go_component: soluble fraction; go_function: opioid peptide activity; go_function: neuropeptide hormone activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: neuropeptide signaling pathway	proenkephalin
PGF_E33_F	1024	0.06935822	5419.875	411.3814	7.20301E-05	25	173.8592	0.08657353	8761.543	839.887	4.154831E-09	30	338.6449	0.06346408	13240.98	904.0476	6.452163E-22	29	716.4321	0.118259	2894.927	401.6791	0.1494329	21	201.087	0.07747494	9593.571	814.0796	1.756761E-11	31	417.4212	0.08101995	10858	966.089	3.773807E-17	26	465.8152	0.08121828	10102.14	901.8467	3.665855E-10	24	422.0371	0.06689765	12677.08	916.0371	5.248315E-11	28	478.6837	0.08888386	8076.571	797.6647	2.534822E-08	26	779.9856	0.08417867	9801.165	910.0759	4.962088E-12	14	414.6911	PGF	PGF_E33_F	56676307	NM_002632.4	PGF	5228	14	36.1	74492011	33	Y	GTCCTCCCGTAGCTGGGCGGCCGTCCGTCGATGCAGTTTCCTCCGC	PLGF, PlGF-2	go_component: membrane; go_function: heparin binding; go_function: growth factor activity; go_process: angiogenesis; go_process: cell proliferation; go_process: cell differentiation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle; go_process: positive regulation of cell proliferation	placental growth factor, vascular endothelial growth factor-related protein
PGF_P320_F	4965	0.3825645	1768.963	1158.014	0.1133566	24	81.34838	0.5055156	4924.802	5136.897	5.321142E-10	31	440.9937	0.4112384	6672.446	4730.421	5.884766E-14	32	474.5498	0.3300885	376.3257	234.7021	0.7650079	33	26.87025	0.4418187	4564.107	3691.793	3.234195E-07	26	659.5751	0.5205167	4871.227	5396.656	8.740239E-13	23	406.4063	0.4370394	5681.093	4487.997	1.153239E-08	29	425.1353	0.4206837	7254.49	5340.629	1.892865E-09	34	498.7502	0.5151232	4093.866	4455.478	1.018655E-07	38	346.0079	0.3560624	6023.043	3385.709	3.031666E-09	23	363.9918	PGF	PGF_P320_F	56676307	NM_002632.4	PGF	5228	14	36.1	74492364	-320	Y	CCAGGAGTCCAGCGTCAGCCGTCAAGGCTCATGATCTAACCGCCTCTGC	PLGF, PlGF-2	go_component: membrane; go_function: heparin binding; go_function: growth factor activity; go_process: angiogenesis; go_process: cell proliferation; go_process: cell differentiation; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of progression through cell cycle; go_process: positive regulation of cell proliferation	placental growth factor, vascular endothelial growth factor-related protein
PGR_E183_R	4154	0.4276339	4324.13	3305.416	3.224426E-08	25	253.0282	0.8332051	2908.965	15030.95	8.013283E-33	39	967.5643	0.8859244	2345.535	18992.31	3.678E-38	37	938.2073	0.5780031	2812.573	3989.311	0.0004221994	31	129.8645	0.8773587	2235.706	16709.31	3.678E-38	30	1077.939	0.8366873	2889.798	15317.39	3.678E-38	24	1362.199	0.8639563	1993.35	13293.98	4.92866E-20	26	1652.348	0.8793424	2774.878	20951.88	1.37364E-34	23	732.702	0.8568384	1606.181	10211.69	4.950296E-15	24	852.9269	0.8926399	2274.886	19745.88	3.678E-38	43	982.73	PGR	PGR_E183_R	31981491	NM_000926.2	PGR	5241	11	36.1	100506282	183	N	GAAGTTTGGATGTTGTGTGCCACACTTCGATTTGTCTTAAGGAATGTGTTCC	PR, NR3C3	go_component: nucleus; go_function: lipid binding; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: steroid hormone receptor activity; go_process: transcription; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	progesterone receptor
PGR_P456_R	2811	0.5031304	1145.551	1261.246	0.2282668	34	94.23819	0.913664	986.305	11495.99	1.718907E-15	18	705.8748	0.895747	1285.202	11901.72	6.490791E-19	30	831.5409	0.05115309	2683.502	150.0608	0.2311164	32	120.3591	0.8966786	987.8203	9440.692	1.576655E-11	32	435.6929	0.8904655	1177.427	10384.9	2.292726E-16	27	708.6799	0.884013	1277.573	10499.39	1.132481E-11	32	553.4259	0.9241902	941.1899	12693.04	4.497328E-11	29	529.6295	0.919275	834.1774	10638.17	3.963161E-14	30	642.3722	0.9235715	878.8343	11828.35	4.089696E-17	24	458.4394	PGR	PGR_P456_R	31981491	NM_000926.2	PGR	5241	11	36.1	100506921	-456	N	ATTCTGGGAAGCAGGTATAGAATGTTCACCGGGCATCAAATGGCAGGATATAATATGG	PR, NR3C3	go_component: nucleus; go_function: lipid binding; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: steroid hormone receptor activity; go_process: transcription; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	progesterone receptor
PGR_P790_F	2813	0.3586265	2518.149	1463.948	0.01575186	26	155.8432	0.736699	2960.084	8561.917	3.751252E-13	28	623.2114	0.749227	3211.16	9892.656	1.152205E-18	20	396.6107	0.05858622	4255.805	271.0712	0.03246364	31	190.9259	0.7819023	2073.588	7792.532	2.668145E-10	24	453.9851	0.6995301	4071.52	9711.801	1.189506E-23	23	684.8101	0.6730617	3745.403	7916.458	1.933935E-11	29	687.1166	0.7737386	3031.689	10709.33	3.003731E-11	23	456.2749	0.7357209	2511.363	7269.715	3.75705E-10	28	525.418	0.8362362	1942.304	10428.73	3.444958E-16	22	1141.031	PGR	PGR_P790_F	31981491	NM_000926.2	PGR	5241	11	36.1	100507255	-790	N	CACTAGCAGTTATTCCACATTTCCGCCTAAATCTCCCAGCAGCCACTAATAT	PR, NR3C3	go_component: nucleus; go_function: lipid binding; go_function: steroid binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: steroid hormone receptor activity; go_process: transcription; go_process: cell-cell signaling; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	progesterone receptor
PHLDA2_E159_R	3777	0.2316508	6805.317	2081.896	3.330095E-11	33	273.5183	0.0925356	13131.62	1349.25	4.865322E-21	31	809.5562	0.07465157	18087.31	1467.244	3.678E-38	36	939.7883	0.1105483	5450.858	689.9058	0.001840753	21	268.7763	0.1001435	13832.65	1550.542	8.995411E-26	15	1151.923	0.09966174	12336.45	1376.636	2.127526E-23	20	1201.174	0.1057314	15453.22	1838.892	6.406392E-26	34	957.149	0.07877677	20443.64	1756.753	3.977908E-30	33	756.0315	0.1055532	10731.13	1278.176	1.516214E-15	24	850.9778	0.09285734	15638.97	1611.08	2.181132E-32	26	617.8145	PHLDA2	PHLDA2_E159_R	57863296	NM_003311.3	PHLDA2	7262	11	36.1	2907067	159	Y	GCTGGCGGGGAACAGGCTCAGGCGGTCGGAGGTGAGCACCCCGC	IPL, BRW1C, BWR1C, HLDA2, TSSC3	tumor suppressing subtransferable candidate 3; tumor suppressing subchromosomal transferable fragment cDNA 3; p17-Beckwith-Wiedemann region 1C; imprinted in placenta and liver; tumor-supressing STF cDNA 3; go_process: imprinting; go_process: apoptosis	pleckstrin homology-like domain family A member 2
PHLDA2_P622_F	1682	0.2771097	4537.047	1777.546	1.15582E-05	30	232.9887	0.466354	4524.593	4041.439	2.822239E-07	28	625.9431	0.4597606	7947.717	6848.857	4.282486E-24	22	887.0038	0.3371164	3558.647	1860.643	0.007527377	34	263.6502	0.5698559	4719.688	6385.133	4.131087E-13	33	830.6968	0.4198667	6635.597	4874.833	3.260861E-16	40	531.5499	0.3855725	6575.564	4189.125	1.017643E-09	29	668.9119	0.3809336	9087.297	5653.271	5.770931E-13	26	821.1176	0.4573717	4846.359	4169.198	1.357578E-08	24	434.7545	0.4208497	7055.925	5199.977	7.042313E-16	32	564.8877	PHLDA2	PHLDA2_P622_F	57863296	NM_003311.3	PHLDA2	7262	11	36.1	2907848	-622	Y	CTATCTTGCCACCCACGGGCTGCGCCAAGAACGACCACCTCTCTTAGCC	IPL, BRW1C, BWR1C, HLDA2, TSSC3	tumor suppressing subtransferable candidate 3; tumor suppressing subchromosomal transferable fragment cDNA 3; p17-Beckwith-Wiedemann region 1C; imprinted in placenta and liver; tumor-supressing STF cDNA 3; go_process: imprinting; go_process: apoptosis	pleckstrin homology-like domain family A member 2
PI3_E107_F	3778	0.7619312	605.4006	2257.611	0.1247067	31	150.9442	0.9447378	666.7412	13107.86	5.661727E-19	23	978.149	0.9545605	795.2244	18806.21	3.678E-38	32	846.4512	0.8754944	376.4936	3350.593	0.09321664	25	117.401	0.9435961	610.7682	11890.62	9.729418E-17	33	1319.665	0.9314359	787.213	12052.69	2.219573E-20	36	942.7808	0.9548016	646.037	15759.77	3.226234E-23	22	1148.356	0.8600119	1684.178	10961.04	1.592957E-09	22	731.1917	0.9362925	761.1367	12655.89	1.288075E-19	28	1188.338	0.9586919	660.8813	17658.79	9.806874E-37	27	1033.004	PI3	PI3_E107_F	31657130	NM_002638.2	PI3	5266	20	36.1	43237019	107	N	CTTGATCGTGGTGGTGTTCCTCATCGCTGGGACGCTGGTTCTAGAG	ESI, WAP3, SKALP, WFDC14, MGC13613	WAP four-disulfide core domain 14; protease inhibitor 3, skin-derived (SKALP); skin-derived antileukoproteinase; elastase-specific inhibitor; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: serine-type endopeptidase inhibitor activity; go_process: copulation	elafin preproprotein
PI3_P1394_R	1685	0.2765785	1623.267	658.8395	0.2632785	36	82.35413	0.7253629	2677.615	7336.149	6.625374E-10	30	426.7801	0.7703531	2765.182	9611.282	1.466934E-16	36	349.7035	0.1136183	2114.595	283.8714	0.3264233	28	101.9028	0.7752849	1937.283	7028.788	1.693628E-08	29	546.535	0.661075	3084.88	6212.125	2.03123E-10	24	489.5329	0.810025	2000.728	8957.186	4.471319E-10	24	626.2761	0.7660267	2620.949	8908.364	6.167259E-08	34	354.5533	0.6224248	2938.334	5008.631	1.139896E-06	18	423.2621	0.783585	2398.32	9045.796	8.785146E-14	22	576.0155	PI3	PI3_P1394_R	31657130	NM_002638.2	PI3	5266	20	36.1	43235518	-1394	N	AAAGGCTTCCACAGTCTGACATTCGTTTATGTCTCCCTCAGTTTCAGGCTTGG	ESI, WAP3, SKALP, WFDC14, MGC13613	WAP four-disulfide core domain 14; protease inhibitor 3, skin-derived (SKALP); skin-derived antileukoproteinase; elastase-specific inhibitor; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: serine-type endopeptidase inhibitor activity; go_process: copulation	elafin preproprotein
PI3_P274_R	1688	0.7676098	1512.885	5327.531	1.290051E-06	33	317.9764	0.9427933	814.1681	15065.93	1.795293E-25	30	902.0997	0.9567167	843.2178	20848.49	3.678E-38	31	920.9555	0.8343552	673.7589	3897.434	0.03040847	25	388.1613	0.937082	927.431	15302.25	7.996827E-29	41	739.4637	0.9444879	946.1171	17798.73	3.678E-38	30	844.1492	0.9405532	1060.977	18368.71	4.338837E-33	28	1412.497	0.9418492	1174.313	20639.61	4.764715E-29	32	1024.56	0.9374534	802.7729	13530.83	1.521707E-22	28	1054.615	0.9476027	1048.352	20767.87	3.678E-38	30	817.668	PI3	PI3_P274_R	31657130	NM_002638.2	PI3	5266	20	36.1	43236638	-274	N	TCTACCAGTGACTTGCTGAATAACCTTCGGTGATTCCTTTCTCTTCTTGGGTCTCACT	ESI, WAP3, SKALP, WFDC14, MGC13613	WAP four-disulfide core domain 14; protease inhibitor 3, skin-derived (SKALP); skin-derived antileukoproteinase; elastase-specific inhibitor; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: serine-type endopeptidase inhibitor activity; go_process: copulation	elafin preproprotein
PIK3R1_P307_F	2632	0.4960912	1235.438	1314.72	0.1914604	21	77.25123	0.9253277	939.9459	12886.86	4.019766E-19	25	731.088	0.8940566	1538.464	13827	4.362572E-26	25	707.5976	0.7050745	396.5012	1186.979	0.5337535	41	85.67962	0.9288072	865.0647	12590.58	1.690143E-19	37	486.6776	0.9253774	977.1251	13357.17	1.107531E-25	28	781.4252	0.9132826	1153.776	13204.41	1.400683E-17	29	730.4513	0.9352829	859.8036	13870.96	6.008147E-13	21	776.5989	0.8570762	1258.974	8149.409	2.249585E-09	26	510.0305	0.9349762	846.2997	13606.82	2.248453E-22	19	746.7684	PIK3R1	PIK3R1_P307_F	32455249	NM_181524.1	PIK3R1	5295	5	36.1	67557911	-307	N	CGTGTGTGGAGTGCCACGGTACAATCAGACGACAGATGGACAGTGTGACAAAAGTGT	GRB1, p85-ALPHA	isoform 3 is encoded by transcript variant 3; phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha); phosphoinositide-3-kinase, regulatory subunit, polypeptide 1 (p85 alpha); phosphatidylinositol 3-kinase, regulatory, 1; phosphatidylinositol 3-kinase-associated p-85 alpha; go_component: phosphoinositide 3-kinase complex; go_component: phosphoinositide 3-kinase complex, class IA; go_function: kinase activity; go_function: insulin binding; go_function: insulin receptor binding; go_function: insulin receptor binding; go_function: phosphatidylinositol binding; go_function: protein phosphatase binding; go_function: insulin receptor substrate binding; go_function: phosphoinositide 3-kinase regulator activity; go_function: phosphoinositide 3-kinase regulator activity; go_function: insulin-like growth factor receptor binding; go_process: intracellular signaling cascade; go_process: intracellular signaling cascade; go_process: phosphoinositide phosphorylation; go_process: insulin receptor signaling pathway; go_process: insulin-like growth factor receptor signaling pathway	phosphoinositide-3-kinase, regulatory subunit, polypeptide 1 isoform 3
PITX2_E24_R	1771	0.3046497	4457.302	1996.664	6.598133E-06	23	224.8746	0.4712979	5309.069	4821.775	3.870382E-10	43	311.0439	0.3951083	6215.79	4125.401	2.137384E-11	24	342.3056	0.1674122	2139.389	450.2841	0.2825724	34	94.87646	0.3864973	5706.743	3658.159	2.849816E-09	26	496.6448	0.5876564	4846.963	7050.225	2.261401E-17	27	473.4554	0.4392868	5812.265	4631.923	3.83426E-09	28	480.9262	0.3688799	6981.17	4138.834	2.13863E-07	43	329.493	0.438857	5028.33	4010.748	1.222183E-08	32	503.0535	0.333344	7130.44	3615.394	4.130108E-12	25	385.3954	PITX2	PITX2_E24_R	40316913	NM_000325.4	PITX2	5308	4	36.1	111777933	24	Y	CTGGCGGGGCACTTAGGAGCCAACCGAGGAGCAGGAGCACGGACTCCCAC	RS, RGS, ARP1, Brx1, IDG2, IGDS, IHG2, PTX2, RIEG, IGDS2, IRID2, Otlx2, RIEG1, MGC20144, MGC111022	isoform c is encoded by transcript variant 3; solurshin; all1-responsive gene 1; rieg bicoid-related homeobox transcription factor 1; pituitary homeo box 2; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: organ morphogenesis; go_process: determination of left/right symmetry; go_process: regulation of transcription, DNA-dependent	paired-like homeodomain transcription factor 2 isoform c
PITX2_P183_R	6125	0.08740917	1545.174	157.5769	0.4537677	30	53.82176	0.1796891	5704.749	1271.531	6.215835E-05	34	350.3703	0.2039789	6310.476	1642.672	1.078353E-06	40	379.551	0.355243	441.6328	298.4244	0.7382237	19	28.67695	0.2322209	5772.464	1776.174	4.594647E-06	35	344.0112	0.246046	5480.99	1821.305	2.066992E-06	32	414.5809	0.2349366	5756.995	1798.573	7.287267E-05	32	332.6106	0.2354818	6453.743	2018.64	0.0001900379	32	261.7289	0.2743117	4287.93	1658.647	0.0007641266	37	254.498	0.1704641	6893.373	1437.092	2.968995E-07	26	436.5239	PITX2	PITX2_P183_R	40316913	NM_000325.4	PITX2	5308	4	36.1	111778140	-183	Y	AGCGACAGGGAAAGTGGCCCAAGAGACGGAACAAAGGACAATGTTCATGGG	RS, RGS, ARP1, Brx1, IDG2, IGDS, IHG2, PTX2, RIEG, IGDS2, IRID2, Otlx2, RIEG1, MGC20144, MGC111022	isoform c is encoded by transcript variant 3; solurshin; all1-responsive gene 1; rieg bicoid-related homeobox transcription factor 1; pituitary homeo box 2; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: organ morphogenesis; go_process: determination of left/right symmetry; go_process: regulation of transcription, DNA-dependent	paired-like homeodomain transcription factor 2 isoform c
PKD2_P287_R	5127	0.1686234	2402.551	507.5783	0.116272	28	112.82	0.1354273	5800.421	924.2461	0.0001296132	40	311.0656	0.1402736	6654.003	1101.988	2.270923E-06	32	300.611	0.04890576	4533.391	238.2514	0.02241255	28	157.0119	0.1257133	5903.999	863.312	6.216051E-05	29	388.7468	0.1382856	6704.625	1091.988	2.683325E-07	20	400.1742	0.1348354	6401.076	1013.189	0.0001071764	33	328.9744	0.1374025	7989.469	1288.566	3.025522E-05	23	322.387	0.1522334	5089.576	931.8918	0.0006242017	25	398.634	0.1190396	7028.518	963.2391	1.094853E-06	25	388.4647	PKD2	PKD2_P287_R	33286447	NM_000297.2	PKD2	5311	4	36.1	89147557	-287	Y	CCTTTCCCTGCAGGCGGGCTGGCGGGTGAGCGATTCCCTCCCTTCC	PKD4, APKD2, MGC138468	polycystwin; go_component: basal body; go_component: plasma membrane; go_component: actin cytoskeleton; go_component: integral to membrane; go_function: calcium ion binding; go_function: cation channel activity; go_function: protein C-terminus binding; go_function: cytoskeletal protein binding; go_function: voltage-gated sodium channel activity; go_function: voltage-gated chloride channel activity; go_process: cation transport; go_process: organ morphogenesis; go_process: cell-matrix adhesion	polycystin 2
PKD2_P336_R	5129	0.1409421	7079.174	1177.857	1.217142E-09	32	436.6143	0.1553108	12491.85	2315.23	4.944154E-22	31	782.7119	0.1332686	15238.63	2358.468	1.028686E-34	36	772.9053	0.0370284	8082.061	314.6184	5.835459E-06	31	273.9554	0.1623003	11447.23	2237.22	3.404962E-20	24	793.8195	0.1878644	15272.51	3555.992	3.678E-38	24	851.9747	0.116249	13842.78	1834.039	4.097593E-21	28	837.5298	0.1179963	15983.99	2151.75	8.027992E-20	33	763.117	0.153156	10818.5	1974.665	9.496535E-18	32	770.813	0.134207	14493.7	2262.177	1.779356E-30	23	1119.594	PKD2	PKD2_P336_R	33286447	NM_000297.2	PKD2	5311	4	36.1	89147508	-336	Y	ACCCAAGAGTTATCTCAGCGTCGGGCAGGCATCGACAGCTCCAGGAG	PKD4, APKD2, MGC138468	polycystwin; go_component: basal body; go_component: plasma membrane; go_component: actin cytoskeleton; go_component: integral to membrane; go_function: calcium ion binding; go_function: cation channel activity; go_function: protein C-terminus binding; go_function: cytoskeletal protein binding; go_function: voltage-gated sodium channel activity; go_function: voltage-gated chloride channel activity; go_process: cation transport; go_process: organ morphogenesis; go_process: cell-matrix adhesion	polycystin 2
PLA2G2A_E268_F	1040	0.2094627	3993.314	1084.574	0.0008778755	20	243.9566	0.7930857	2772.744	11010.99	5.332963E-19	19	1021.561	0.8066276	3052.785	13151.43	3.542548E-29	40	630.8297	0.2797805	2729.093	1099.005	0.08265162	20	175.1703	0.7771919	2745.019	9923.903	3.311711E-17	37	560.2797	0.7417016	3904.84	11499.87	6.979569E-30	23	793.812	0.8132395	2603.271	11771.26	1.272556E-17	25	1202.105	0.7766144	3510.457	12551.99	1.907886E-15	34	901.3987	0.7196782	2766.838	7360.117	6.630854E-11	26	785.6444	0.8376504	2148.615	11601.83	3.632063E-20	30	649.254	PLA2G2A	PLA2G2A_E268_F	20149501	NM_000300.2	PLA2G2A	5320	1	36.1	20179228	268	N	CCAGCACCTGTGCAGGCCTCACGTGTGCACCCCACAGTCCACCA	MOM1, PLA2, PLA2B, PLA2L, PLA2S, PLAS1, sPLA2	phosphatidylcholine 2-acylhydrolase; synovial phospholipase-A2; go_component: membrane; go_component: extracellular region; go_function: hydrolase activity; go_function: calcium ion binding; go_function: calcium-dependent phospholipase A2 activity; go_process: lipid catabolism	phospholipase A2, group IIA
PLA2G2A_P528_F	4976	0.3922518	2071.329	1401.415	0.04494187	27	140.6131	0.7147467	3537.982	9115.533	6.251389E-16	26	564.9098	0.7840987	3069.715	11511.6	2.309301E-23	27	874.6158	0.1342038	3989.217	633.8539	0.02814079	29	184.9389	0.7383722	3065.281	8933.132	2.243793E-15	31	706.3414	0.6501311	4496.271	8540.852	4.831105E-21	37	575.9261	0.8096943	2129.888	9487.511	2.37417E-11	31	927.5764	0.7733684	3493.688	12263.27	7.502491E-15	29	885.0425	0.6889867	2563.217	5899.815	1.458746E-07	20	615.1115	0.7965079	3250.666	13115.16	5.198593E-29	35	681.1197	PLA2G2A	PLA2G2A_P528_F	20149501	NM_000300.2	PLA2G2A	5320	1	36.1	20180024	-528	N	CCATCAAACAGCTTTCCTCTCGAGAATACCATTTACCTCCAGTGCTCGA	MOM1, PLA2, PLA2B, PLA2L, PLA2S, PLAS1, sPLA2	phosphatidylcholine 2-acylhydrolase; synovial phospholipase-A2; go_component: membrane; go_component: extracellular region; go_function: hydrolase activity; go_function: calcium ion binding; go_function: calcium-dependent phospholipase A2 activity; go_process: lipid catabolism	phospholipase A2, group IIA
PLAGL1_E68_R	3780	0.3023209	4589.97	2032.275	3.287529E-06	25	286.4806	0.7481732	3614.103	11034.54	1.511715E-21	22	828.0743	0.7290753	4989.972	13697.43	3.678E-38	23	744.0865	0.1274662	1961.027	301.0899	0.3592799	34	89.29708	0.6370023	4409.908	7914.162	2.990907E-16	36	601.351	0.606971	5095.324	8023.354	2.551956E-21	34	616.5278	0.573264	4293.911	5902.645	1.03477E-08	31	747.5298	0.5855653	5813.712	8355.633	5.740164E-12	23	702.4712	0.5230119	4104.439	4610.119	5.06068E-08	30	684.4393	0.5657681	5167.204	6862.728	2.802904E-15	22	598.5591	PLAGL1	PLAGL1_E68_R	88997857	XM_933027.1	LOC645648	645648	6	36.1	144371178	-92	Y	ATGGCAGATGCCGTGGGCTTTGCCGCCCGCGGCAGCCAAGAGGATGG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_938120
PLAGL1_P236_R	1689	0.209535	6690.798	1800.092	3.319075E-10	33	406.3061	0.8025667	2469.606	10445.45	1.294027E-16	27	1035.388	0.7841753	3471.838	12977.88	4.074603E-30	24	633.449	0.09583271	3518.502	383.5252	0.07550944	38	130.5537	0.728182	3480.816	9592.762	2.293514E-18	31	609.6462	0.6825613	3255.438	7214.912	2.591636E-13	29	866.0279	0.6404207	4314.842	7862.958	1.675086E-12	26	646.4319	0.7286775	4579.84	12568.42	1.155642E-17	30	623.9391	0.6566574	3375.042	6646.167	1.135375E-10	30	692.0641	0.617988	4657.183	7695.786	3.855945E-16	37	628.0379	PLAGL1	PLAGL1_P236_R	37622889	NM_002656.2	PLAGL1	5325	6	36.1	144371482	-236	Y	AGCGGGGCCTGCTAGCCGAAGTCTCCGCCAGGATGGGCCGCCAGAGCCC	ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017	isoform 1 is encoded by transcript variant 1; PLAG-like 1; pleomorphic adenoma gene-like 1; ZAC tumor supressor; pleiomorphic adenoma gene-like 1, isoform 2; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_process: transcription; go_process: cell cycle arrest; go_process: induction of apoptosis; go_process: regulation of transcription, DNA-dependent; go_process: positive regulation of transcription from RNA polymerase II promoter	pleiomorphic adenoma gene-like 1 isoform 1
PLAGL1_P334_F	1693	0.07056035	30123.25	2294.461	3.678E-38	20	1019.686	0.896323	1635.012	14999.77	4.733459E-28	28	1141.532	0.9101843	1953.863	20813.67	3.678E-38	42	932.403	0.07967376	14236.54	1241.132	8.872958E-20	47	1046.741	0.8865543	1698.921	14058.19	4.251607E-27	29	1047.766	0.8735812	2172.976	15706.75	3.678E-38	34	1327.315	0.8631707	2471.547	16222.29	1.620041E-30	30	929.3874	0.8927948	2442.051	21169.96	3.05169E-34	35	824.1395	0.8572906	1405.15	9041.806	1.250865E-11	30	567.0571	0.8769335	2479.299	18379.28	3.678E-38	21	937.5927	PLAGL1	PLAGL1_P334_F	37622889	NM_002656.2	PLAGL1	5325	6	36.1	144371580	-334	Y	AACTAACTTACCTCCTGTGCCAGCAGCGCCCAAGTGCAGCTGCCCAAACGTGAG	ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017	isoform 1 is encoded by transcript variant 1; PLAG-like 1; pleomorphic adenoma gene-like 1; ZAC tumor supressor; pleiomorphic adenoma gene-like 1, isoform 2; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_process: transcription; go_process: cell cycle arrest; go_process: induction of apoptosis; go_process: regulation of transcription, DNA-dependent; go_process: positive regulation of transcription from RNA polymerase II promoter	pleiomorphic adenoma gene-like 1 isoform 1
PLAT_E158_F	1041	0.4220836	1607.349	1246.969	0.1263086	23	70.97212	0.8803002	1239.134	9848.309	3.656582E-12	30	601.8269	0.681203	5322.726	11587.24	6.411789E-32	30	879.0829	0.7039267	581.4894	1620.27	0.3741816	27	81.00117	0.3226679	7449.605	3596.486	5.72714E-13	25	524.8416	0.8224903	1887.856	9210.723	5.005866E-15	27	522.5006	0.8816427	1449.127	11539.43	2.799813E-14	43	516.4503	0.8861424	1625.237	13427.35	1.575271E-13	30	645.3162	0.8757679	1231.834	9388.69	4.934839E-12	29	500.571	0.7379581	3558.139	10301.99	1.673298E-20	39	457.5698	PLAT	PLAT_E158_F	14702166	NM_000931.2	PLAT	5327	8	36.1	42184193	158	N	GCTTGCTCCTTCCCTTTCCTCGCAGAGGTTTTCTCTCCAGCCCTGGA	TPA, T-PA, DKFZp686I03148	isoform 2 precursor is encoded by transcript variant 2; plasminogen activator, tissue type; t-plasminogen activator; alteplase; reteplase; tissue plasminogen activator (t-PA); go_component: extracellular space; go_component: extracellular region; go_function: peptidase activity; go_function: plasminogen activator activity; go_process: proteolysis; go_process: proteolysis; go_process: blood coagulation; go_process: protein modification	plasminogen activator, tissue type isoform 2 precursor
PLAT_P80_F	4991	0.208889	1964.804	545.2015	0.2013837	28	108.4553	0.5141845	5821.58	6267.37	1.655412E-14	33	592.318	0.3309839	12094.1	6032.814	5.934591E-37	29	908.5635	0.2777623	3666.119	1448.396	0.01283496	25	181.6228	0.1780234	11303.75	2469.821	1.809346E-20	28	705.2463	0.4038698	7657.104	5255.33	1.270689E-20	25	589.4091	0.4649289	7096.398	6253.026	4.110942E-15	29	912.0104	0.4439371	8876.267	7166.271	2.087822E-15	33	629.9309	0.4649204	5344.434	4730.564	8.643562E-11	35	499.2676	0.3452213	9404.219	5010.943	2.980726E-22	32	777.2749	PLAT	PLAT_P80_F	14702166	NM_000931.2	PLAT	5327	8	36.1	42184431	-80	N	AGCACAGCCCATCCTGGCTTCGGGCCAGGCTGATTATTCACAGCCGTGAT	TPA, T-PA, DKFZp686I03148	isoform 2 precursor is encoded by transcript variant 2; plasminogen activator, tissue type; t-plasminogen activator; alteplase; reteplase; tissue plasminogen activator (t-PA); go_component: extracellular space; go_component: extracellular region; go_function: peptidase activity; go_function: plasminogen activator activity; go_process: proteolysis; go_process: proteolysis; go_process: blood coagulation; go_process: protein modification	plasminogen activator, tissue type isoform 2 precursor
PLAU_P11_F	1707	0.2737254	3669.494	1420.684	0.000845664	27	247.0114	0.08194255	9059.444	817.5395	1.230258E-09	24	565.9791	0.07300052	11048.98	877.9736	2.505004E-15	24	632.5527	0.1092314	3692.351	465.0408	0.05442031	38	137.1581	0.06771506	9697.896	711.6548	1.739562E-11	31	550.8625	0.09204612	9163.789	939.14	2.305899E-12	23	358.4648	0.09762052	8525.002	933.0634	1.693043E-07	26	634.5999	0.08108153	10803.26	962.0579	2.940265E-08	26	663.0237	0.1116577	6663.265	850.09	5.686358E-06	35	547.2778	0.1003408	10526.65	1185.211	1.864287E-14	20	507.42	PLAU	PLAU_P11_F	53729348	NM_002658.2	PLAU	5328	10	36.1	75340885	-11	Y	GCGGGCCCTGATATAGAGCAGGCGCCGCGGGTCGCAGCACAGTGCGGAGACC	ATF, UPA, URK, u-PA	plasminogen activator, urinary; urokinase-type plasminogen activator precursor; U-plasminogen activator; antagonist of uPA; urokinase-type plasminogen activator amino-terminal fragment; urokinase plasminogen activator; go_component: extracellular space; go_function: kinase activity; go_function: peptidase activity; go_function: plasminogen activator activity; go_function: serine-type endopeptidase activity; go_process: proteolysis; go_process: fibrinolysis; go_process: chemotaxis; go_process: proteolysis; go_process: blood coagulation; go_process: signal transduction	urokinase plasminogen activator preproprotein
PLAU_P176_R	1702	0.09064467	2487.99	257.9712	0.1474811	33	118.6637	0.04859322	8324.969	430.3064	1.361039E-07	26	410.806	0.03427881	9214.063	330.6078	1.149274E-09	23	436.9727	0.03856486	5071.245	207.4277	0.009672015	30	182.3727	0.06247849	7510.905	507.2074	8.145641E-07	38	299.3829	0.06037125	7177.651	467.5899	5.100445E-07	32	347.5242	0.05686196	7911.554	483.018	6.139393E-06	24	537.038	0.07549061	8920.07	736.5319	1.191162E-05	35	371.8211	0.07742273	7666.489	651.7641	2.63822E-07	39	203.6983	0.04063677	8614.463	369.1278	1.998488E-08	37	217.7918	PLAU	PLAU_P176_R	53729348	NM_002658.2	PLAU	5328	10	36.1	75340720	-176	Y	TCTCGATTCCTCAGTCCAGACGCTGTTGGGTCCCCTCCGCTGGAGATC	ATF, UPA, URK, u-PA	plasminogen activator, urinary; urokinase-type plasminogen activator precursor; U-plasminogen activator; antagonist of uPA; urokinase-type plasminogen activator amino-terminal fragment; urokinase plasminogen activator; go_component: extracellular space; go_function: kinase activity; go_function: peptidase activity; go_function: plasminogen activator activity; go_function: serine-type endopeptidase activity; go_process: proteolysis; go_process: fibrinolysis; go_process: chemotaxis; go_process: proteolysis; go_process: blood coagulation; go_process: signal transduction	urokinase plasminogen activator preproprotein
PLAUR_E123_F	951	0.06771246	6686.192	492.8842	2.808971E-07	29	274.1598	0.09634912	11015.05	1185.109	8.798626E-15	22	800.0441	0.09398727	12195.98	1275.551	8.815284E-20	29	786.9796	0.04589663	4229.837	208.2845	0.03692455	23	175.025	0.1158574	10232.37	1353.946	2.632615E-14	27	598.3299	0.1107762	9321.453	1173.689	2.228993E-13	34	611.7719	0.09791608	14475	1582.033	3.377626E-22	26	1060.918	0.09106119	15352.99	1548.143	3.818185E-17	27	611.6881	0.1106821	7764.271	978.7657	4.478509E-08	31	670.9304	0.09205301	14050.87	1434.698	7.64777E-26	27	708.9491	PLAUR	PLAUR_E123_F	53829380	NM_001005377.1	PLAUR	5329	19	36.1	48866219	123	Y	GGACTCCTCCCAGACGTTTTGCGAAAGAGCGAGTCAGCCCCAGATGC	CD87, UPAR, URKR	isoform 3 precursor is encoded by transcript variant 3; monocyte activation antigen Mo3; u-plasminogen activator receptor form 2; go_component: cell surface; go_component: plasma membrane; go_component: integral to membrane; go_component: extrinsic to membrane; go_function: protein binding; go_function: U-plasminogen activator receptor activity; go_function: U-plasminogen activator receptor activity; go_process: chemotaxis; go_process: cell motility; go_process: blood coagulation; go_process: regulation of proteolysis; go_process: cell surface receptor linked signal transduction	plasminogen activator, urokinase receptor isoform 3 precursor
PLAUR_P82_F	4261	0.07315931	4404.225	355.5368	0.002222177	20	117.6392	0.0519776	9181.581	508.885	2.816154E-09	28	603.9913	0.07335138	10047.84	803.2795	1.36916E-12	29	473.0863	0.05415212	2152.849	128.9812	0.3544575	33	93.39778	0.05964025	8089.28	519.3871	7.744906E-08	28	526.0983	0.07017523	8948.838	682.929	3.332347E-11	24	333.9077	0.06792434	8469.198	624.4741	6.137494E-07	26	570.825	0.0646923	10907.04	761.3225	3.994472E-08	29	427.0931	0.08173166	8197.52	738.5315	1.931782E-08	27	302.3836	0.06798571	11886.6	874.3616	2.890758E-17	25	683.5967	PLAUR	PLAUR_P82_F	53829380	NM_001005377.1	PLAUR	5329	19	36.1	48866424	-82	Y	TCTCTCTTCCTAACGTGGGACCCGGGGCAATCGCTCTCCACTGCTGTAAAATGA	CD87, UPAR, URKR	isoform 3 precursor is encoded by transcript variant 3; monocyte activation antigen Mo3; u-plasminogen activator receptor form 2; go_component: cell surface; go_component: plasma membrane; go_component: integral to membrane; go_component: extrinsic to membrane; go_function: protein binding; go_function: U-plasminogen activator receptor activity; go_function: U-plasminogen activator receptor activity; go_process: chemotaxis; go_process: cell motility; go_process: blood coagulation; go_process: regulation of proteolysis; go_process: cell surface receptor linked signal transduction	plasminogen activator, urokinase receptor isoform 3 precursor
PLG_E406_F	952	0.5383775	2202.17	2684.957	0.001545954	17	303.4258	0.9372292	1074.116	17530.7	2.09491E-35	39	1355.31	0.959803	1060.161	27701.7	3.678E-38	33	1028.119	0.4271532	2539.655	1968.305	0.03337512	27	167.6874	0.9500607	1075.94	22371.46	3.678E-38	30	1204.69	0.9264296	1751.177	23310.79	3.678E-38	32	1366.449	0.9545268	1022.638	23565.25	3.678E-38	29	1682.73	0.9603916	1091.927	28900.88	3.678E-38	20	935.8412	0.9229814	992.4815	13092.17	9.980692E-22	26	1377.191	0.957531	1040.239	25708.48	3.678E-38	39	955.7973	PLG	PLG_E406_F	4505880	NM_000301.1	PLG	5340	6	36.1	161043679	406	N	AAGAGCCAATGTAGCTAATTATGCAAAGGACGGCTAAGCTCTTTGCCTGGTTCT	DKFZp779M0222	covering first half of fourth kringle; go_component: extracellular space; go_function: peptidase activity; go_function: calcium ion binding; go_function: plasmin activity; go_process: proteolysis; go_process: fibrinolysis; go_process: tissue development; go_process: blood coagulation; go_process: organismal physiological process; go_process: negative regulation of cell proliferation	plasminogen
PLG_P370_F	4268	0.5241528	6577.744	7355.633	1.358378E-28	32	648.2554	0.9092079	2969.862	30742.14	3.678E-38	28	1431.722	0.9194672	2770.548	32773.91	3.678E-38	25	1563.199	0.532132	4593.819	5338.538	3.510935E-08	41	439.067	0.911527	2554.985	27354	3.678E-38	37	1279.402	0.8914264	3704.618	31237.21	3.678E-38	31	1138.26	0.9114099	3146.103	33395.7	3.678E-38	30	1149.514	0.9134532	3072.517	33484.13	3.678E-38	33	1404.514	0.875738	2578.984	18880.17	3.678E-38	39	1721.03	0.919972	2748.749	32748.16	3.678E-38	26	925.7885	PLG	PLG_P370_F	4505880	NM_000301.1	PLG	5340	6	36.1	161042903	-370	N	GAAGCTTGAGGGAGGCTATGGACGTGCAGCGCTTGGCAGAGGGTCT	DKFZp779M0222	covering first half of fourth kringle; go_component: extracellular space; go_function: peptidase activity; go_function: calcium ion binding; go_function: plasmin activity; go_process: proteolysis; go_process: fibrinolysis; go_process: tissue development; go_process: blood coagulation; go_process: organismal physiological process; go_process: negative regulation of cell proliferation	plasminogen
PLS3_E70_F	3790	0.9004781	1142.737	11244.33	2.435169E-22	29	552.6884	0.1612391	9181.619	1784.251	6.791885E-12	30	395.4836	0.1065607	10538.66	1268.876	5.216867E-15	24	761.272	0.9385844	444.5461	8322.039	1.862119E-06	34	304.4011	0.2423313	8850.031	2862.561	1.250879E-14	32	831.5063	0.3209706	8919.416	4263.39	1.540147E-21	28	837.8959	0.1826282	12535.88	2823.279	3.13184E-20	24	1045.816	0.2856599	13545.98	5456.936	7.910037E-22	18	668.4698	0.303108	7093.725	3128.857	4.053885E-11	33	669.2115	0.2248259	12557.51	3671.094	1.668943E-28	28	1017.327	PLS3	PLS3_E70_F	28416938	NM_005032.3	PLS3	5358	X	36.1	114701835	70	Y	GGCAGTCGGGCCAGACCCAGGACTCTGCGACTTTACGTAAGTGCTTTGTAGGCGC	T-PLASTIN	T isoform; go_component: actin cytoskeleton; go_function: actin binding; go_function: calcium ion binding; go_function: protein binding	plastin 3
PLS3_P94_R	1711	0.1372087	9570.583	1537.901	8.689417E-18	33	459.1473	0.2302837	7763.073	2352.474	4.153672E-10	37	588.3163	0.2392918	9974.229	3168.995	8.78168E-19	32	602.7095	0.2012308	6307.713	1614.271	2.326925E-05	28	275.8572	0.3540026	9082.388	5031.893	1.546542E-21	30	877.6701	0.4048484	9434.245	6485.615	5.037394E-32	36	728.8499	0.3416004	10906.92	5710.771	7.535684E-24	29	822.0956	0.3738139	11549.75	6954.542	1.160346E-20	27	521.0019	0.3874693	6071.096	3903.657	1.43496E-10	25	698.3997	0.4082085	10134.71	7059.74	3.604408E-32	29	627.3926	PLS3	PLS3_P94_R	28416938	NM_005032.3	PLS3	5358	X	36.1	114701671	-94	Y	CCTTCCTGGTTCCCAGGCCGACTGCTAGCACCACCCGAGCCAATG	T-PLASTIN	T isoform; go_component: actin cytoskeleton; go_function: actin binding; go_function: calcium ion binding; go_function: protein binding	plastin 3
PLSCR3_P751_R	2705	0.0857138	3621.769	348.9137	0.01615866	24	160.6962	0.4811006	8033.234	7540.777	1.830424E-24	36	919.1636	0.3476732	11876.13	6382.967	1.597228E-37	23	892.9636	0.03509086	6155.68	227.5004	0.001094843	37	235.8253	0.4510387	8221.536	6837.156	1.190519E-24	30	638.699	0.4258222	9020.776	6764.157	1.864975E-31	36	1008.172	0.2861692	10996.75	4448.601	1.812012E-20	27	1234.403	0.3547041	13204.17	7312.994	1.396071E-25	25	730.7457	0.4247715	6736.265	5048.169	6.072956E-15	34	914.386	0.3827031	9870.594	6181.429	7.368328E-28	29	799.3403	PLSCR3	PLSCR3_P751_R	31543416	NM_020360.2	PLSCR3	57048	17	36.1	7239318	-751	Y	GTGGAAGCTGCGATTTGGCCCCACGAGCAGCGAGGAGTCCACCGAGACATTT	.	go_component: plasma membrane; go_component: integral to membrane; go_function: calcium ion binding; go_function: phospholipid scramblase activity; go_process: phospholipid scrambling	phospholipid scramblase 3
PLXDC1_E71_F	2871	0.3719463	7272.745	4366.292	1.311515E-19	30	695.5939	0.09544797	11580.24	1232.495	2.406686E-16	29	562.4664	0.06624309	16951.2	1209.655	4.240938E-37	31	894.6082	0.1833399	4887.046	1119.59	0.002429241	23	238.0252	0.07905427	13236.28	1144.791	2.150464E-22	28	1271.415	0.0926526	13662.03	1405.292	1.599984E-28	25	1054.831	0.115219	12092.08	1587.692	6.734975E-16	23	1031.128	0.08896839	18081.03	1775.5	6.629044E-24	28	1222.548	0.1010928	10953.2	1243.064	4.674782E-16	27	933.8136	0.07546314	15806.51	1298.331	8.067587E-32	21	811.6769	PLXDC1	PLXDC1_E71_F	21361852	NM_020405.3	PLXDC1	57125	17	36.1	34561227	71	Y	AGCTCGCCTCGCATGGTGGGTGCCCGGACCTGCCCCCGGCCTGCTTGCTGC	TEM3, TEM7, FLJ45632	2410003I07Rik; tumor endothelial marker 7; go_component: membrane; go_function: receptor activity; go_process: development; go_process: angiogenesis	plexin domain containing 1 precursor
PLXDC1_P236_F	2732	0.08844383	12191.23	1192.558	2.815339E-26	37	629.0485	0.07008512	10500.63	798.9402	1.218299E-12	37	743.9722	0.08848356	10110.85	991.1975	3.346552E-13	27	459.8169	0.09481388	7093.007	753.4328	2.875219E-05	29	353.3348	0.08070866	11835.37	1047.859	8.148316E-18	40	776.9197	0.09033195	13161.21	1316.866	3.160232E-26	33	628.6814	0.09615747	11655.1	1250.594	4.312985E-14	33	636.1406	0.07918669	14405.79	1247.447	1.186269E-14	31	1118.493	0.09935372	7896.572	882.1322	3.840346E-08	25	488.0288	0.1041069	14822.65	1734.08	1.007711E-29	27	967.7093	PLXDC1	PLXDC1_P236_F	21361852	NM_020405.3	PLXDC1	57125	17	36.1	34561534	-236	Y	CGCCTGCCCTCAGCCCTAACGGAGCGCTCCCCTAGAGCTCTGCAGCC	TEM3, TEM7, FLJ45632	2410003I07Rik; tumor endothelial marker 7; go_component: membrane; go_function: receptor activity; go_process: development; go_process: angiogenesis	plexin domain containing 1 precursor
PLXDC2_E337_F	3051	0.02383122	16650.13	408.9212	3.678E-38	29	1203.396	0.05843415	11586.18	725.2516	4.644114E-15	25	772.3309	0.07222616	14453.23	1132.953	6.986464E-27	25	753.0496	0.02355267	8306.084	202.7613	4.151894E-06	28	464.0315	0.0467732	12617.29	624.0157	7.375714E-19	26	635.5684	0.1134176	11914.5	1536.976	1.801569E-22	35	727.6042	0.06669113	12463.07	897.7151	3.866158E-15	36	673.0798	0.06702202	14240.81	1030.196	6.232657E-14	32	619.4951	0.08093756	10022.52	891.4431	9.83291E-13	21	741.3081	0.04752454	15976.26	802.1381	1.460489E-30	32	767.0175	PLXDC2	PLXDC2_E337_F	40255004	NM_032812.7	PLXDC2	84898	10	36.1	20145715	337	Y	GCTGCCCGAGTGGAACCGACAGTTTGCGAGCCTCGGCTGCAAGTGGCCTC	TEM7R, FLJ14623	1200007L24Rik; tumor endothelial marker 7-related; go_component: membrane; go_function: receptor activity; go_process: development	plexin domain containing 2 precursor
PLXDC2_P914_R	2776	0.753485	5157.109	16068.6	3.678E-38	23	1715.63	0.1120831	11439.16	1456.606	1.455219E-16	29	529.6406	0.08640081	13943.12	1328.085	9.453731E-26	26	645.9506	0.8438462	2330.548	13134.54	9.567075E-20	40	1336.168	0.08878543	11131.84	1094.39	5.514881E-16	31	647.7465	0.1473207	11832.45	2061.616	4.723928E-24	31	629.0045	0.09797307	12432.87	1361.249	3.558863E-16	32	654.8915	0.08887379	13215.75	1298.856	1.44962E-12	27	519.0569	0.1078207	9246.66	1129.553	1.818101E-11	32	494.7791	0.07114171	15901.06	1225.529	6.637817E-32	26	727.5938	PLXDC2	PLXDC2_P914_R	40255004	NM_032812.7	PLXDC2	84898	10	36.1	20144464	-914	Y	CCTGTTCCTTTAAACTCTCGCTTTCGCCCCCGCTGACACTTTGCAAAGCC	TEM7R, FLJ14623	1200007L24Rik; tumor endothelial marker 7-related; go_component: membrane; go_function: receptor activity; go_process: development	plexin domain containing 2 precursor
PMP22_P1254_F	1718	0.616524	875.7563	1568.748	0.2182186	21	106.0124	0.9012523	1070.48	10682.75	1.072348E-13	28	518.8602	0.9001513	1169.071	11440.87	3.20383E-17	28	524.2643	0.9412124	531.3677	10108.44	2.39264E-09	29	778.9476	0.8905496	945.6403	8507.912	1.894186E-09	35	746.6747	0.8986677	1131.344	10920.2	7.579474E-18	21	457.1797	0.8925741	1195.637	10765.11	4.758348E-12	31	539.0657	0.8924112	1449.014	12848.53	3.458757E-12	26	506.7997	0.8987457	1024.418	9980.474	5.902915E-13	18	426.4777	0.8753173	1345.521	10148.07	6.617252E-14	33	350.3209	PMP22	PMP22_P1254_F	24430161	NM_000304.2	PMP22	5376	17	36.1	15110623	-1254	N	ATTTCCAGTGTCTTTCTCCCCGCTGGATGTTTCGTTGTCCAGCCAGGTTGTC	DSS, HNPP, CMT1A, CMT1E, GAS-3, Sp110, MGC20769	growth arrest-specific 3; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_process: mechanosensory behavior; go_process: synaptic transmission; go_process: sensory perception of sound; go_process: negative regulation of cell proliferation; go_process: peripheral nervous system development	peripheral myelin protein 22
PMP22_P975_F	1730	0.2640536	2798.077	1039.815	0.02159145	22	82.25646	0.7687778	2820.616	9710.596	1.289577E-15	33	455.601	0.8122103	2451.687	11036.32	7.841566E-20	31	593.1814	0.6411403	369.8637	839.4608	0.629339	28	48.02165	0.8048817	1742.089	7598.794	3.180851E-09	28	502.64	0.7340669	3154.624	8983.884	4.065356E-18	22	655.9059	0.8647502	1614.81	10964.03	2.298966E-13	28	474.8937	0.8258983	2308.681	11426.23	3.074269E-11	34	538.8674	0.7763571	2377.732	8601.236	6.830673E-13	26	675.781	0.8456766	1941.683	11188.22	2.558138E-18	30	410.6922	PMP22	PMP22_P975_F	24430161	NM_000304.2	PMP22	5376	17	36.1	15110344	-975	N	CCCTCCCTGTCACACACTTTACGTTTGATTGGACTCTCCAGTCACAAGGGC	DSS, HNPP, CMT1A, CMT1E, GAS-3, Sp110, MGC20769	growth arrest-specific 3; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_process: mechanosensory behavior; go_process: synaptic transmission; go_process: sensory perception of sound; go_process: negative regulation of cell proliferation; go_process: peripheral nervous system development	peripheral myelin protein 22
PODXL_P1341_R	5925	0.2970196	5159.265	2222.117	1.083331E-07	36	275.2358	0.07693807	11230.68	944.4224	1.015105E-14	26	692.926	0.05702086	14192.84	864.2717	5.368678E-25	30	1334.046	0.349087	3864.404	2126.124	0.002510328	22	163.4052	0.05919726	11516.01	730.9033	4.848061E-16	34	535.3542	0.1401434	10757.07	1769.535	2.370337E-19	31	936.2158	0.08024133	13210.11	1161.197	1.296939E-17	29	979.4777	0.05863555	15967.87	1000.833	2.759155E-17	30	804.011	0.08046631	7700.24	682.5813	2.028645E-07	30	468.3505	0.04906787	14610.95	759.0813	1.927116E-25	34	756.8528	PODXL	PODXL_P1341_R	66277201	NM_001018111.1	PODXL	5420	7	36.1	130893249	-1341	Y	TGCCTGGGAGACGCAGACCCCAGGCCCGCCTGAAGAGGAGGCACATCGGC	PCLP, Gp200	precursor isoform 1 is encoded by transcript variant 1; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: catalytic activity	podocalyxin-like precursor isoform 1
POMC_E254_F	3805	0.06440634	6497.196	454.1515	7.906011E-07	21	356.9516	0.1429388	11811.24	1986.531	4.864175E-19	27	791.6544	0.1408028	15578.96	2569.424	4.798502E-37	22	1017.514	0.4289801	788.1973	667.2604	0.5669733	23	61.24081	0.1454413	12651.54	2170.244	7.549506E-24	33	519.6588	0.1701064	13052.73	2695.964	2.645182E-31	28	418.3857	0.1313429	11654.58	1777.319	2.629411E-15	32	731.2261	0.151647	15919.83	2863.619	2.604924E-21	36	839.6917	0.1411457	10053.84	1668.701	8.85049E-15	27	604.236	0.1496914	17002.55	3010.795	3.678E-38	37	926.502	POMC	POMC_E254_F	4505948	NM_000939.1	POMC	5443	2	36.1	25244702	254	Y	GGCCCTCCAGCTCAGCTACTGGCGGCTTCTCATGCCGCAGTCGGCGCAG	MSH, POC, ACTH, CLIP	Proopiomelanocortin (adrenocorticotropin/beta-lipotropin); go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: neuropeptide signaling pathway; go_process: generation of precursor metabolites and energy	proopiomelanocortin
POMC_P400_R	1743	0.07584351	2390.586	204.397	0.1807428	31	96.71265	0.2916453	5399.935	2264.445	7.060881E-06	21	371.0423	0.264061	6373.696	2322.816	5.305116E-08	29	296.4542	0.03469177	4540.776	166.7827	0.02474986	33	190.9334	0.3328713	5023.785	2556.569	4.103861E-06	33	303.8103	0.4848047	3960.035	3820.539	2.874339E-07	27	457.1252	0.2808379	5401.931	2148.542	7.390476E-05	22	458.2373	0.3288884	6238.041	3106.054	2.579503E-05	33	306.7469	0.2660252	4775.06	1766.939	0.0001401137	22	313.6044	0.2345852	6800.625	2114.912	2.677199E-08	31	362.3021	POMC	POMC_P400_R	4505948	NM_000939.1	POMC	5443	2	36.1	25245356	-400	Y	TGGTTCGCATTTGGCGGTAAATATCACCGTCTGCACACGGGGAGGCCTCC	MSH, POC, ACTH, CLIP	Proopiomelanocortin (adrenocorticotropin/beta-lipotropin); go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: neuropeptide signaling pathway; go_process: generation of precursor metabolites and energy	proopiomelanocortin
POMC_P53_F	1741	0.05927711	5739.437	367.9563	2.588019E-05	28	192.6613	0.04394095	9342.882	433.9995	1.923122E-09	35	546.7659	0.04101321	13370.27	576.0864	2.830665E-21	31	577.2382	0.03296234	5173.557	179.7539	0.008475104	30	249.9731	0.04176072	11280.41	495.9659	8.55984E-15	30	773.5588	0.04195813	11037.92	487.7932	2.940117E-16	27	658.6209	0.04900635	11099.3	577.1196	1.807938E-11	28	590.702	0.04751386	12039.99	605.5916	1.59095E-09	25	445.4888	0.05505744	8339.378	491.7235	3.059851E-08	23	477.8849	0.03681188	12736.48	490.5947	1.333229E-18	33	523.9962	POMC	POMC_P53_F	4505948	NM_000939.1	POMC	5443	2	36.1	25245009	-53	Y	ACTTGCCGAGCTCTCCTGGTGGGCGCGGGACTTTGACCTTCCCGGCAGCAC	MSH, POC, ACTH, CLIP	Proopiomelanocortin (adrenocorticotropin/beta-lipotropin); go_component: extracellular region; go_component: soluble fraction; go_function: hormone activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: neuropeptide signaling pathway; go_process: generation of precursor metabolites and energy	proopiomelanocortin
PPARD_P846_F	4278	0.1418034	985.3196	179.3319	0.6421268	24	77.69104	0.1999222	3324.191	855.6314	0.03697665	26	128.9742	0.2254503	2545.86	770.1378	0.1285599	32	79.9406	0.2169027	424.7369	145.3419	0.7731803	38	18.27776	0.155394	3152.316	598.374	0.06320033	26	148.0617	0.1941293	3364.104	834.4816	0.02061292	30	127.8768	0.2242282	2920.896	873.1564	0.1106985	29	108.1367	0.2103053	3771.431	1031.01	0.07072873	20	122.7049	0.1751217	3235.078	708.0372	0.05380287	33	152.7309	0.2011856	2757.267	719.6174	0.0979117	44	93.79918	PPARD	PPARD_P846_F	29171748	NM_006238.2	PPARD	5467	6	36.1	35417518	-846	Y	GCTAGGTGTGGCCTAAGGAGCTTGCGGCCTACGGAAGGTGTGGCC	FAAR, NUC1, NUCI, NR1C2, NUCII, PPARB, MGC3931, PPAR-beta	isoform 1 is encoded by transcript variant 1; nuclear hormone receptor 1; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: fatty acid binding; go_function: enzyme activator activity; go_function: retinoid X receptor binding; go_function: sequence-specific DNA binding; go_function: prostacyclin receptor activity; go_function: transcription factor activity; go_function: transcriptional repressor activity; go_function: protein heterodimerization activity; go_function: steroid hormone receptor activity; go_process: apoptosis; go_process: transcription; go_process: lipid metabolism; go_process: cell proliferation; go_process: nerve ensheathment; go_process: decidualization; go_process: embryo implantation; go_process: fatty acid transport; go_process: epidermis development; go_process: glucose transport; go_process: cell proliferation; go_process: glucose metabolism; go_process: embryo implantation; go_process: fatty acid beta-oxidation; go_process: fatty acid catabolism; go_process: cholesterol metabolism; go_process: fatty acid beta-oxidation; go_process: fatty acid beta-oxidation; go_process: regulation of insulin secretion; go_process: generation of precursor metabolites and energy; go_process: positive regulation of fat cell differentiation; go_process: negative regulation of transcription from RNA polymerase II promoter	peroxisome proliferative activated receptor, delta isoform 1
PPARG_E178_R	1042	0.02652238	12197.98	335.0584	6.779702E-23	28	753.4139	0.05553474	10464.57	621.1989	3.688025E-12	30	382.3547	0.06052836	12071.82	784.2068	6.223102E-18	29	397.1949	0.03292781	9157.253	315.1999	1.799271E-07	30	474.8257	0.06312493	11037.44	750.4202	7.992727E-15	32	597.0926	0.06421497	10816.3	749.0928	2.245407E-16	35	427.3973	0.06133896	11488.98	757.3086	1.199539E-12	26	568.0723	0.04818955	14097.73	718.822	4.218501E-13	18	674.7923	0.06999404	7899.594	602.0648	1.242861E-07	32	404.9754	0.05936783	10624.41	676.8693	1.975297E-13	30	254.4741	PPARG	PPARG_E178_R	62865855	NM_005037.4	PPARG	5468	3	36.1	12304537	178	Y	CGCAGGTCAGAGTACGGGTGCCCGCGGCGCTCGGGAACCGGCTGCTGGCTGGGC	NR1C3, PPARG1, PPARG2, HUMPPARG	isoform 1 is encoded by transcript variant 4; PPAR gamma; peroxisome proliferator-activated receptor gamma 1; ppar gamma2; peroxisome proliferator activated-receptor gamma; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_process: transcription; go_process: lipid metabolism; go_process: signal transduction; go_process: response to nutrient; go_process: white fat cell differentiation; go_process: generation of precursor metabolites and energy; go_process: regulation of transcription from RNA polymerase II promoter	peroxisome proliferative activated receptor gamma isoform 1
PPARG_P693_F	4993	0.3523338	1009.576	603.6154	0.4855577	31	45.55867	0.7331089	2509.732	7168.534	2.971021E-09	34	241.2046	0.7312954	2501.182	7079.271	9.686609E-10	31	296.0257	0.033809	6796.511	241.323	0.0002392133	29	196.1125	0.7765969	1880.375	6884.207	4.026139E-08	23	471.6751	0.7935276	1836.662	7443.1	2.224908E-10	32	325.3031	0.7051819	2571.797	6390.729	9.614062E-07	29	346.9354	0.6924804	3135.037	7284.739	1.590318E-06	20	405.9319	0.780297	1907.933	7131.373	1.220933E-08	24	284.4021	0.7208459	2332.554	6281.465	9.476265E-08	29	272.5429	PPARG	PPARG_P693_F	62865855	NM_005037.4	PPARG	5468	3	36.1	12303666	-693	Y	CCCACTTTGGACAGGTCACGATGGACAGCGTGGCAGGAAAAGAAAAGGTCACT	NR1C3, PPARG1, PPARG2, HUMPPARG	isoform 1 is encoded by transcript variant 4; PPAR gamma; peroxisome proliferator-activated receptor gamma 1; ppar gamma2; peroxisome proliferator activated-receptor gamma; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_process: transcription; go_process: lipid metabolism; go_process: signal transduction; go_process: response to nutrient; go_process: white fat cell differentiation; go_process: generation of precursor metabolites and energy; go_process: regulation of transcription from RNA polymerase II promoter	peroxisome proliferative activated receptor gamma isoform 1
PPAT_E170_R	3810	0.2218532	2874.11	847.9326	0.02752182	26	142.3485	0.398715	4641.419	3144.059	4.695425E-06	35	414.7702	0.5079939	5177.637	5449.135	4.674676E-12	27	485.5005	0.8167103	522.4893	2773.715	0.1494943	29	194.794	0.4591515	4170.36	3625.308	1.877765E-06	33	551.3948	0.5562258	4231.544	5429.151	2.840467E-11	31	402.5142	0.5568538	3738.431	4823.34	3.611046E-06	34	408.1609	0.5513093	4666.326	5856.417	1.195372E-06	28	418.7601	0.3831352	4215.319	2680.248	4.648552E-05	29	272.7563	0.3584736	5540.566	3151.848	6.855648E-08	31	340.3454	PPAT	PPAT_E170_R	17388802	NM_006452.2	PAICS	10606	4	36.1	56996432	-266	Y	GCCGAAAGCACGTGGAAGGACCTGCCGCTGCGGCCAAGGTGTAAGCACCAACC	AIRC, PAIS, ADE2H1, DKFZp781N1372	AIR carboxylase; SAICAR synthetase; phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole succinocarboxamide synthetase; go_component: phosphoribosylaminoimidazole carboxylase complex; go_function: lyase activity; go_function: ligase activity; go_function: protein self binding; go_function: phosphoribosylaminoimidazole carboxylase activity; go_function: phosphoribosylaminoimidazolesuccinocarboxamide synthase activity; go_process: 'de novo' IMP biosynthesis; go_process: purine base biosynthesis; go_process: purine nucleotide biosynthesis	phosphoribosylaminoimidazole carboxylase
PPP2R1B_P268_R	2222	0.05089442	3547.69	195.6021	0.02634224	26	113.6835	0.1093765	8029.06	998.321	4.616107E-08	24	655.1264	0.10399	9875.111	1157.701	4.955035E-13	23	546.8924	0.04802889	3027.886	157.8083	0.1669907	34	163.8003	0.1498319	7662.891	1368.117	1.274908E-08	37	355.907	0.1277371	8301.685	1230.371	5.753944E-11	33	512.2881	0.1419929	8629.019	1444.579	1.676572E-08	34	460.8801	0.1232289	9117.6	1295.52	1.619755E-06	25	563.2394	0.1475036	7189.02	1261.187	1.538126E-07	29	331.35	0.1172527	10084.26	1352.745	9.149024E-14	30	475.7153	PPP2R1B	PPP2R1B_P268_R	32455243	NM_181699.1	PPP2R1B	5519	11	36.1	111142647	-268	Y	AAGACTCAGGCGGACCAAAGAGAGTGCCCGAGGCCAGGAGGAAAAAGGCTT	MGC26454	isoform b is encoded by transcript variant 2; protein phosphatase 2, structural/regulatory subunit A, beta; PP2A, subunit A, PR65-beta isoform; PP2A, subunit A, R1-beta isoform; serine/threonine protein phosphatase 2A, 65 kDa regulatory subunit A, beta isoform; go_component: cytosol; go_component: nucleus; go_component: membrane; go_component: mitochondrion; go_component: soluble fraction; go_component: microtubule cytoskeleton; go_component: protein phosphatase type 2A complex; go_function: binding; go_function: antigen binding; go_function: protein binding; go_function: hydrolase activity; go_function: phosphoprotein phosphatase activity; go_function: protein heterodimerization activity; go_function: protein phosphatase type 2A activity; go_function: protein phosphatase type 2A regulator activity; go_process: RNA splicing; go_process: ceramide metabolism; go_process: regulation of growth; go_process: induction of apoptosis; go_process: protein complex assembly; go_process: regulation of translation; go_process: regulation of cell adhesion; go_process: regulation of transcription; go_process: inactivation of MAPK activity; go_process: regulation of DNA replication; go_process: response to organic substance; go_process: negative regulation of cell growth; go_process: regulation of cell differentiation; go_process: second-messenger-mediated signaling; go_process: protein amino acid dephosphorylation; go_process: regulation of Wnt receptor signaling pathway; go_process: regulation of progression through cell cycle; go_process: negative regulation of tyrosine phosphorylation of Stat3 protein	beta isoform of regulatory subunit A, protein phosphatase 2 isoform b
PRDM2_P1340_R	1759	0.5932844	372.6216	689.4229	0.6757096	35	36.05178	0.9311737	527.7899	8493.576	4.729744E-08	21	533.4547	0.9359429	582.4156	9970.826	6.945807E-12	23	677.7166	0.1408566	759.0059	140.834	0.703012	26	42.20567	0.9388477	460.9026	8611.318	1.063307E-08	29	376.656	0.9342852	521.3265	8833.574	1.493875E-10	28	355.2701	0.9365645	471.9978	8445.001	1.121457E-06	32	441.9188	0.9406905	574.4171	10696.72	1.359463E-07	33	491.8845	0.908785	554.6952	6522.797	2.562E-05	21	495.5443	0.9315093	522.1577	8461.676	1.996395E-08	34	475.495	PRDM2	PRDM2_P1340_R	55953109	NM_001007257.1	PRDM2	7799	1	36.1	13902597	-1340	N	AGAAGTGGACTTCAGGTCTGTCCACGTTCCTTTCCACCTTTGGTTTTGTGACTT	RIZ, RIZ1, RIZ2, MTB-ZF, HUMHOXY1	isoform c is encoded by transcript variant 3; retinoblastoma protein-binding zinc finger protein; retinoblastoma protein-interacting zinc finger protein; MTE-binding protein; zinc-finger DNA-binding protein; GATA-3 binding protein G3B; go_component: nucleus; go_component: nucleus; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_function: zinc ion binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	retinoblastoma protein-binding zinc finger protein isoform c
PRKAR1A_P337_R	2791	0.04133687	5685.288	249.4575	4.941382E-05	31	342.8665	0.09409037	7747.378	815.0512	2.861172E-07	19	480.3853	0.08457109	9689.273	904.3733	5.589794E-12	31	495.6974	0.07149678	4659.107	366.4617	0.01489643	29	273.9397	0.09201699	8063.277	827.2844	2.349243E-08	37	471.766	0.1128004	7387.176	951.9349	2.371614E-08	27	792.4924	0.06987247	9432.531	716.0969	1.249945E-08	36	628.4628	0.07250189	10535.45	831.3659	1.016734E-07	27	475.2029	0.1108222	6499.142	822.4805	1.117651E-05	33	410.2225	0.07950489	10973.02	956.3973	5.133106E-15	28	418.0512	PRKAR1A	PRKAR1A_P337_R	47132582	NM_212472.1	PRKAR1A	5573	17	36.1	64019368	-337	Y	CCGTGCCTGGTTTCCACAGGGACGGTGTTGCCTGCACAGACGACAGCACC	CAR, CNC1, PKR1, TSE1, PRKAR1, MGC17251, DKFZp779L0468	tissue-specific extinguisher 1; cAMP-dependent protein kinase type I-alpha regulatory chain; cAMP-dependent protein kinase regulatory subunit RIalpha; protein kinase A type 1a regulatory subunit; go_component: cAMP-dependent protein kinase complex; go_function: 3',5'-cAMP binding; go_function: nucleotide binding; go_function: protein binding; go_function: cAMP-dependent protein kinase regulator activity; go_process: protein amino acid phosphorylation; go_process: intracellular signaling cascade; go_process: regulation of transcription from RNA polymerase II promoter	cAMP-dependent protein kinase, regulatory subunit alpha 1
PRKCDBP_E206_F	3824	0.2608958	7338.689	2625.778	3.461411E-14	27	489.7676	0.07176139	7432.862	582.3596	2.120765E-06	30	506.3347	0.05010793	11768.02	626.0522	1.309371E-16	23	503.0901	0.2186127	3681.176	1057.879	0.02357675	28	274.1164	0.05486441	8364.572	491.362	2.726623E-08	36	433.3572	0.1068102	8423.965	1019.32	9.305249E-11	25	872.7076	0.04982994	9603.643	508.8899	1.440066E-08	27	818.83	0.06924623	11928.67	894.9092	8.563943E-10	17	612.4133	0.05306515	6865.958	390.3643	1.400045E-05	26	390.3113	0.03816333	11225.62	449.3728	2.313551E-14	27	542.2654	PRKCDBP	PRKCDBP_E206_F	47132586	NM_145040.2	PRKCDBP	112464	11	36.1	6298110	206	Y	GCCCAGGCCGCTCTGGATGCGGCGCACGGACCCTGCCAGGCCTCC	SRBC, HSRBC, MGC20400	sdr-related gene product that binds to c-kinase; go_function: kinase activity	protein kinase C, delta binding protein
PRKCDBP_P352_R	1762	0.07142546	6202.175	484.76	2.500689E-06	28	311.2713	0.1289853	8140.111	1220.247	1.166309E-08	28	444.4491	0.2005811	8964.913	2274.466	1.523642E-13	29	666.7601	0.06625339	4036.805	293.5244	0.04300328	18	201.0203	0.2269492	7983.725	2373.188	2.283021E-11	36	351.4688	0.2003489	7663.383	1945.079	3.788344E-11	44	431.8466	0.1737181	8955.274	1903.787	6.82467E-10	24	475.2833	0.2230822	10276.7	2979.539	1.823238E-10	29	453.2338	0.2396852	5647.632	1811.911	6.888687E-06	37	303.82	0.2202548	9637.276	2750.491	3.103002E-16	35	498.9289	PRKCDBP	PRKCDBP_P352_R	47132586	NM_145040.2	PRKCDBP	112464	11	36.1	6298668	-352	Y	TGGGCGCAGAGACTGTGTTGGCACGGCAAAGAGATAACCAGAGGGGCCT	SRBC, HSRBC, MGC20400	sdr-related gene product that binds to c-kinase; go_function: kinase activity	protein kinase C, delta binding protein
PROK2_E0_F	3826	0.5193487	4860.498	5359.869	5.924374E-15	24	673.0831	0.05495726	8717.683	512.7765	2.008549E-08	33	500.5596	0.05850624	10240.68	642.5897	1.145436E-12	28	473.564	0.1524028	7373.338	1343.748	2.176769E-06	30	643.5354	0.06227595	7282.922	490.3132	2.039611E-06	30	758.2781	0.05464496	9959.99	581.5041	1.679698E-13	31	619.3103	0.0603212	10008.48	648.8983	1.594939E-09	21	468.712	0.05689759	10596.68	645.333	1.484346E-07	36	618.2695	0.06657358	7600.803	549.2346	5.171258E-07	19	512.4545	0.0663856	8283.688	596.1306	3.117992E-08	26	254.1262	PROK2	PROK2_E0_F	24475653	NM_021935.2	PROK2	60675	3	36.1	71916902	0	Y	CAGGCTCCTCATGGCGCCCTCGGGACTGGGCGGCCGCCGGAGGCAG	BV8, PK2, MIT1	go_component: extracellular region; go_function: G-protein-coupled receptor binding; go_process: chemotaxis; go_process: angiogenesis; go_process: rhythmic process; go_process: anti-apoptosis; go_process: spermatogenesis; go_process: cell proliferation; go_process: inflammatory response; go_process: neuropeptide signaling pathway; go_process: sensory perception of pain; go_process: activation of MAPK activity; go_process: elevation of cytosolic calcium ion concentration; go_process: positive regulation of smooth muscle contraction	prokineticin 2
PROK2_P390_F	1765	0.03389939	4830.723	173.0135	0.00109738	29	180.4246	0.04061207	8772.441	375.5813	2.823004E-08	29	579.8094	0.02709239	11781.02	330.8486	7.909867E-16	21	560.1782	0.09159876	2569.279	269.1571	0.2301444	20	134.9198	0.02403871	10444.99	259.7316	3.677489E-12	24	454.9953	0.0279861	9931.827	288.8351	1.155949E-12	30	938.9058	0.03288827	11548.83	396.1381	5.129308E-12	24	635.2913	0.03593596	11849.21	445.4128	5.239985E-09	26	572.5573	0.0392489	7526.365	311.5547	1.725333E-06	44	478.7127	0.03231205	11134.15	375.1191	6.047441E-14	29	599.5948	PROK2	PROK2_P390_F	24475653	NM_021935.2	PROK2	60675	3	36.1	71917292	-390	Y	CCGGAACCGCTTTTGTGGTCTCCGAGACACTCATTTGCTGTCCTGGTTTCCAA	BV8, PK2, MIT1	go_component: extracellular region; go_function: G-protein-coupled receptor binding; go_process: chemotaxis; go_process: angiogenesis; go_process: rhythmic process; go_process: anti-apoptosis; go_process: spermatogenesis; go_process: cell proliferation; go_process: inflammatory response; go_process: neuropeptide signaling pathway; go_process: sensory perception of pain; go_process: activation of MAPK activity; go_process: elevation of cytosolic calcium ion concentration; go_process: positive regulation of smooth muscle contraction	prokineticin 2
PROM1_P44_R	5933	0.579159	1328.146	1965.407	0.06226077	38	101.577	0.8110406	2630.688	11720.5	1.188691E-20	30	889.1319	0.8675904	2124.353	14574.68	4.367127E-31	26	991.9013	0.0341302	3923.041	142.1591	0.06142017	37	145.4186	0.8554466	1928.934	12006.95	5.653289E-21	30	1019.329	0.7328284	3851.275	10838.01	4.882324E-27	35	762.6942	0.873714	1959.514	14248.82	1.227981E-22	20	1097.335	0.8688312	2214.186	15328.63	1.646856E-18	32	676.6384	0.7832304	1877.735	7145.936	1.309306E-08	25	335.8307	0.8914608	1717.245	14925.51	4.778152E-30	31	862.172	PROM1	PROM1_P44_R	5174386	NM_006017.1	PROM1	8842	4	36.1	15686708	-44	N	GGAAGCCTTGGGGAAGGCAAGCGTGTTCCTGGGCAGAAGAGGA	AC133, CD133, PROML1, MSTP061	hProminin; prominin (mouse)-like 1; hematopoietic stem cell antigen; go_component: membrane; go_component: integral to plasma membrane; go_process: visual perception; go_process: sensory perception	prominin 1
PRSS1_E45_R	3060	0.7477121	1993.089	6203.342	1.692636E-09	32	225.4784	0.814276	2496.693	11384.77	2.80393E-19	29	602.6021	0.8249841	2726.974	13325.69	1.32206E-28	27	869.2159	0.3391305	5026.345	2630.625	4.838025E-05	29	327.7203	0.8200367	2287.51	10879.14	1.224604E-18	15	633.1013	0.7930802	2192.528	8786.776	1.080831E-14	22	739.0591	0.8241776	2420.597	11815.44	2.857692E-17	41	590.9437	0.8123301	2878.564	12892.73	7.040277E-15	32	778.3605	0.7800217	2345.899	8672.919	5.456782E-13	19	734.6226	0.8305474	2532.984	12905.19	1.118308E-25	22	756.4608	PRSS1	PRSS1_E45_R	21071011	NM_002769.2	PRSS1	5644	7	36.1	142136949	45	N	CTGATCCTTACCTTTGTGGCAGCTGCTCGTGAGTATCATGCCCTGCCTCAGGCCC	TRP1, TRY1, TRY4, TRYP1, MGC120175	trypsinogen A; trypsinogen 1; trypsin 1; trypsin I; cationic trypsinogen; protease serine 1; serine protease 1; nonfunctional trypsin 1; digestive zymogen; go_component: extracellular region; go_function: trypsin activity; go_function: hydrolase activity; go_function: peptidase activity; go_function: calcium ion binding; go_function: trypsin activity; go_process: digestion; go_process: proteolysis	protease, serine, 1 preproprotein
PRSS1_P1249_R	2247	0.534351	354.9855	522.1142	0.7326387	30	31.43493	0.8691964	786.1083	5888.233	0.0001495557	38	394.001	0.8906349	885.2032	8023.185	2.119077E-08	30	421.5059	0.1278186	934.5821	151.6185	0.6594108	24	52.57934	0.845089	1140.762	6768.752	1.22891E-06	31	388.2005	0.7918732	1297.976	5318.965	2.688965E-05	31	680.6512	0.869947	1131.034	8234.602	2.360559E-07	20	691.4765	0.871668	1178.481	8683.815	7.046438E-06	25	550.4441	0.800662	1161.99	5068.915	0.0003486032	34	441.7222	0.8810112	818.6461	6801.793	4.252271E-06	27	361.9174	PRSS1	PRSS1_P1249_R	21071011	NM_002769.2	PRSS1	5644	7	36.1	142135655	-1249	N	TAGCCCCCTGGCCAGGTCCGATTTCAACACCAAGTTTCTGAGCTTTT	TRP1, TRY1, TRY4, TRYP1, MGC120175	trypsinogen A; trypsinogen 1; trypsin 1; trypsin I; cationic trypsinogen; protease serine 1; serine protease 1; nonfunctional trypsin 1; digestive zymogen; go_component: extracellular region; go_function: trypsin activity; go_function: hydrolase activity; go_function: peptidase activity; go_function: calcium ion binding; go_function: trypsin activity; go_process: digestion; go_process: proteolysis	protease, serine, 1 preproprotein
PRSS1_P1378_F	2236	0.07118545	3110.906	246.0877	0.05561436	26	162.4306	0.2360695	280.634	117.6234	0.8379623	21	15.55519	0.888502	344.4758	3541.927	0.05743353	28	174.437	0.1319006	1026.201	171.117	0.6323101	31	63.95472	0.8780642	353.7982	3267.817	0.07640878	27	187.1583	0.8930904	297.0228	3316.61	0.05960353	26	146.4815	0.2254599	329.4727	125.0147	0.8562776	31	18.94445	0.2817994	308.8767	160.4304	0.8387384	26	20.81916	0.8079167	340.5153	1852.841	0.4026929	32	114.0125	0.860881	305.7119	2510.581	0.2147753	27	128.9823	PRSS1	PRSS1_P1378_F	21071011	NM_002769.2	PRSS1	5644	7	36.1	142135526	-1378	N	GCTGTGGGGAAGCTGGCTCAGCGGCCATACCAGGAGCTGAAACCGAAG	TRP1, TRY1, TRY4, TRYP1, MGC120175	trypsinogen A; trypsinogen 1; trypsin 1; trypsin I; cationic trypsinogen; protease serine 1; serine protease 1; nonfunctional trypsin 1; digestive zymogen; go_component: extracellular region; go_function: trypsin activity; go_function: hydrolase activity; go_function: peptidase activity; go_function: calcium ion binding; go_function: trypsin activity; go_process: digestion; go_process: proteolysis	protease, serine, 1 preproprotein
PRSS8_E134_R	3828	0.8602954	1267.785	8422.767	2.163493E-13	29	319.6758	0.96578	637.2487	20807.12	3.678E-38	26	1527.166	0.9766703	573.0794	28177.6	3.678E-38	24	977.4874	0.887716	520.9942	4909.571	0.007375114	29	228.405	0.9656794	551.7654	18338.75	3.678E-38	35	1511.725	0.964442	646.1971	20239.14	3.678E-38	20	1923.696	0.9620955	795.1073	22719.7	3.678E-38	31	1938.328	0.9666911	822.1686	26763.19	3.678E-38	26	1505.464	0.9336542	899.5529	14066.24	1.085184E-24	31	862.3128	0.972669	669.4552	27383.77	3.678E-38	30	1353.687	PRSS8	PRSS8_E134_R	21536453	NM_002773.2	PRSS8	5652	16	36.1	31054518	134	Y	GGGAGACGCCTGGAGTATCCGAAGCGAGCAGTGTGGACGAGTCACCAGCACCG	CAP1, PROSTASIN	channel-activating protease 1; go_component: plasma membrane; go_component: integral to membrane; go_component: extracellular space; go_function: serine-type endopeptidase activity; go_process: proteolysis	prostasin preproprotein
PSCA_E359_F	5698	0.09701293	3413.507	377.4756	0.02384805	22	82.04793	0.1401305	9711.142	1598.894	1.153286E-12	27	691.5339	0.177398	11763.46	2558.412	1.696066E-22	31	632.6979	0.1313706	4311.687	667.2192	0.01608753	32	153.0804	0.1768063	8590.675	1866.591	1.35773E-11	28	642.9839	0.2168075	9481.646	2652.442	4.196626E-18	38	579.8246	0.2666376	8468.255	3115.265	2.774062E-11	27	784.6567	0.1439021	9518.916	1616.851	2.040601E-07	20	574.6966	0.1745493	7453.852	1597.333	1.157691E-08	32	467.3004	0.2525119	9902.228	3378.892	9.257358E-19	25	419.7888	PSCA	PSCA_E359_F	29893565	NM_005672.2	PSCA	8000	8	36.1	143759274	359	N	TCCTAGGGGGCAGGTAGACAGACTGACGGATGGATGGGCAGAGATGC	PRO232	go_component: plasma membrane	prostate stem cell antigen
PSCA_P135_F	5131	0.1276159	9161.036	1354.742	7.243334E-16	26	470.173	0.9307247	1091.357	16006.08	1.068851E-29	26	1057.914	0.9394025	1470.795	24350.99	3.678E-38	23	1662.968	0.5638764	3586.809	4766.778	6.64155E-06	22	199.9576	0.9235293	1538.701	19790.44	3.678E-38	40	1078.353	0.89249	2352.634	20360.43	3.678E-38	30	1218.975	0.8963478	1890.206	17210.6	6.316451E-32	28	1065.237	0.9188398	2224.136	26312.25	3.678E-38	31	1206.827	0.8725243	1925.852	13866.21	1.181361E-27	32	1197.293	0.9244006	1329.712	17481.96	3.678E-38	38	661.8306	PSCA	PSCA_P135_F	29893565	NM_005672.2	PSCA	8000	8	36.1	143758780	-135	N	AAGGGAGAGGGAGGTGCAGGTCGCTCAGGGAGGAGACTCGGAC	PRO232	go_component: plasma membrane	prostate stem cell antigen
PSIP1_P163_R	2795	0.09119428	2682.581	279.2186	0.1074968	36	92.24948	0.03117505	8996.861	292.7207	1.570041E-08	31	620.4406	0.02964127	10206.13	314.8185	8.256657E-12	22	655.4752	0.1613261	1629.924	332.7658	0.4348651	32	80.09349	0.03690517	9829.349	380.4862	4.839065E-11	24	604.1691	0.03263989	10551.57	359.3969	1.672646E-14	37	589.8094	0.03650627	10840.88	414.544	1.219005E-10	26	473.4615	0.03149117	12824.82	420.2519	1.898898E-10	30	317.9721	0.0538819	7017.036	405.3188	7.85738E-06	32	485.1667	0.04917935	13390.66	697.7779	3.26103E-21	36	561.3911	PSIP1	PSIP1_P163_R	19923652	NM_033222.2	PSIP1	11168	9	36.1	15501145	-163	Y	ACAGGTGCATGCAGATGGAGAGGAAGACGCAAGCGAAGAAGAAAGGACTGG	p52, p75, PAIP, DFS70, LEDGF, PSIP2, MGC74712	isoform 2 is encoded by transcript variant 2; transcriptional coactivator p52/p75; PC4 and SFRS1 interacting protein 2; go_component: nucleus; go_function: DNA binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	PC4 and SFRS1 interacting protein 1 isoform 2
PTCH_E42_F	4157	0.1129805	4466.903	581.6907	0.0009592599	22	180.8392	0.02864572	12697.84	377.4148	4.843789E-17	31	884.3415	0.02303844	17534.36	415.8488	3.374718E-36	26	832.9818	0.05828957	2884.795	184.7515	0.1867468	20	108.7287	0.02500492	13328.26	344.3838	3.701192E-20	39	782.8959	0.0268316	12533	348.3092	1.615009E-20	33	812.0327	0.02408041	14163.63	351.949	5.532654E-18	23	957.4	0.02974269	17416.91	536.9711	2.052097E-19	19	1109.086	0.04452233	8276.443	390.3166	6.206161E-08	22	425.0321	0.03323071	11669.09	404.5384	2.150709E-15	23	676.2101	PTCH	PTCH_E42_F	25121959	NM_000264.2	PTCH	5727	9	36.1	97310610	42	Y	GCAGGCTGCTCGGGCTCGGGCTCCGGTTGACAGACCAGCCGCTGCTGCTGCTCA	PTC, BCNS, HPE7, PTC1, NBCCS, patched	patched (Drosophila) homolog; go_component: membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: hedgehog receptor activity; go_process: cell cycle; go_process: morphogenesis; go_process: cell proliferation; go_process: signal transduction; go_process: negative regulation of progression through cell cycle	patched
PTCH2_E173_F	969	0.1809652	4065.899	920.4529	0.001155644	38	168.8477	0.4311381	7450.238	5722.294	2.649529E-17	35	673.1606	0.4048105	9648.683	6630.441	1.838189E-29	27	480.9807	0.6534425	1032.633	2135.607	0.1698703	30	125.3589	0.3625287	7844.686	4518.126	2.343787E-16	34	716.5917	0.4598663	6772.53	5851.228	1.145332E-19	29	747.0824	0.406305	6720.838	4667.954	6.718293E-11	36	847.4695	0.3810664	10009.02	6223.945	8.770639E-16	27	737.6211	0.4360825	4861.926	3837.102	5.40835E-08	38	723.3125	0.4148907	8816.077	6322.234	1.201767E-24	29	1263.453	PTCH2	PTCH2_E173_F	52145304	NM_003738.3	PTCH2	8643	1	36.1	45081030	173	Y	CTTGCCTTCAGACATCTAATGACACTCGGCACTTCAAGACATCACAAACCTTGC	.	patched (Drosophila) homolog 2; go_component: membrane; go_component: integral to plasma membrane; go_function: hedgehog receptor activity; go_function: transmembrane receptor activity; go_process: spermatogenesis; go_process: epidermis development; go_process: protein complex assembly	patched 2
PTCH2_P37_F	5025	0.1545831	4846.209	904.4064	9.607413E-05	22	201.2112	0.1489306	10213.37	1804.76	2.467383E-14	31	592.1319	0.1199548	11562.41	1589.648	8.262154E-19	34	513.8633	0.08377195	6763.287	627.5195	9.803376E-05	33	230.0585	0.1575101	8867.046	1676.459	8.64677E-12	22	521.9346	0.1757912	9719.35	2094.318	4.05839E-17	21	635.7034	0.1516116	10725.38	1934.555	1.52475E-13	27	664.0889	0.137021	11415.31	1828.363	1.908588E-10	25	795.4482	0.1571854	7204.855	1362.359	9.451505E-08	24	531.0748	0.1057834	12593.26	1501.579	3.113415E-21	18	1068.182	PTCH2	PTCH2_P37_F	52145304	NM_003738.3	PTCH2	8643	1	36.1	45081240	-37	Y	CCCAACCCGCGTTATCTGGGCGCTCCCATAGGCTAGCCCGGTCTCC	.	patched (Drosophila) homolog 2; go_component: membrane; go_component: integral to plasma membrane; go_function: hedgehog receptor activity; go_function: transmembrane receptor activity; go_process: spermatogenesis; go_process: epidermis development; go_process: protein complex assembly	patched 2
PTCH2_P568_R	4292	0.06037154	3516.1	232.336	0.02606312	31	148.318	0.1803276	10739.8	2384.753	3.56995E-17	19	779.0341	0.1662362	13571.06	2725.742	1.573727E-29	19	1120.601	0.1153541	7027.051	929.3374	2.111531E-05	23	316.4965	0.1761389	11418.1	2462.534	8.414046E-21	32	970.9594	0.3135375	10214.36	4711.019	5.840435E-28	23	865.1493	0.1645953	11607.56	2306.678	1.809085E-16	37	718.1167	0.1902441	15773.82	3729.395	4.934688E-23	36	604.7583	0.204556	7692.921	2004.024	5.667944E-10	19	958.8578	0.1383399	15123.37	2444.118	1.198113E-33	25	965.567	PTCH2	PTCH2_P568_R	52145304	NM_003738.3	PTCH2	8643	1	36.1	45081771	-568	Y	CGCCGGCCAAGTGTAAGTCCAGAGGCTTACGCTGAGAAAGGGCCTTTGCG	.	patched (Drosophila) homolog 2; go_component: membrane; go_component: integral to plasma membrane; go_function: hedgehog receptor activity; go_function: transmembrane receptor activity; go_process: spermatogenesis; go_process: epidermis development; go_process: protein complex assembly	patched 2
PTEN_P438_F	2827	0.03407701	5551.052	199.3647	9.614167E-05	27	177.1301	0.05903897	10044.75	636.5146	2.807461E-11	36	458.02	0.06867364	10798.91	803.6583	1.801744E-14	29	1002.325	0.03826359	3667.284	149.8849	0.08374929	33	113.4812	0.06613391	8767.174	627.9496	2.480619E-09	42	353.0743	0.05486077	10459.67	612.938	5.923969E-15	28	814.3425	0.05420312	10561.34	610.9957	1.759567E-10	37	437.6624	0.07489453	12054.84	984.0293	3.995497E-10	23	617.0842	0.07590465	6694.984	558.136	1.415504E-05	22	416.3475	0.06495145	13943.39	975.4987	6.609699E-24	35	826.9825	PTEN	PTEN_P438_F	73765543	NM_000314.3	PTEN	5728	10	36.1	89612737	-438	Y	AAAGGAAAGAGCGAATGCAGTCCACGCCGCGGAAATCTAGGGGTAGAGGCAAG	BZS, MHAM, TEP1, MMAC1, PTEN1, MGC11227	tensin homolog; MMAC1 phosphatase and tension homolog deleted on chromosome 10; mutated in multiple advanced cancers 1; go_component: cytoplasm; go_component: cytoplasm; go_function: hydrolase activity; go_function: protein binding; go_function: PDZ domain binding; go_function: PDZ domain binding; go_function: protein tyrosine phosphatase activity; go_function: phosphatidylinositol-3-phosphatase activity; go_function: protein serine/threonine phosphatase activity; go_function: protein tyrosine/serine/threonine phosphatase activity; go_function: inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity; go_function: phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity; go_function: phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity; go_function: phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity; go_process: cell cycle; go_process: cell migration; go_process: heart development; go_process: cell proliferation; go_process: induction of apoptosis; go_process: central nervous system development; go_process: regulation of protein stability; go_process: phosphoinositide dephosphorylation; go_process: phosphoinositide dephosphorylation; go_process: inositol phosphate dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: negative regulation of cell migration; go_process: negative regulation of cell proliferation; go_process: negative regulation of focal adhesion formation; go_process: negative regulation of progression through cell cycle; go_process: regulation of cyclin dependent protein kinase activity; go_process: negative regulation of protein kinase B signaling cascade	phosphatase and tensin homolog
PTGS1_E80_F	1051	0.4457721	5311.803	4352.776	2.566245E-13	31	257.4278	0.05920891	11722.59	744.0573	1.883987E-15	26	1000.739	0.06136088	12066.59	795.3567	5.979518E-18	27	886.2672	0.4101063	3700.235	2642.002	0.00119723	31	255.8446	0.07317928	10960.01	873.2685	6.09015E-15	31	584.2471	0.05785762	13245.46	819.554	1.117191E-24	26	710.2823	0.09400751	11178.18	1170.246	7.261028E-13	23	1054.501	0.074554	14692.28	1191.667	4.261516E-15	39	630.4575	0.09539906	8811.491	939.8043	4.347805E-10	33	403.2603	0.0548895	14100.78	824.7435	6.280182E-24	35	457.7279	PTGS1	PTGS1_E80_F	18104966	NM_000962.2	PTGS1	5742	9	36.1	124173130	80	Y	GGCTGGAGCTCCGGGCAGTGTGCGAGGCGCACGCACAGGAGCCTGCACTC	COX1, COX3, PHS1, PCOX1, PGHS1, PTGHS, PGG/HS, PGHS-1	isoform 1 precursor is encoded by transcript variant 1; prostaglandin G/H synthase and cyclooxygenase; go_component: nucleus; go_component: membrane; go_component: cytoplasm; go_component: microsome; go_function: iron ion binding; go_function: metal ion binding; go_function: peroxidase activity; go_function: oxidoreductase activity; go_function: prostaglandin-endoperoxide synthase activity; go_function: oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen; go_process: lipid metabolism; go_process: fatty acid biosynthesis; go_process: blood pressure regulation; go_process: physiological process; go_process: prostaglandin biosynthesis; go_process: keratinocyte differentiation	prostaglandin-endoperoxide synthase 1 isoform 1 precursor
PTGS1_P2_F	4295	0.102118	5366.608	621.7289	4.052392E-05	39	213.5378	0.07039729	10421.55	796.78	1.861087E-12	21	820.9959	0.0506334	13742.88	738.2946	5.009459E-23	34	574.6526	0.04734218	5095.352	258.1822	0.008471721	31	244.3598	0.07227663	11883.8	933.6284	1.256814E-17	31	568.158	0.05081638	12478.66	673.423	1.962344E-21	18	831.9564	0.05587875	11033.74	658.9612	1.676624E-11	25	946.2729	0.06506181	12644.86	886.9072	6.601914E-11	21	1097.238	0.07582193	7871.965	654.0404	1.123009E-07	31	475.6412	0.06570403	12154.96	861.8257	5.424969E-18	38	609.1967	PTGS1	PTGS1_P2_F	18104966	NM_000962.2	PTGS1	5742	9	36.1	124173048	-2	Y	TGGGCAGAGGAAGTAAGCGGGCAGCCGAGGTGACAGCTGGAGGGAG	COX1, COX3, PHS1, PCOX1, PGHS1, PTGHS, PGG/HS, PGHS-1	isoform 1 precursor is encoded by transcript variant 1; prostaglandin G/H synthase and cyclooxygenase; go_component: nucleus; go_component: membrane; go_component: cytoplasm; go_component: microsome; go_function: iron ion binding; go_function: metal ion binding; go_function: peroxidase activity; go_function: oxidoreductase activity; go_function: prostaglandin-endoperoxide synthase activity; go_function: oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen; go_process: lipid metabolism; go_process: fatty acid biosynthesis; go_process: blood pressure regulation; go_process: physiological process; go_process: prostaglandin biosynthesis; go_process: keratinocyte differentiation	prostaglandin-endoperoxide synthase 1 isoform 1 precursor
PTGS2_P308_F	2831	0.1847066	3420.24	797.5184	0.009112912	18	161.9797	0.1825708	9353.312	2111.374	5.094268E-13	26	587.9841	0.1275815	11140.86	1643.851	1.004254E-17	24	424.0587	0.03277513	9462.78	324.0419	5.944807E-08	39	683.1223	0.1635556	8113.995	1606.137	5.398117E-10	19	415.6913	0.2611924	8025.806	2872.735	1.810302E-14	26	685.9487	0.1217864	10666.16	1492.999	1.833782E-12	31	694.6224	0.1446301	11755.66	2004.612	2.791893E-11	31	447.972	0.2779403	6352.92	2483.904	2.984569E-08	33	460.9838	0.09515913	12975.41	1375.098	4.808962E-22	32	580.3369	PTGS2	PTGS2_P308_F	4506264	NM_000963.1	PTGS2	5743	1	36.1	184916487	-308	Y	CCGCCAGATGTCTTTTCTTCTTCGCAGTCTTTGCCCGAGCGCTTCCGA	COX2, COX-2, PHS-2, PGG/HS, PGHS-2, hCox-2	prostaglandin G/H synthase and cyclooxygenase; cyclooxygenase 2b; go_component: nucleus; go_component: membrane; go_component: cytoplasm; go_component: cytoplasm; go_function: iron ion binding; go_function: metal ion binding; go_function: oxidoreductase activity; go_function: peroxidase activity; go_function: prostaglandin-endoperoxide synthase activity; go_function: oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen; go_process: cell motility; go_process: fatty acid biosynthesis; go_process: blood pressure regulation; go_process: physiological process; go_process: cyclooxygenase pathway; go_process: keratinocyte differentiation; go_process: regulation of inflammatory response	prostaglandin-endoperoxide synthase 2 precursor
PTGS2_P524_R	2829	0.07489848	4720.129	390.2495	0.0007950703	41	211.3381	0.1731411	9021.711	1910.051	8.069172E-12	28	618.2017	0.1515018	11059.28	1992.522	1.646679E-18	28	560.9196	0.03167507	5926.461	197.1328	0.001908055	30	231.4457	0.1282101	9770.746	1451.645	2.13528E-13	26	749.4909	0.2134806	10242.59	2807.232	4.375386E-21	24	705.4734	0.1563756	9991.302	1870.541	7.602378E-12	26	559.5413	0.1500051	11208.92	1995.772	2.199006E-10	24	814.0418	0.1754477	7145.602	1541.715	5.685692E-08	25	511.6149	0.1445688	13326	2269.009	3.164014E-26	48	537.2884	PTGS2	PTGS2_P524_R	4506264	NM_000963.1	PTGS2	5743	1	36.1	184916703	-524	Y	AAGTCACGTCGGGACAGACTGGGGCGAGTAAGGTTAAGAAAGGCTGACATG	COX2, COX-2, PHS-2, PGG/HS, PGHS-2, hCox-2	prostaglandin G/H synthase and cyclooxygenase; cyclooxygenase 2b; go_component: nucleus; go_component: membrane; go_component: cytoplasm; go_component: cytoplasm; go_function: iron ion binding; go_function: metal ion binding; go_function: oxidoreductase activity; go_function: peroxidase activity; go_function: prostaglandin-endoperoxide synthase activity; go_function: oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen; go_process: cell motility; go_process: fatty acid biosynthesis; go_process: blood pressure regulation; go_process: physiological process; go_process: cyclooxygenase pathway; go_process: keratinocyte differentiation; go_process: regulation of inflammatory response	prostaglandin-endoperoxide synthase 2 precursor
PTHLH_E251_F	973	0.08994725	2413.703	248.4478	0.1654034	38	86.48706	0.3518976	7110.729	3915.18	5.007372E-12	29	581.4728	0.3106965	9203.705	4193.549	1.491247E-19	20	721.2308	0.1662224	4521.413	921.3278	0.00721375	42	210.39	0.3213734	7629.162	3660.255	1.460544E-13	36	369.9018	0.3664097	7518.384	4405.766	1.870493E-17	36	611.3711	0.2610044	8009.261	2864.094	6.42167E-10	28	482.2511	0.2702451	10019.65	3747.542	2.719351E-11	28	591.0441	0.3730593	5243.288	3179.509	1.721989E-07	30	442.8729	0.3047807	9668.186	4282.325	8.789544E-21	28	491.0717	PTHLH	PTHLH_E251_F	39995088	NM_198964.1	PTHLH	5744	12	36.1	28015932	251	N	CCTCAGTTCATTACTGTAAACCCCGTACCTTAAAAGACTCGGCTTCTTCTCAC	HHM, PLP, PTHR, PTHRP, MGC14611	isoform 2 preproprotein is encoded by transcript variant 3; parathyroid-like protein; parathyroid hormone-like protein; parathyroid hormone-related protein; PTH-related protein; osteostatin; humoral hypercalcemia of malignancy; parathyroid hormone-like related protein; go_component: nucleus; go_component: cytoplasm; go_component: extracellular space; go_function: calcium ion binding; go_function: hormone activity; go_process: lactation; go_process: pregnancy; go_process: cAMP metabolism; go_process: cell-cell signaling; go_process: epidermis development; go_process: negative regulation of cell proliferation; go_process: positive regulation of cell proliferation	parathyroid hormone-like hormone isoform 2 preproprotein
PTHLH_P15_R	5037	0.1459679	943.7792	178.3987	0.6561803	20	44.10061	0.5941379	3446.017	5190.983	2.151622E-07	26	241.8495	0.556273	3727.821	4798.702	1.086906E-07	26	260.1965	0.8991613	757.2377	7643.84	5.758647E-06	28	277.8177	0.5865356	3053.143	4473.011	4.976036E-06	25	409.1837	0.6380576	3121.176	5678.519	2.594655E-09	28	341.1729	0.5546476	3700.434	4733.108	5.431154E-06	24	307.1979	0.656197	3041.802	5996.577	5.335807E-05	23	483.8424	0.5454031	3595.697	4433.917	8.287444E-07	26	314.5006	0.5625684	3535.074	4674.966	4.756774E-07	30	238.5501	PTHLH	PTHLH_P15_R	39995088	NM_198964.1	PTHLH	5744	12	36.1	28016198	-15	N	TCCAAAAAGATGCAGGAGCCCTAATGTAATCGTTAGATCTGAAGGGGGAAAT	HHM, PLP, PTHR, PTHRP, MGC14611	isoform 2 preproprotein is encoded by transcript variant 3; parathyroid-like protein; parathyroid hormone-like protein; parathyroid hormone-related protein; PTH-related protein; osteostatin; humoral hypercalcemia of malignancy; parathyroid hormone-like related protein; go_component: nucleus; go_component: cytoplasm; go_component: extracellular space; go_function: calcium ion binding; go_function: hormone activity; go_process: lactation; go_process: pregnancy; go_process: cAMP metabolism; go_process: cell-cell signaling; go_process: epidermis development; go_process: negative regulation of cell proliferation; go_process: positive regulation of cell proliferation	parathyroid hormone-like hormone isoform 2 preproprotein
PTHLH_P757_F	4301	0.3276097	3028.869	1524.484	0.003900789	25	230.8578	0.8259538	2361.659	11682.05	9.536485E-20	29	552.1968	0.8142514	2960.803	13417.4	7.678876E-30	22	753.1966	0.3249176	2892.218	1440.157	0.04288083	16	193.2224	0.8091969	2331.962	10313.97	3.843331E-17	19	521.4709	0.8304093	2143.284	10984.36	2.378474E-21	26	701.812	0.8035842	2564.718	10902	2.175278E-15	21	718.457	0.8042947	2786.518	11862.79	8.387612E-13	25	762.5499	0.8202227	1706.165	8240.517	1.652057E-10	28	572.3832	0.7851787	3004.849	11348.32	4.715359E-22	28	652.5569	PTHLH	PTHLH_P757_F	39995088	NM_198964.1	PTHLH	5744	12	36.1	28016940	-757	N	CCAAGCTGCCCTGTTTATTACTTTCCGTAGAAATTCTCCTCAATATATACCCA	HHM, PLP, PTHR, PTHRP, MGC14611	isoform 2 preproprotein is encoded by transcript variant 3; parathyroid-like protein; parathyroid hormone-like protein; parathyroid hormone-related protein; PTH-related protein; osteostatin; humoral hypercalcemia of malignancy; parathyroid hormone-like related protein; go_component: nucleus; go_component: cytoplasm; go_component: extracellular space; go_function: calcium ion binding; go_function: hormone activity; go_process: lactation; go_process: pregnancy; go_process: cAMP metabolism; go_process: cell-cell signaling; go_process: epidermis development; go_process: negative regulation of cell proliferation; go_process: positive regulation of cell proliferation	parathyroid hormone-like hormone isoform 2 preproprotein
PTHR1_E36_R	3833	0.1666054	834.6544	186.8484	0.6886125	30	36.97535	0.9105692	1085.72	12072.8	2.890999E-17	26	991.2645	0.9259038	1028.401	14100.47	3.008883E-25	32	670.8649	0.2227323	615.3519	204.9898	0.7208012	27	53.84567	0.9119735	952.1008	10899.99	5.439654E-15	30	633.0872	0.900538	1159.67	11405.17	1.781607E-19	26	840.3397	0.9163849	1081.775	12951.75	9.179341E-17	28	872.3517	0.923646	1259.659	16447.64	7.203381E-19	22	925.8392	0.8770261	1136.624	8819.369	1.576706E-10	31	814.3954	0.9203539	916.7789	11749.44	5.320818E-17	32	601.9359	PTHR1	PTHR1_E36_R	39995096	NM_000316.2	PTHR1	5745	3	36.1	46894276	36	N	GGGACTATCCATGGCCTCCCCGTGGCCAACTTGAGTCTGCTCTGCAGCTTTA	PTHR, MGC138426, MGC138452	parathyroid hormone/parathyroid hormone-related peptide receptor; parathyroid hormone/parathyroid hormone-related protein receptor; PTH/PTHrP receptor; PTH/PTHr receptor; PTH/PTHrP type I receptor; PTH receptor; seven transmembrane helix receptor; go_component: membrane; go_component: nucleus; go_component: cytoplasm; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: parathyroid hormone receptor activity; go_function: parathyroid hormone receptor activity; go_process: signal transduction; go_process: skeletal development; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	parathyroid hormone receptor 1 precursor
PTHR1_P170_R	1775	0.4821161	1729.2	1702.866	0.04848714	24	109.5816	0.9490293	563.1193	12346.69	1.336057E-16	27	846.4457	0.9572343	654.8883	16896.81	1.58757E-34	32	809.6889	0.05172493	3864.737	216.2619	0.06017306	32	112.811	0.9504437	543.7272	12346.08	7.801621E-18	19	783.2738	0.9436734	619.7914	12059.11	7.558027E-20	28	677.8611	0.943373	696.8194	13274.55	1.308278E-16	33	553.5371	0.9527913	687.0767	15885.22	1.817395E-16	20	917.4448	0.9294834	728.5908	10921.69	1.369837E-14	35	579.4488	0.944343	609.5531	12039.13	5.953483E-17	28	614.5793	PTHR1	PTHR1_P170_R	39995096	NM_000316.2	PTHR1	5745	3	36.1	46894070	-170	N	CAGCCCTGGGCATCTGAACACCGGCACACTTGGATCTGCCTCTGTTGCCTCC	PTHR, MGC138426, MGC138452	parathyroid hormone/parathyroid hormone-related peptide receptor; parathyroid hormone/parathyroid hormone-related protein receptor; PTH/PTHrP receptor; PTH/PTHr receptor; PTH/PTHrP type I receptor; PTH receptor; seven transmembrane helix receptor; go_component: membrane; go_component: nucleus; go_component: cytoplasm; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: parathyroid hormone receptor activity; go_function: parathyroid hormone receptor activity; go_process: signal transduction; go_process: skeletal development; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	parathyroid hormone receptor 1 precursor
PTHR1_P258_F	1772	0.3055198	3366.672	1525.078	0.001525384	21	223.2773	0.5670328	4802.77	6420.883	1.810357E-12	24	342.6404	0.6299081	4882.413	8480.226	1.903111E-19	24	646.0496	0.5398457	1310.303	1654.546	0.2057431	33	99.73031	0.5415806	5006.282	6032.606	5.960455E-13	40	228.4709	0.5068009	5411.746	5663.754	5.814129E-15	24	550.1256	0.6843018	3835.132	8529.722	6.694854E-13	22	470.756	0.6467328	4738.67	8858.243	5.174066E-11	25	476.2265	0.5533546	4304.117	5456.314	4.157569E-10	36	351.8868	0.5658709	5059.727	6725.511	1.210323E-14	18	503.1108	PTHR1	PTHR1_P258_F	39995096	NM_000316.2	PTHR1	5745	3	36.1	46893982	-258	N	GGCAAGGAGAGGACTATTGAGGCACACACACGTGTCTGGCAGCCTGAGTGGG	PTHR, MGC138426, MGC138452	parathyroid hormone/parathyroid hormone-related peptide receptor; parathyroid hormone/parathyroid hormone-related protein receptor; PTH/PTHrP receptor; PTH/PTHr receptor; PTH/PTHrP type I receptor; PTH receptor; seven transmembrane helix receptor; go_component: membrane; go_component: nucleus; go_component: cytoplasm; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: parathyroid hormone receptor activity; go_function: parathyroid hormone receptor activity; go_process: signal transduction; go_process: skeletal development; go_process: G-protein signaling, coupled to cyclic nucleotide second messenger	parathyroid hormone receptor 1 precursor
PTK2_P735_R	5044	0.09941342	2613.158	299.4985	0.1158313	24	77.7382	0.09465915	8354.796	884.0027	1.940178E-08	27	265.026	0.08528445	8787.958	828.6779	8.142422E-10	34	411.0105	0.1689276	800.6757	183.0755	0.6836922	32	30.39545	0.09521873	7617.193	812.1536	1.615802E-07	37	387.3154	0.1322591	7304.282	1128.544	1.529213E-08	30	333.2471	0.08721986	8234.542	796.3995	7.614581E-07	33	414.4449	0.1030835	10098.07	1172.074	1.363565E-07	28	348.993	0.0793571	7634.726	666.7139	2.823894E-07	23	455.0502	0.08579472	9545.418	905.1861	1.934942E-11	26	327.1088	PTK2	PTK2_P735_R	27886592	NM_005607.3	PTK2	5747	8	36.1	142081249	-735	Y	ACTGGAGGTAGACAGGTTACCTAAATGAACGCCAGCAGGGAACGAGCCCTGCAATC	FAK, FADK, FAK1, pp125FAK	isoform b is encoded by transcript variant 2; focal adhesion kinase 1; go_component: cytoskeleton; go_component: cytoskeleton; go_function: binding; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: SH2 domain binding; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: integrin-mediated signaling pathway	PTK2 protein tyrosine kinase 2 isoform b
PTK2B_P673_R	2254	0.05025362	3779.968	205.2995	0.01564045	31	129.2809	0.05363811	9804.642	561.3775	1.28638E-10	26	525.8474	0.04448964	11942.19	560.6981	6.462163E-17	30	784.4929	0.04551769	3185.904	156.6994	0.1425267	17	171.1519	0.04746985	8861.431	446.5977	3.694846E-09	29	396.8301	0.04801074	9816.313	500.0997	6.5473E-13	32	491.7883	0.04488089	10019.46	475.5119	3.117129E-09	30	551.5671	0.0488898	12509.74	648.1769	2.604697E-10	22	726.8076	0.0570799	6843.444	420.3231	1.364715E-05	34	340.489	0.04100569	10697.31	461.683	4.376498E-13	21	724.4236	PTK2B	PTK2B_P673_R	27886587	NM_173175.1	PTK2B	2185	8	36.1	27224243	.	Y	AAATCGCTGCTCTTACCCGAAAGTCGTGGGCAGTGTCCTTCACCGGCTGCAC	PKB, PTK, CAKB, FAK2, PYK2, CADTK, FADK2, RAFTK	isoform b is encoded by transcript variant 4; protein tyrosine kinase 2 beta; protein kinase B; cell adhesion kinase beta; CAK beta; related adhesion focal tyrosine kinase; calcium-dependent tyrosine kinase; focal adhesion kinase 2; proline-rich tyrosine kinase 2; go_component: cytoskeleton; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: signal transducer activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: cell adhesion; go_process: apoptosis; go_process: response to stress; go_process: signal transduction; go_process: signal transduction; go_process: protein complex assembly; go_process: signal complex formation; go_process: protein amino acid phosphorylation; go_process: positive regulation of cell proliferation	PTK2B protein tyrosine kinase 2 beta isoform b
PTK6_E50_F	5700	0.08287802	3242.81	302.0814	0.03916928	22	154.5171	0.4809673	4016.75	3814.83	4.011978E-06	36	374.3961	0.4450805	5730.19	4676.181	1.517261E-11	30	523.9314	0.1778607	1993.853	452.9818	0.3150683	29	84.72098	0.4224607	4689.398	3503.367	4.146023E-07	27	423.9349	0.3488526	5396.063	2944.518	2.355455E-08	30	508.3491	0.5011053	4057.124	4175.544	1.014188E-05	31	355.2763	0.5158468	4993.881	5427.336	1.584011E-06	34	391.7669	0.4287038	4303.936	3304.737	4.031645E-06	34	385.2288	0.3862822	4494.183	2891.64	9.632128E-06	29	257.4502	PTK6	PTK6_E50_F	27886594	NM_005975.2	PTK6	5753	20	36.1	61639101	50	Y	GGCCCAGGTGAGCCTGGTCCCGGGACACCATGGCGGGCGGGCGCAGC	BRK	breast tumor kinase; protein-tyrosine kinase BRK; go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	PTK6 protein tyrosine kinase 6
PTK7_E317_F	1077	0.1397407	2574.759	434.4882	0.09986844	19	91.66178	0.2481799	6673.639	2236.015	7.404623E-08	30	505.6215	0.2301546	7957.694	2408.945	1.870287E-11	24	564.2193	0.04017906	3511.94	151.1994	0.1004021	32	155.1973	0.17453	7310.694	1566.851	2.484741E-08	27	434.162	0.3200408	6683.528	3192.847	8.484251E-12	27	487.9786	0.4197305	5940.672	4369.443	6.586123E-09	32	399.2306	0.382731	7370.588	4632.057	1.371644E-08	29	710.7294	0.3457204	4989.493	2689.28	3.120183E-06	30	353.5754	0.1925468	8644.82	2085.306	4.489405E-12	31	371.3114	PTK7	PTK7_E317_F	27886610	NM_002821.3	PTK7	5754	6	36.1	43152324	317	Y	GGGGGCACAGAGCTTGGGAAGCGCGGGAGTCCCGTGGGCAAAAG	CCK4	isoform a precursor is encoded by transcript variant PTK7-1; colon carcinoma kinase-4; protein-tyrosine kinase PTK7; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: protein binding; go_function: receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: vascular endothelial growth factor receptor activity; go_process: cell adhesion; go_process: signal transduction; go_process: protein amino acid phosphorylation	PTK7 protein tyrosine kinase 7 isoform a precursor
PTPN6_E171_R	3840	0.0417337	4398.082	195.8971	0.003500465	24	157.4349	0.03757721	7376.02	291.8966	6.978E-06	39	259.6603	0.04615951	7610.024	373.1137	9.609494E-07	25	273.6819	0.1797012	3438.858	775.2503	0.05043767	30	137.962	0.05845586	6868.623	432.6476	1.087592E-05	26	393.5148	0.05244084	7095.319	398.2111	9.563006E-07	37	331.2628	0.0436949	7013.022	325.0038	0.0001314893	29	291.3851	0.0540272	8055.815	465.8018	0.0001708202	34	227.5985	0.05488976	6212.386	366.6084	0.0001252578	22	240.668	0.05279366	7201.836	406.9764	4.431301E-06	24	424.1219	PTPN6	PTPN6_E171_R	34328901	NM_080548.2	PTPN6	5777	12	36.1	6926172	171	Y	GAGATGCTGTCCCGTGGGTAAGTCCCGGGCACCATCGGGGTCCCAGTCT	HCP, HCPH, SHP1, SHP-1, HPTP1C, PTP-1C, SHP-1L, SH-PTP1	isoform 2 is encoded by transcript variant 2; protein-tyrosine phosphatase 1C; hematopoietic cell phophatase; hematopoietic cell protein-tyrosine phosphatase; 70 kda SHP-1L protein; go_component: cytoskeleton; go_component: membrane; go_function: hydrolase activity; go_function: protein binding; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine phosphatase activity; go_process: apoptosis; go_process: intracellular signaling cascade; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: negative regulation of cell proliferation; go_process: G-protein coupled receptor protein signaling pathway	protein tyrosine phosphatase, non-receptor type 6 isoform 2
PTPN6_P282_R	1776	0.2271828	1198.241	381.6402	0.497416	31	47.54155	0.5293984	3564.906	4122.797	6.531148E-06	34	231.2768	0.6677306	3306.009	6844.737	5.733941E-11	30	395.1843	0.2488323	326.863	141.4029	0.792789	23	20.03524	0.5122924	3523.251	3805.896	9.886428E-06	36	311.7681	0.7242488	2484.245	6787.41	2.322098E-10	32	312.2133	0.5892442	3361.233	4965.267	7.592821E-06	34	336.0184	0.5238793	4269.568	4807.87	4.870379E-05	22	456.3593	0.5869593	3112.036	4564.525	3.145652E-06	34	203.5332	0.3333755	5037.033	2569.004	4.475109E-06	28	292.2618	PTPN6	PTPN6_P282_R	34328901	NM_080548.2	PTPN6	5777	12	36.1	6925719	-282	N	TAGGCCCTTTGGTTTCCGCCTACGGAGAGGTTTCCCCCATTGGTTGCTCT	HCP, HCPH, SHP1, SHP-1, HPTP1C, PTP-1C, SHP-1L, SH-PTP1	isoform 2 is encoded by transcript variant 2; protein-tyrosine phosphatase 1C; hematopoietic cell phophatase; hematopoietic cell protein-tyrosine phosphatase; 70 kda SHP-1L protein; go_component: cytoskeleton; go_component: membrane; go_function: hydrolase activity; go_function: protein binding; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine phosphatase activity; go_process: apoptosis; go_process: intracellular signaling cascade; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: negative regulation of cell proliferation; go_process: G-protein coupled receptor protein signaling pathway	protein tyrosine phosphatase, non-receptor type 6 isoform 2
PTPNS1_E433_R	3841	0.03039944	5523.125	176.2992	0.0001150561	23	161.7866	0.02218281	11791.9	269.7802	1.931047E-14	29	577.0403	0.01758187	15411.3	277.5984	2.949426E-27	34	842.186	0.2433472	443.9698	174.9462	0.763415	17	35.60196	0.02757097	14060.11	401.4771	1.176074E-22	23	875.6479	0.057538	11487.17	707.405	2.713438E-18	39	893.5286	0.02380159	13230.2	325.016	1.339998E-15	26	1087.071	0.02146187	17528.09	386.6296	2.50822E-19	30	774.1187	0.03324905	10035.99	348.6027	1.73962E-11	24	698.1141	0.03902812	16091.96	657.6071	1.880555E-30	13	1048.808	PTPNS1	PTPNS1_E433_R	18426910	NM_080792.1	PTPNS1	140885	20	36.1	1823858	433	Y	GCCCCTGGCTTTATTTCTCGCGCGCTTGGGGTCTCTCCCAGTCTCCGT	BIT, MFR, P84, SIRP, MYD-1, SHPS1, SIRPA, CD172A, SHPS-1, SIRPalpha, SIRPalpha2, SIRP-ALPHA-1	myd-1 antigen; signal regulatory protein, alpha type 2; SHP substrate-1; brain-immunoglobulin-like molecule with tyrosine-based activation motifs; signal regulatory protein, alpha type 1; tyrosine phosphatase SHP substrate 1; macrophage fusion receptor; signal-regulatory protein alpha; go_component: plasma membrane; go_component: integral to membrane; go_process: cell adhesion	protein tyrosine phosphatase, non-receptor type substrate 1 precursor
PTPNS1_P301_R	1784	0.05758469	6366.699	395.1367	1.814506E-06	29	261.447	0.03466319	11804.62	427.4696	7.32931E-15	31	727.7366	0.03097057	16127.62	518.6414	7.027946E-31	40	483.7198	0.02787482	5810.544	169.4796	0.002564517	27	290.7265	0.03827165	12552.11	503.4864	2.587649E-18	28	692.1627	0.04343388	12409.57	568.0101	7.67659E-21	26	1058.182	0.0340543	12285.09	436.6348	1.112892E-13	32	704.556	0.03448561	18205.61	653.8277	1.727181E-21	28	966.2522	0.04467794	8857.672	418.9272	4.153414E-09	29	544.6611	0.03432072	12005.46	430.2343	2.297907E-16	21	735.0205	PTPNS1	PTPNS1_P301_R	18426910	NM_080792.1	PTPNS1	140885	20	36.1	1823124	-301	Y	GGCCTCTGGGCAGCCCCGGCGGCGCTTCCAGTGCCTTCCAGCC	BIT, MFR, P84, SIRP, MYD-1, SHPS1, SIRPA, CD172A, SHPS-1, SIRPalpha, SIRPalpha2, SIRP-ALPHA-1	myd-1 antigen; signal regulatory protein, alpha type 2; SHP substrate-1; brain-immunoglobulin-like molecule with tyrosine-based activation motifs; signal regulatory protein, alpha type 1; tyrosine phosphatase SHP substrate 1; macrophage fusion receptor; signal-regulatory protein alpha; go_component: plasma membrane; go_component: integral to membrane; go_process: cell adhesion	protein tyrosine phosphatase, non-receptor type substrate 1 precursor
PTPRF_E178_R	977	0.04399288	4511.899	212.2272	0.002454358	25	183.109	0.08449019	8495.33	793.2422	1.576684E-08	27	514.2445	0.07928544	11390.62	989.491	1.432851E-16	30	505.5797	0.1942583	1069.6	281.9818	0.5935948	26	40.21478	0.06118265	8569.942	565.0194	8.051203E-09	35	484.9684	0.119821	9751.905	1341.164	5.188129E-15	28	872.2962	0.109742	9916.802	1234.77	1.927649E-10	28	678.8517	0.07085244	14318.91	1099.518	3.305024E-14	41	521.3087	0.1724356	7223.313	1525.924	4.360653E-08	26	505.1105	0.07940322	8262.303	721.2645	1.99869E-08	40	372.6625	PTPRF	PTPRF_E178_R	18860871	NM_002840.2	PTPRF	5792	1	36.1	43769312	178	Y	GGAGCAGCGGCCCTAGCGGCTTGCGGGGGGACATGCGGACCGACGGCCC	LAR	isoform 1 precursor is encoded by transcript variant 1; protein tyrosine phosphatase, receptor type, F polypeptide; receptor-linked protein-tyrosine phosphatase LAR; LCA-homolog; leukocyte antigen-related tyrosine phosphatase; leukocyte antigen-related (LAR) PTP receptor; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: receptor activity; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: cell adhesion; go_process: protein amino acid dephosphorylation; go_process: transmembrane receptor protein tyrosine phosphatase signaling pathway	protein tyrosine phosphatase, receptor type, F isoform 1 precursor
PTPRG_E40_R	1099	0.09584833	3976.692	432.1665	0.005677692	33	141.7443	0.1457033	8332.694	1438.225	1.974649E-09	17	219.4211	0.1130189	9982.194	1284.671	1.299881E-13	32	422.6236	0.1303389	4921.114	752.5304	0.004690087	16	139.0073	0.1224953	8651.13	1221.614	2.583437E-10	24	387.8211	0.1688878	8839.649	1816.599	8.285735E-14	26	575.3268	0.1214026	9023.946	1260.726	7.291425E-09	30	489.6248	0.1372186	10013.54	1608.479	4.619768E-08	29	365.1077	0.1626805	7908.967	1556.04	1.723099E-09	24	513.441	0.1629857	9504.273	1870.17	1.306242E-13	24	574.2369	PTPRG	PTPRG_E40_R	18860897	NM_002841.2	PTPRG	5793	3	36.1	61522325	40	Y	ATGGCCAGTTTCCAGCCCCGCGCTCTTCGTTCCTTCCCAGCC	PTPG, HPTPG, RPTPG, R-PTP-GAMMA	protein tyrosine phosphatase, receptor type, gamma polypeptide; H_RG317H01.1; match to U46116 (PID:g1588304); receptor tyrosine phosphatase gamma; receptor-type protein phosphatase gamma; protein tyrosine phosphatase gamma; go_component: integral to plasma membrane; go_function: zinc ion binding; go_function: hydrolase activity; go_function: carbonate dehydratase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: one-carbon compound metabolism; go_process: protein amino acid dephosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	protein tyrosine phosphatase, receptor type, G precursor
PTPRG_P476_F	5055	0.03685262	5162.735	201.3664	0.0003569807	26	202.5782	0.100631	10874.93	1227.993	1.529585E-14	33	625.4709	0.08447042	15117.51	1404.029	2.149437E-30	31	791.302	0.2538582	355.2769	154.8979	0.7848418	27	26.85544	0.08789144	10983.43	1068.008	1.622885E-15	28	734.0435	0.1301224	10054.46	1518.976	2.125687E-16	29	566.2079	0.08083814	11721.27	1039.653	9.10534E-14	32	637.8514	0.1031989	13419.39	1555.737	2.180676E-13	33	603.0756	0.08963282	9036.849	899.5947	1.738959E-10	30	441.4115	0.09454172	12794.56	1346.361	2.22966E-21	31	484.8452	PTPRG	PTPRG_P476_F	18860897	NM_002841.2	PTPRG	5793	3	36.1	61521809	-476	Y	AACAGGAGCCGCAGACGGTGAGCCTCACCGCTGCAAATGCCAGGGCAGTGAAGCC	PTPG, HPTPG, RPTPG, R-PTP-GAMMA	protein tyrosine phosphatase, receptor type, gamma polypeptide; H_RG317H01.1; match to U46116 (PID:g1588304); receptor tyrosine phosphatase gamma; receptor-type protein phosphatase gamma; protein tyrosine phosphatase gamma; go_component: integral to plasma membrane; go_function: zinc ion binding; go_function: hydrolase activity; go_function: carbonate dehydratase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: one-carbon compound metabolism; go_process: protein amino acid dephosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	protein tyrosine phosphatase, receptor type, G precursor
PTPRH_E173_F	979	0.1112767	6772.382	860.4883	3.171476E-08	26	354.7238	0.4563006	7458.896	6343.817	4.708966E-19	20	526.0055	0.473945	8182.231	7461.809	4.301559E-27	29	488.608	0.08553946	3528.804	339.4416	0.07871241	31	143.988	0.4224918	7035.46	5220.141	4.592146E-16	25	805.6332	0.4393241	8306.84	6587.277	7.753339E-28	32	1138.625	0.4408084	7546.471	6027.681	1.207514E-15	29	611.4991	0.4461533	9462.768	7703.323	1.059348E-17	31	513.8345	0.4276635	6979.629	5290.067	2.928026E-16	28	605.3933	0.483212	8255.66	7812.789	6.422551E-28	21	612.8879	PTPRH	PTPRH_E173_F	67190343	NM_002842.2	PTPRH	5794	19	36.1	60412481	173	N	CAGCACCTACTTCCTCAAGATCGAGGTGCAGGCACCCAGCTCCTTCT	SAP-1	go_component: integral to plasma membrane; go_function: hydrolase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: protein amino acid dephosphorylation	protein tyrosine phosphatase, receptor type, H precursor
PTPRH_P255_F	5067	0.2760127	4189.936	1635.493	7.355712E-05	24	239.8376	0.9638992	517.0716	16475.95	2.53986E-29	24	1348.938	0.9732361	504.0648	21966.12	3.678E-38	17	1617.165	0.7987275	731.5975	3300.103	0.06413121	27	165.78	0.9648488	507.47	16674.14	1.80168E-32	37	1020.983	0.9635306	573.7112	17799.62	3.678E-38	30	1500.199	0.9721527	529.6604	21981.53	3.678E-38	21	1642.63	0.9695135	657.064	24075.67	1.047563E-37	29	1040.512	0.9418679	646.6237	12096.94	1.323449E-17	23	1200.187	0.9750681	466.7634	22165.71	3.678E-38	17	1336.325	PTPRH	PTPRH_P255_F	67190343	NM_002842.2	PTPRH	5794	19	36.1	60412909	-255	N	TGCACCCCAGGTACCGGGTGCCGCGCCCCACTGCTGCACGGATGCGGGA	SAP-1	go_component: integral to plasma membrane; go_function: hydrolase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: protein amino acid dephosphorylation	protein tyrosine phosphatase, receptor type, H precursor
PTPRO_E56_F	3842	0.03341937	8219.436	287.6432	3.028792E-10	24	347.108	0.02211178	11774.84	268.5111	2.141085E-14	29	708.436	0.02113493	14475.55	314.7044	4.501591E-24	31	645.817	0.02880326	6660.453	200.4981	0.0003670023	27	286.821	0.03208575	10844.61	362.8071	2.323476E-13	21	1074.453	0.04250349	14404.76	643.8695	1.899041E-28	32	448.4779	0.03062174	11990.53	381.9283	6.447725E-13	25	1025.456	0.02208416	14745.92	335.2637	1.396403E-13	32	621.3824	0.03458945	9845.66	356.3405	4.508839E-11	30	572.2889	0.02390521	16376.65	403.5242	1.437851E-30	23	653.0278	PTPRO	PTPRO_E56_F	13677212	NM_002848.2	PTPRO	5800	12	36.1	15366810	56	Y	GGGACTGGAAAGGCAGCATGCGCTCGCCAGGAGCAACCTCGGCGCCCAGG	PTPU2, GLEPP1, PTP-U2	isoform b precursor is encoded by transcript variant 2; PTPase U2; PTPROt; glomerular epithelial protein-1; protein tyrosine phosphatase PTP-U2; phosphotyrosine phosphatase U2; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine phosphatase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation	receptor-type protein tyrosine phosphatase O isoform b precursor
PTPRO_P371_F	1786	0.1615541	2985.047	594.4356	0.03662383	24	121.798	0.2005516	6591.781	1678.717	8.49268E-07	21	638.9836	0.1695207	8211.456	1696.567	1.95513E-10	21	306.7605	0.1828742	787.3618	198.5931	0.6831776	28	47.37663	0.2246391	6539.078	1923.487	1.411971E-07	34	354.7598	0.2009047	6283.346	1604.87	1.805878E-07	22	380.7377	0.2377428	6644.598	2103.594	1.968787E-06	20	339.6473	0.2788894	7205.72	2825.487	4.534198E-06	24	500.5809	0.1592105	6539.363	1257.219	2.015229E-06	21	478.2448	0.1791123	6629.848	1468.408	7.314173E-07	37	240.4395	PTPRO	PTPRO_P371_F	13677212	NM_002848.2	PTPRO	5800	12	36.1	15366383	-371	N	TGAGAGGGAACTGGGATCTGGCGCCTGGATTGCTCAAGAGAGGTC	PTPU2, GLEPP1, PTP-U2	isoform b precursor is encoded by transcript variant 2; PTPase U2; PTPROt; glomerular epithelial protein-1; protein tyrosine phosphatase PTP-U2; phosphotyrosine phosphatase U2; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: receptor activity; go_function: hydrolase activity; go_function: protein tyrosine phosphatase activity; go_function: protein tyrosine phosphatase activity; go_function: transmembrane receptor protein tyrosine phosphatase activity; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation; go_process: protein amino acid dephosphorylation	receptor-type protein tyrosine phosphatase O isoform b precursor
PURA_P928_R	5960	0.1022509	4934.371	573.3994	0.0002220516	36	182.301	0.04195626	4583.029	205.087	0.01277565	27	212.2263	0.04898309	5150.941	270.455	0.0028022	24	169.9492	0.06078072	2094.752	142.0313	0.36551	26	112.7859	0.04001682	4265.856	181.9903	0.01959945	27	191.381	0.06339852	5025.65	346.955	0.001302328	27	264.0771	0.08156481	4520.821	410.368	0.0226742	17	272.1136	0.0623911	4878.31	331.2705	0.044425	31	248.6032	0.089537	4140.952	417.0649	0.0184026	31	189.7278	0.05601874	4293.433	260.7198	0.01722485	26	226.1569	PURA	PURA_P928_R	62530389	NM_005859.3	PURA	5813	5	36.1	139472964	-928	Y	GCCCTGGTGCGTCTACTGTCCTCTGCTCGGCTCCCCCCATCGGTGAGTGCG	PUR1, PURALPHA, PUR-ALPHA	purine-rich single-stranded DNA-binding protein alpha; transcriptional activator protein PUR-alpha; go_component: nucleus; go_function: single-stranded DNA binding; go_function: RNA polymerase II transcription factor activity, enhancer binding; go_process: transcription; go_process: DNA replication initiation; go_process: regulation of transcription, DNA-dependent	purine-rich element binding protein A
PWCR1_E81_R	3846	0.7071131	1927.648	4895.327	1.392089E-06	37	342.2723	0.9747432	675.318	29922.13	3.678E-38	24	906.8474	0.9710715	839.3788	31533.12	3.678E-38	26	885.1169	0.796117	945.579	4082.749	0.01482844	31	221.155	0.9725565	723.8659	29196.57	3.678E-38	15	919.2907	0.972093	686.1091	27382.77	3.678E-38	30	1737.456	0.9714912	807.7709	30934.02	3.678E-38	22	1108.512	0.9734766	803.2675	33152.19	3.678E-38	22	791.2216	0.931907	991.0079	14931.32	3.881371E-28	34	1374.47	0.9732236	692.1786	28792.75	3.678E-38	33	1113.111	PWCR1	PWCR1_E81_R	29171309	NR_001290.1	PWCR1	63968	15	36.1	22847798	81	N	GAGAACTCATAACGTCATTCTCATCGGAACTGAGGTCCAGCATGTTGCTTCCTCT	PET1, HBII-85	synonyms: PET1, HBII-85	.
PWCR1_P357_F	1789	0.3621818	2099.347	1248.888	0.05649713	24	93.87167	0.9293319	790.2833	11707.81	1.56682E-15	14	965.7057	0.9243941	1055.042	14122.11	2.034441E-25	28	761.8463	0.3041635	2349.812	1070.86	0.1313062	37	109.7719	0.9131382	764.0316	9083.169	2.925287E-10	30	1048.264	0.9219921	886.3111	11657.42	2.08604E-19	22	1018.815	0.9198236	843.185	10820.7	1.915936E-11	27	606.207	0.9140643	1142.601	13217.07	2.700718E-12	25	660.4272	0.8995003	779.9487	7875.787	6.503965E-08	26	631.7182	0.9136779	843.3376	9984.772	2.661979E-12	18	639.402	PWCR1	PWCR1_P357_F	29171309	NR_001290.1	PWCR1	63968	15	36.1	22847360	-357	N	GGAGAAGTTGTCATGGGAGGCCAGCCGCCTGCTGGCAAGGAAGATGG	PET1, HBII-85	synonyms: PET1, HBII-85	.
PWCR1_P811_F	1790	0.3273538	2019.403	1031.44	0.09351279	38	125.3339	0.9202258	1150.254	14422.16	1.852559E-24	32	1015.42	0.9290605	1209.705	17152.56	5.692831E-38	30	677.921	0.8052029	542.1442	2654.333	0.1652276	33	142.4115	0.9235091	1007.775	13374.65	2.128815E-22	32	716.0095	0.9260313	1103.5	15066.89	4.290121E-33	40	807.9625	0.9292031	1125.068	16078.92	1.208857E-25	22	1168.686	0.9414115	1170.123	20408.59	2.109508E-28	23	678.686	0.8831404	916.4707	7681.754	8.295919E-08	24	682.5189	0.9310504	894.6539	13431.14	5.769777E-22	29	713.5379	PWCR1	PWCR1_P811_F	29171309	NR_001290.1	PWCR1	63968	15	36.1	22846906	-811	N	TTGAGCTGTCCGGTTGCCACAGGGTCGGACCTGGAGGCTGCAGACCATC	PET1, HBII-85	synonyms: PET1, HBII-85	.
PXN_P308_F	4826	0.1617155	3772.398	747.0338	0.004265958	38	202.2719	0.3233379	7008.288	3396.643	1.069056E-10	29	444.7335	0.3152994	8630.079	4020.135	2.456314E-17	31	546.7721	0.02881809	6038.656	182.1537	0.001554586	47	207.1973	0.3713935	6588.047	3951.434	8.831595E-12	31	496.3427	0.3576986	6266.052	3545.265	1.225546E-11	27	419.3061	0.3643952	6591.055	3836.013	4.110366E-09	27	456.3465	0.3549819	8364.077	4658.155	4.240146E-10	34	498.0778	0.3803737	6042.009	3770.433	3.219661E-10	21	515.5168	0.4211919	6673.421	4928.939	3.531802E-14	23	599.005	PXN	PXN_P308_F	4506344	NM_002859.1	PXN	5829	12	36.1	119188200	-308	Y	TCAAAGTCACTTGCCTGACCCTGCGGATGACAAATCCGTCCACAGTCAGC	.	go_component: cytoskeleton; go_component: microtubule associated complex; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: vinculin binding; go_process: cell motility; go_process: cell adhesion; go_process: cell-matrix adhesion; go_process: signal transduction; go_process: signal complex formation	paxillin
PYCARD_E87_F	3856	0.08117457	6127.532	550.1777	2.600686E-06	32	217.8513	0.1277294	10815.09	1598.332	2.570771E-15	25	481.2215	0.1016923	12636.37	1441.812	1.063982E-21	31	710.7766	0.1377862	1697.554	287.2585	0.429161	26	121.5882	0.1307699	10288.61	1562.897	5.458726E-15	26	631.5004	0.1123025	10492.22	1340.02	3.565025E-17	28	707.2451	0.1265716	10735.58	1570.222	8.958459E-13	23	1129.035	0.1356291	14087.14	2226.116	6.063428E-16	21	821.7471	0.11561	9921.44	1310.032	1.620118E-13	25	765.3771	0.115095	13057.6	1711.34	2.085563E-23	30	495.5795	PYCARD	PYCARD_E87_F	22035619	NM_145182.1	PYCARD	29108	16	36.1	31121665	87	Y	CGTTGCCCTCCAGCAAAAGGCGCTTCCTTACTACACCCTTGGTCCC	ASC, TMS1, CARD5, MGC10332	isoform b is encoded by transcript variant 2; apoptosis-associated speck-like protein containing a CARD; target of methylation-induced silencing-1; caspase recruitment domain protein 5; go_component: cytoplasm; go_function: protein binding; go_function: caspase activator activity; go_process: cell cycle; go_process: caspase activation; go_process: regulation of apoptosis; go_process: signal transduction; go_process: induction of apoptosis; go_process: negative regulation of progression through cell cycle	PYD and CARD domain containing isoform b
PYCARD_P150_F	1795	0.1411139	3550.832	599.827	0.0106928	30	113.0979	0.7353882	3027.609	8692.003	1.288747E-13	28	417.7548	0.7141706	3465.293	8908.209	1.495212E-16	28	559.2302	0.2477843	1707.506	595.4033	0.3493266	26	68.44438	0.7143524	3387.796	8722.341	1.131691E-15	21	595.0552	0.7304177	3077.717	8609.842	9.72687E-17	34	564.243	0.6686336	3889	8049.034	5.301024E-12	27	843.087	0.7270821	3658.047	10011.83	3.93192E-11	22	540.0163	0.7278698	3001.379	8295.294	1.110462E-13	33	491.1048	0.6123095	4116.199	6658.968	3.533008E-12	25	596.5856	PYCARD	PYCARD_P150_F	22035619	NM_145182.1	PYCARD	29108	16	36.1	31121902	-150	Y	TTATTGGAGCACCTAGGCTTAGAACCTCGGATTTCTAGAACCCCGAAACCTC	ASC, TMS1, CARD5, MGC10332	isoform b is encoded by transcript variant 2; apoptosis-associated speck-like protein containing a CARD; target of methylation-induced silencing-1; caspase recruitment domain protein 5; go_component: cytoplasm; go_function: protein binding; go_function: caspase activator activity; go_process: cell cycle; go_process: caspase activation; go_process: regulation of apoptosis; go_process: signal transduction; go_process: induction of apoptosis; go_process: negative regulation of progression through cell cycle	PYD and CARD domain containing isoform b
PYCARD_P393_F	1799	0.247449	3666.136	1238.357	0.001469968	27	202.7527	0.2821792	7885.845	3139.278	5.027459E-12	27	484.5296	0.2248266	10970.38	3210.786	4.918023E-22	33	401.044	0.1244673	4828.222	700.6052	0.006159021	26	282.0272	0.2159724	8053.653	2246.048	3.062368E-11	17	514.2339	0.3095233	8052.985	3654.778	8.46188E-17	33	887.4861	0.216776	8548.471	2393.672	4.78481E-10	28	608.8125	0.2515119	10607.51	3598.008	4.978201E-12	36	311.7419	0.3024677	5566.033	2456.936	8.503836E-07	26	676.6753	0.2536105	10039.53	3445.24	2.306752E-19	30	430.8586	PYCARD	PYCARD_P393_F	22035619	NM_145182.1	PYCARD	29108	16	36.1	31122145	-393	N	CCAGCATAACATGGCCAACCCGATGGCTCCCGAAACCTTGCCAGATGC	ASC, TMS1, CARD5, MGC10332	isoform b is encoded by transcript variant 2; apoptosis-associated speck-like protein containing a CARD; target of methylation-induced silencing-1; caspase recruitment domain protein 5; go_component: cytoplasm; go_function: protein binding; go_function: caspase activator activity; go_process: cell cycle; go_process: caspase activation; go_process: regulation of apoptosis; go_process: signal transduction; go_process: induction of apoptosis; go_process: negative regulation of progression through cell cycle	PYD and CARD domain containing isoform b
RAB32_E314_R	3857	0.1382848	4401.446	722.3752	0.0007629631	27	216.7284	0.08249551	9833.955	893.1909	2.239768E-11	40	658.9042	0.05411108	13747.02	792.1406	3.201701E-23	17	1103.772	0.06014487	4636.611	303.1136	0.01714984	40	200.7035	0.06411862	11404.52	788.1917	6.792292E-16	28	833.4308	0.1482776	10985.84	1929.95	1.238212E-20	38	580.6216	0.06169828	12689.66	840.9878	1.533458E-15	27	816.5469	0.08037354	12491.58	1100.479	5.269178E-11	30	751.5226	0.06269528	8089.138	547.7624	7.045062E-08	21	460.0081	0.1047107	14386.36	1694.286	5.798877E-28	29	813.6052	RAB32	RAB32_E314_R	20127508	NM_006834.2	RAB32	10981	6	36.1	146906835	314	Y	AGACCAGCATCATCAAGCGCTACGTCCACCAGCTCTTCTCCCAGC	.	go_component: mitochondrion; go_function: GTP binding; go_function: nucleotide binding; go_process: small GTPase mediated signal transduction	RAB32, member RAS oncogene family
RAB32_P493_R	1804	0.05694347	3654.012	226.6741	0.01969287	24	156.8999	0.1208608	9534.271	1324.483	1.164458E-11	25	788.3688	0.09064818	10491.4	1055.798	2.507544E-14	29	873.8717	0.08811683	1426.714	147.5289	0.5361612	26	80.92343	0.0880243	10273.85	1001.288	1.583986E-13	29	848.0986	0.2073239	10373.52	2739.343	2.671105E-21	21	769.4877	0.1155561	10078.59	1329.873	6.148975E-11	24	772.8309	0.09361355	12462.37	1297.469	2.796473E-11	27	754.7114	0.1116372	6759.283	861.9801	3.851098E-06	34	498.0708	0.06788646	12275.75	901.3342	1.865493E-18	31	521.2735	RAB32	RAB32_P493_R	20127508	NM_006834.2	RAB32	10981	6	36.1	146906028	-493	Y	AGCCCAGTGTTATCCGTCCTTCGTTAAGTTCAAAGTCACGGTGCCACTTC	.	go_component: mitochondrion; go_function: GTP binding; go_function: nucleotide binding; go_process: small GTPase mediated signal transduction	RAB32, member RAS oncogene family
RAD50_P191_F	2834	0.270279	2708.834	1040.355	0.02602245	22	149.313	0.8047601	2242.161	9654.164	4.871261E-14	36	590.7404	0.81281	2889.697	12981.76	6.270164E-28	23	817.8425	0.1093545	3752.077	472.9624	0.0496975	21	216.3398	0.7943761	2598.428	10424.7	3.215963E-18	22	534.6649	0.7585841	2603.723	8495.718	4.97793E-15	27	556.7047	0.8346124	1920.395	10195.72	2.258626E-12	31	820.9185	0.8461604	2450.795	14030.08	2.787327E-16	39	585.3274	0.7899799	2150.574	8465.418	5.057313E-12	22	579.1979	0.8513398	2408.286	14364.33	1.536537E-30	21	1200.123	RAD50	RAD50_P191_F	19924130	NM_133482.1	RAD50	10111	5	36.1	131920338	-191	Y	GAGTCCCAGGATCAAGCTTTGGGAAGCGCCATCCGTCACAGGTCTTGGTCTCC	hRad50, RAD50-2	isoform 2 is encoded by transcript variant 2; RAD50 (S. cerevisiae) homolog; go_component: Mre11 complex; go_component: chromosome, telomeric region; go_function: ATP binding; go_function: ATPase activity; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nuclease activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: protein binding, bridging; go_function: 3'-5' exonuclease activity; go_function: single-stranded DNA specific endodeoxyribonuclease activity; go_process: meiosis; go_process: cell cycle; go_process: meiotic recombination; go_process: double-strand break repair; go_process: chromosome organization and biogenesis; go_process: regulation of mitotic recombination; go_process: telomerase-dependent telomere maintenance	RAD50 homolog isoform 2
RAD54B_P227_F	5965	0.1411609	7591.242	1264.152	4.023366E-11	23	286.8107	0.187674	8356.321	1953.688	1.676668E-10	31	607.5006	0.1408725	10009.9	1657.737	1.21896E-14	22	453.2784	0.08555661	6144.312	584.2266	0.0005014464	21	325.8491	0.2584885	6146.073	2177.361	2.473432E-07	33	388.1718	0.1457775	9019.744	1556.332	1.358781E-13	26	611.7404	0.1330264	8311.173	1290.591	1.002102E-07	26	486.9134	0.1845443	10212.65	2333.836	2.236287E-09	27	777.5016	0.1807309	5942.465	1332.969	1.311046E-05	28	536.7233	0.3210052	7115.681	3411.323	1.30367E-11	37	458.6071	RAD54B	RAD54B_P227_F	20143929	NM_134434.1	RAD54B	25788	8	36.1	95556713	-227	Y	GCCTACTTTCAGACACAGTGTAGATGCCGAGGCTACAGACCTCACCATCTGCGTGGA	.	isoform 2 is encoded by transcript variant 2; RAD54, S. cerevisiae, homolog of, B; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: DNA helicase activity; go_function: RNA helicase activity; go_process: DNA repair; go_process: meiotic recombination; go_process: mitotic recombination	RAD54 homolog B isoform 2
RAF1_P330_F	5069	0.04696044	7447.967	371.9214	1.23243E-08	29	343.5753	0.06911762	12016.86	899.6715	1.282477E-16	30	708.9995	0.0492197	14506.5	756.1446	1.013939E-25	22	852.9619	0.08475635	5955.035	560.7279	0.0008158729	21	284.7226	0.05072509	11295.26	608.9128	3.974519E-15	34	530.8936	0.1158729	10715.4	1417.456	4.234096E-18	28	920.0147	0.04625887	11423.47	558.9178	4.292052E-12	27	944.8369	0.05299993	14556.13	820.2471	3.963265E-14	34	977.8382	0.08250363	8400.156	764.3559	6.940662E-09	22	448.0377	0.04779986	16110.56	813.7599	4.032617E-31	27	706.3029	RAF1	RAF1_P330_F	52486392	NM_002880.2	RAF1	5894	3	36.1	12681008	-330	Y	AGGGCACAGTGTCCAACTTTGACGCGTCCTCTCCGGGCACTTTAATACCAA	CRAF, Raf-1, c-Raf	raf proto-oncogene serine/threonine protein kinase; Oncogene RAF1; go_component: mitochondrial outer membrane; go_function: ATP binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: diacylglycerol binding; go_function: receptor signaling protein activity; go_function: protein serine/threonine kinase activity; go_process: apoptosis; go_process: cell proliferation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	v-raf-1 murine leukemia viral oncogene homolog 1
RAN_P581_R	4881	0.4243869	2143.966	1654.427	0.02347887	26	114.7938	0.6357533	4059.24	7259.506	1.101783E-12	24	553.007	0.6873608	4209.937	9475.719	1.901321E-20	23	640.5376	0.7122003	1046.798	2837.913	0.07713865	38	119.6322	0.7250465	3084.974	8398.705	4.787655E-14	30	577.0428	0.5567769	4721.401	6056.646	3.876141E-14	25	569.9257	0.7040588	3903.648	9524.875	2.678099E-15	31	366.1214	0.691408	4177.227	9583.231	2.789932E-11	27	652.6105	0.6831097	3142.612	6989.988	6.442021E-11	13	874.4598	0.7573772	3211.257	10336.5	1.493634E-19	23	488.5174	RAN	RAN_P581_R	6042206	NM_006325.2	RAN	5901	12	36.1	129921940	-581	Y	GGGTGCATCCCTCTCTGGTTCCTCGCTCTCCAACTGGCCCTGGTCCTGGGG	TC4, Gsp1, ARA24	OK/SW-cl.81; member RAS oncogene family; go_component: nucleus; go_component: chromatin; go_component: cytoplasm; go_component: nuclear pore; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: protein binding; go_function: chromatin binding; go_function: androgen receptor binding; go_function: transcription coactivator activity; go_process: DNA metabolism; go_process: RNA export from nucleus; go_process: signal transduction; go_process: protein export from nucleus; go_process: intracellular protein transport; go_process: androgen receptor signaling pathway; go_process: small GTPase mediated signal transduction; go_process: mitotic spindle organization and biogenesis; go_process: regulation of progression through cell cycle; go_process: positive regulation of transcription, DNA-dependent	ras-related nuclear protein
RAP1A_P285_R	4896	0.3426885	569.9281	349.2661	0.7201342	31	35.10835	0.3873181	2900.022	1896.519	0.01257333	25	238.2202	0.3840786	3347.945	2150.083	0.002329968	21	247.9272	0.09341082	1612.747	176.4736	0.4799699	26	84.2641	0.356441	3457.305	1970.246	0.002461711	21	298.2552	0.4346189	2970.563	2360.398	0.001457713	20	372.1419	0.3929207	2830.309	1896.588	0.03133458	26	259.7175	0.4053631	3426.148	2403.77	0.0200059	29	165.5051	0.3916879	2404.525	1612.646	0.04778492	26	230.9154	0.4320958	3302.633	2588.928	0.0008613887	31	218.0725	RAP1A	RAP1A_P285_R	58331201	NM_001010935.1	RAP1A	5906	1	36.1	111963643	-285	Y	CCTAACAGGTGCTCAATTAGGGCTTGTCGAATGATTGAGTTCCCTCCAAATTCTCT	RAP1, KREV1, KREV-1, SMGP21	RAS-related protein RAP1A; Ras-related protein Krev-1; go_component: membrane; go_function: GTP binding; go_function: nucleotide binding; go_function: protein binding; go_process: cell cycle; go_process: small GTPase mediated signal transduction; go_process: negative regulation of progression through cell cycle	RAP1A, member of RAS oncogene family
RARA_E128_R	1151	0.1566852	5500.631	1040.58	4.610362E-06	29	155.7126	0.2413755	10144.58	3259.57	6.17343E-18	36	537.706	0.2110749	12229.09	3298.616	1.138256E-26	30	739.5137	0.4576459	4138.08	3576.15	4.140402E-05	27	265.0396	0.2407208	9415.821	3016.882	1.506421E-16	34	677.8188	0.2768997	10456.83	4042.571	2.620607E-26	29	650.5251	0.166494	11874.7	2391.962	2.391491E-17	24	1115.765	0.2199194	13346.2	3790.738	1.22115E-17	27	685.0166	0.2499349	7577.464	2558.266	6.33958E-11	26	535.2758	0.2143359	11729.6	3227.219	4.932284E-24	31	525.288	RARA	RARA_E128_R	75812906	NM_000964.2	RARA	5914	17	36.1	35719100	128	N	CCCTTCCCAATTCTTTGGCCGCCTTTGACCCCGGCCTCTGCTTCTGA	RAR, NR1B1	isoform a is encoded by transcript variant 1; Retinoic acid receptor, alpha polypeptide; nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR long form; nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR short form; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: retinoic acid receptor activity; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_function: retinoic acid receptor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	retinoic acid receptor, alpha isoform a
RARA_P1076_R	5118	0.7126832	3119.749	7986.517	8.839048E-18	22	565.2256	0.6763988	4085.803	8749.263	2.102923E-16	34	706.4653	0.7060105	4288.279	10538.37	3.376712E-24	31	808.3671	0.7157434	1762.713	4690.215	0.0009387241	19	265.8491	0.6501881	5381.847	10188.99	1.964488E-26	28	916.782	0.6858983	3004.87	6780.049	1.421631E-11	23	610.7966	0.611603	5621.691	9009.862	2.769969E-18	29	791.9708	0.6166577	7084.083	11556.56	5.610953E-21	21	1017.61	0.6994557	2778.794	6699.807	1.615808E-09	30	720.3186	0.57839	6605.547	9199.074	5.725447E-27	32	504.8531	RARA	RARA_P1076_R	75812906	NM_000964.2	RARA	5914	17	36.1	35717896	-1076	N	CCTCTCCCCTCAAGTCTGTCGCTGACTTCCTCTGGCCCTTCCCC	RAR, NR1B1	isoform a is encoded by transcript variant 1; Retinoic acid receptor, alpha polypeptide; nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR long form; nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR short form; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: retinoic acid receptor activity; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_function: retinoic acid receptor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	retinoic acid receptor, alpha isoform a
RARA_P176_R	5097	0.2268256	2242.42	687.1942	0.1129049	30	124.5191	0.6355867	3526.911	6325.832	1.371474E-09	22	535.1118	0.6034145	4547.79	7071.726	1.62783E-14	32	444.4966	0.05187156	2942.156	166.4346	0.1799499	28	98.08949	0.6071882	3567.154	5668.497	5.128192E-09	28	452.4755	0.7290146	2808.157	7823.629	9.639938E-14	26	412.7953	0.5576636	4454.636	5742.132	1.033906E-08	29	468.2037	0.6007671	4738.714	7281.314	1.29624E-08	19	669.3359	0.5932539	3553.132	5328.225	2.456999E-08	31	452.6556	0.5809377	4675.959	6620.818	2.02602E-13	27	408.1543	RARA	RARA_P176_R	75812906	NM_000964.2	RARA	5914	17	36.1	35718796	-176	N	GAACTGTTCCTGTCCCCAGCCGATGACCAGACGCCCATCTTTCTTC	RAR, NR1B1	isoform a is encoded by transcript variant 1; Retinoic acid receptor, alpha polypeptide; nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR long form; nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR short form; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: retinoic acid receptor activity; go_function: steroid hormone receptor activity; go_function: transcription factor activity; go_function: retinoic acid receptor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent	retinoic acid receptor, alpha isoform a
RARB_E114_F	4165	0.02506865	7852.669	204.4889	3.573E-09	22	286.5896	0.04881039	17270.27	891.3574	1.132381E-33	27	988.1975	0.04090866	18750.36	804.0349	3.678E-38	27	1282.931	0.02940317	6148.848	189.302	0.001207919	32	169.6346	0.04531964	15176.86	725.208	1.274127E-27	33	1463.879	0.08059432	16043.5	1415.126	3.678E-38	35	1108.199	0.04545268	17942.83	859.1453	6.892672E-31	32	1254.054	0.03834046	21532.21	862.4558	1.121348E-30	19	803.8811	0.0744506	8739.6	711.0517	1.843933E-09	27	584.101	0.04315578	22492.53	1018.973	3.678E-38	34	917.5591	RARB	RARB_E114_F	14916495	NM_016152.2	RARB	5915	3	36.1	25444872	114	Y	GAGGACTGGGATGCCGAGAACGCGAGCGATCCGAGCAGGGTTTGTC	HAP, RRB2, NR1B2	isoform 2 is encoded by transcript variant 2; retinoic acid receptor, beta polypeptide; retinoic acid receptor beta 4; hepatitis B virus activated protein; HBV-activated protein; RAR-epsilon; retinoic acid receptor beta 2; retinoic acid receptor beta 5; go_component: nucleus; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: retinoic acid receptor activity; go_function: retinoic acid receptor activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	retinoic acid receptor, beta isoform 2
RARB_P60_F	2853	0.128335	3550.906	537.5222	0.01236608	31	116.4651	0.09306382	8600.544	892.7925	6.624904E-09	32	443.852	0.08304092	9715.271	888.8828	5.281979E-12	31	273.374	0.0856279	3596.946	346.2066	0.07174546	23	216.8391	0.06094264	8537.43	560.5491	9.4882E-09	33	334.5752	0.1531117	8014.564	1467.058	7.565694E-11	16	236.1691	0.07262629	8923.729	706.6838	9.016065E-08	21	374.2203	0.07478801	9695.231	791.7817	1.320343E-06	30	414.4755	0.08567873	6769.939	643.7645	8.100673E-06	31	272.3202	0.07545857	10195.09	840.2578	8.655521E-13	34	509.7876	RARB	RARB_P60_F	14916495	NM_016152.2	RARB	5915	3	36.1	25444698	-60	Y	CTAGTTGGGTCATTTGAAGGTTAGCAGCCCGGGTAGGGTTCACCGAAAGTTCA	HAP, RRB2, NR1B2	isoform 2 is encoded by transcript variant 2; retinoic acid receptor, beta polypeptide; retinoic acid receptor beta 4; hepatitis B virus activated protein; HBV-activated protein; RAR-epsilon; retinoic acid receptor beta 2; retinoic acid receptor beta 5; go_component: nucleus; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: steroid hormone receptor activity; go_function: retinoic acid receptor activity; go_function: retinoic acid receptor activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	retinoic acid receptor, beta isoform 2
RARRES1_E235_F	3858	0.1266975	10110.35	1481.302	1.924657E-19	29	500.6069	0.03104475	16134.7	520.1502	4.025146E-28	34	1190.318	0.02342223	24523.13	590.5607	3.678E-38	23	735.5717	0.05578744	7629.927	456.7116	1.455387E-05	40	378.3895	0.02475679	19721.61	503.1763	3.678E-38	24	1205.931	0.04353162	18819.57	861.084	3.678E-38	30	1299.98	0.03656296	20224.69	771.3329	3.678E-38	26	1152.195	0.05482848	23500.29	1369.03	3.855121E-38	31	738.2197	0.07193511	12299.55	961.0999	3.868898E-19	31	1031.749	0.02889378	19252.91	575.8162	3.678E-38	26	1174.598	RARRES1	RARRES1_E235_F	46255042	NM_206963.1	RARRES1	5918	3	36.1	159932734	235	Y	GCCGCCTGCTGCAGGAGCCTGCGCGGGACCCCAGCATCCTGAGGCTGCC	TIG1	isoform 1 is encoded by transcript variant 1; RAR-responsive protein; go_component: membrane; go_component: integral to membrane; go_process: negative regulation of cell proliferation	retinoic acid receptor responder (tazarotene induced) 1 isoform 1
RARRES1_P426_R	1824	0.08981141	4349.97	439.0937	0.002046375	31	210.2404	0.9152414	537.0505	6879.009	1.591956E-05	20	337.2791	0.9393004	498.822	9266.521	3.956184E-10	29	285.5246	0.08843953	1236.106	129.6289	0.5899901	35	56.14124	0.9012148	566.2526	6078.205	9.076687E-05	25	365.929	0.8931571	708.9235	6762.222	1.047892E-06	24	353.0323	0.9078132	529.3764	6197.808	0.0006166226	28	464.4882	0.8728134	910.9526	6937.625	0.0006883895	27	306.7886	0.8927034	474.8964	4783.117	0.004231073	32	352.8466	0.9115552	515.4063	6342.678	5.419317E-05	25	345.7277	RARRES1	RARRES1_P426_R	46255042	NM_206963.1	RARRES1	5918	3	36.1	159933395	-426	Y	CGGAGAAAGGGGCAGGCCGCAGCGGGCATTGATGGGGCTCCT	TIG1	isoform 1 is encoded by transcript variant 1; RAR-responsive protein; go_component: membrane; go_component: integral to membrane; go_process: negative regulation of cell proliferation	retinoic acid receptor responder (tazarotene induced) 1 isoform 1
RARRES1_P57_R	1823	0.06335392	4420.963	305.794	0.002436499	35	131.5068	0.4190188	5961.338	4371.595	1.504649E-10	33	443.5786	0.3133652	7356.486	3402.978	2.269288E-12	26	309.6035	0.2153203	336.6091	119.8079	0.7950041	26	17.19092	0.4289906	5997.32	4580.822	7.204902E-12	26	436.1634	0.4792707	6853.636	6400.013	8.787919E-22	26	535.627	0.5246652	5686.196	6386.688	2.782143E-12	33	610.8828	0.5147976	6887.424	7413.625	3.41088E-12	26	681.0623	0.4274255	5720.704	4345.142	9.055232E-11	27	465.0699	0.313537	6351.936	2946.875	4.985659E-09	31	397.1373	RARRES1	RARRES1_P57_R	46255042	NM_206963.1	RARRES1	5918	3	36.1	159933026	-57	Y	CCAGGGCGAAGGTCTGTAGCGAGCCCGGGTCCCCATGGGGCCACTCC	TIG1	isoform 1 is encoded by transcript variant 1; RAR-responsive protein; go_component: membrane; go_component: integral to membrane; go_process: negative regulation of cell proliferation	retinoic acid receptor responder (tazarotene induced) 1 isoform 1
RASA1_E107_F	1697	0.1367785	12943.28	2066.723	1.97037E-33	31	786.2108	0.02760934	14655.14	418.9466	7.294043E-23	28	893.2508	0.02694917	19229.5	535.3408	3.678E-38	36	826.8282	0.1011805	8313.093	947.0652	3.713513E-07	24	385.0328	0.0249536	15853.16	408.2766	6.094703E-29	34	790.5449	0.02597615	17378.84	466.1415	3.678E-38	32	957.2111	0.02946293	15389.24	470.2122	1.24597E-21	27	890.0042	0.02882632	21979.05	655.349	2.311675E-31	37	1071.091	0.05169816	10988.08	604.4839	1.937452E-14	27	717.5816	0.02600409	20155.13	540.7788	3.678E-38	32	1005.598	RASA1	RASA1_E107_F	12545405	NM_022650.1	RASA1	5921	5	36.1	86600014	107	Y	GCGGGCAGGGTAGGGCAGAGTAGAGCGGGCTTCAACATGATGGCGGCC	GAP, PKWS, RASA, CMAVM, RASGAP, p120GAP, DKFZp434N071	isoform 2 is encoded by transcript variant 2; GTPase activating protein; triphosphatase-activating protein; go_component: cytoplasm; go_function: GTPase activity; go_function: receptor binding; go_function: receptor binding; go_function: GTPase inhibitor activity; go_function: Ras GTPase activator activity; go_function: potassium channel inhibitor activity; go_process: cytokinesis; go_process: cell adhesion; go_process: vasculogenesis; go_process: embryonic development; go_process: regulation of cell shape; go_process: regulation of RNA metabolism; go_process: intracellular signaling cascade; go_process: negative regulation of neuron apoptosis; go_process: negative regulation of cell adhesion; go_process: positive regulation of anti-apoptosis; go_process: actin cytoskeleton organization and biogenesis; go_process: negative regulation of cell-matrix adhesion; go_process: regulation of actin filament polymerization; go_process: positive regulation of inflammatory response	RAS p21 protein activator 1 isoform 2
RASGRF1_E16_F	3860	0.02957356	7877.438	243.1109	2.547761E-09	42	306.4172	0.04601977	13122.23	637.8373	6.226571E-19	23	929.9467	0.03750737	17510.1	686.2478	2.982243E-37	32	671.355	0.02677533	5941.733	166.22	0.001971305	24	392.0895	0.03155319	16616.27	544.6368	2.1749E-32	28	962.5496	0.07408616	17967.4	1445.647	3.678E-38	28	838.6479	0.04293558	16087.83	726.2142	1.922137E-24	37	1098.919	0.03355139	20458.69	713.719	2.644076E-27	34	739.5218	0.04812559	9995.325	510.4072	9.147305E-12	23	1093.249	0.03276803	18003.18	613.3023	5.424427E-38	24	1031.439	RASGRF1	RASGRF1_E16_F	24797098	NM_002891.3	RASGRF1	5923	15	36.1	77169879	16	Y	GCGACGTGGCCATCATTCAGCCGGATCCCCTTCTGCATGGTGCTCAGAGG	GNRP, GRF1, CDC25, GRF55, CDC25L, H-GRF55	isoform 1 is encoded by transcript variant 1; Ras-specific guanine nucleotide-releasing factor, CDC25 homolog; guanine nucleotide exchange factor; guanine nucleotide-releasing factor, 55 kD; Ras-specific nucleotide exchange factor CDC25; go_component: synaptosome; go_component: plasma membrane; go_function: Ras guanyl-nucleotide exchange factor activity; go_process: long-term memory; go_process: small GTPase mediated signal transduction	Ras protein-specific guanine nucleotide-releasing factor 1 isoform 1
RASGRF1_P768_F	1826	0.20401	2561.614	682.1641	0.06789679	31	111.8997	0.06393001	9980.441	688.4557	2.983114E-11	25	832.3497	0.08212463	11466.38	1034.873	6.531623E-17	22	594.9648	0.05724416	3816.026	237.7812	0.0623319	30	163.6067	0.09056721	10270.21	1032.732	1.352388E-13	19	712.315	0.1065576	9991.277	1203.549	2.671234E-15	19	1230.009	0.09919979	8008.907	892.9858	1.179999E-06	28	451.9611	0.0956578	11723.09	1250.6	5.04059E-10	38	495.527	0.09104743	7721.983	783.5078	1.22321E-07	35	465.6463	0.08633503	11486.88	1094.88	9.126157E-17	24	698.0176	RASGRF1	RASGRF1_P768_F	24797098	NM_002891.3	RASGRF1	5923	15	36.1	77170663	-768	Y	CAGTCCTAGTCTTTGCATAGTCAGCCGGGTCACATTGAATTCCAGCATCCGG	GNRP, GRF1, CDC25, GRF55, CDC25L, H-GRF55	isoform 1 is encoded by transcript variant 1; Ras-specific guanine nucleotide-releasing factor, CDC25 homolog; guanine nucleotide exchange factor; guanine nucleotide-releasing factor, 55 kD; Ras-specific nucleotide exchange factor CDC25; go_component: synaptosome; go_component: plasma membrane; go_function: Ras guanyl-nucleotide exchange factor activity; go_process: long-term memory; go_process: small GTPase mediated signal transduction	Ras protein-specific guanine nucleotide-releasing factor 1 isoform 1
RASSF1_E116_F	3865	0.05705659	5104.643	314.9279	0.0002977371	27	139.2845	0.02901396	8950.467	270.4363	2.089766E-08	29	488.1255	0.02187926	11304.1	255.0946	2.334597E-14	23	542.9286	0.02829158	5219.847	154.8889	0.00815647	24	181.9391	0.02771553	9328.919	268.7767	9.656643E-10	20	475.065	0.03385152	8520.853	302.054	2.312235E-09	22	487.7826	0.02621475	9152.975	249.0944	2.071659E-07	28	468.3798	0.02482867	12887.19	330.6645	2.096443E-10	31	709.4023	0.04844439	7777.952	401.0723	4.610442E-07	18	500.1757	0.02505671	10326.01	267.9556	9.197532E-12	26	396.7224	RASSF1	RASSF1_E116_F	25777679	NM_170712.1	RASSF1	11186	3	36.1	50353255	116	Y	CGACATGGCCCGGTTGGGCCCGTGCTTCGCTGGCTTTGGGCGCTAGCAAGCG	123F2, RDA32, NORE2A, RASSF1A, REH3P21	isoform B is encoded by transcript variant B; Ras association domain family protein 1; tumor suppressor protein RDA32; pancreas-specific ras association domain family 1 protein; cardiac-specific ras association domain family 1 protein; WUGSC:H_LUCA12.5; go_component: microtubule; go_component: nucleus; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: zinc ion binding; go_function: diacylglycerol binding; go_process: cell cycle; go_process: cell cycle arrest; go_process: intracellular signaling cascade; go_process: Ras protein signal transduction	Ras association domain family 1 isoform B
RASSF1_P244_F	1836	0.06059796	2169.096	146.3725	0.2536496	21	129.7571	0.03185215	10300.6	342.1807	3.390179E-11	26	622.1241	0.03887253	12981.87	529.0924	6.659808E-20	31	577.3076	0.2717056	282.3828	142.656	0.8008016	31	13.02569	0.03751251	7950.377	313.7598	3.130565E-07	27	946.0723	0.03738543	10409.05	408.144	3.029939E-14	20	733.2963	0.02663871	10822.19	298.9158	2.202965E-10	21	667.6765	0.03570217	13309.96	496.4905	2.341509E-11	32	560.68	0.03786455	8277.199	329.6822	7.998531E-08	33	562.4363	0.03510625	12584.65	461.5123	4.466046E-18	31	688.8921	RASSF1	RASSF1_P244_F	25777679	NM_170712.1	RASSF1	11186	3	36.1	50353615	-244	Y	GGCCCTGGCCCTCCTGGTCCGGTTTGCTGAAGCAACACACTTGGCCTACC	123F2, RDA32, NORE2A, RASSF1A, REH3P21	isoform B is encoded by transcript variant B; Ras association domain family protein 1; tumor suppressor protein RDA32; pancreas-specific ras association domain family 1 protein; cardiac-specific ras association domain family 1 protein; WUGSC:H_LUCA12.5; go_component: microtubule; go_component: nucleus; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: zinc ion binding; go_function: diacylglycerol binding; go_process: cell cycle; go_process: cell cycle arrest; go_process: intracellular signaling cascade; go_process: Ras protein signal transduction	Ras association domain family 1 isoform B
RBL2_P250_R	5132	0.04607914	3115.483	155.3239	0.06478932	24	116.093	0.1499519	6303.555	1129.613	1.506771E-05	28	215.9791	0.1523736	6551.082	1195.632	2.350611E-06	27	381.3598	0.04751007	2401.682	124.7835	0.2967534	29	108.6349	0.1786254	4944.425	1097.017	0.000515583	21	259.8442	0.1640327	5904.091	1178.117	4.871834E-06	36	288.4042	0.1525398	5960.272	1090.827	0.0002773577	27	353.8271	0.1881383	6541.221	1539.016	0.0004327261	31	273.551	0.2221379	4419.875	1290.763	0.00141543	19	358.2255	0.1845268	6908.241	1585.838	1.544625E-07	26	369.5829	RBL2	RBL2_P250_R	21361291	NM_005611.2	RBL2	5934	16	36.1	52025651	-250	Y	ACGTCAGTGTCTTTTGGACATTTTCTCGTCAGTACAGCCCTGTTGAATGTTCTCACG	Rb2, P130	go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_process: cell cycle; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle	retinoblastoma-like 2 (p130)
RBP1_E158_F	3868	0.08453067	4153.873	392.7852	0.003970557	33	156.7661	0.05060288	11114.81	597.7497	1.339291E-13	43	677.8761	0.04055241	15982.1	679.7327	6.108626E-31	30	687.0399	0.03910483	3314.413	138.9538	0.1267932	33	170.9914	0.04577225	13675.07	660.7605	3.013671E-22	35	528.6601	0.1003743	12547.81	1411.159	2.738947E-24	28	1082.561	0.04635147	14216.89	695.8635	5.043699E-19	22	789.0071	0.04587554	13951.15	675.5977	9.196215E-13	26	803.9187	0.0523587	8825.641	493.1559	3.416798E-09	32	900.0928	0.03053253	13760.28	436.5173	1.484935E-21	39	839.7192	RBP1	RBP1_E158_F	8400726	NM_002899.2	RBP1	5947	3	36.1	140741022	158	Y	GCGCAGGTACTCCTCGAAATTCTCGTTGACCAACATCTTCCAGTACCC	CRBP, RBPC, CRBP1, CRABP-I	retinol-binding protein 1, cellular; go_function: lipid binding; go_function: retinal binding; go_function: retinol binding; go_process: transport; go_process: vitamin A metabolism	retinol binding protein 1, cellular
RBP1_P150_F	1838	0.08479201	1572.586	154.9614	0.4450092	26	82.68557	0.0709001	6311.682	489.2788	0.0001040776	24	482.4091	0.0365766	7570.798	291.2237	1.525726E-06	23	352.666	0.174493	1991.516	442.0978	0.3181555	35	72.93034	0.0380678	7515.02	301.3592	1.739329E-06	26	331.5233	0.08677825	6988.065	673.5385	4.761813E-07	26	450.7318	0.04694688	7188.951	359.0498	7.44105E-05	23	387.1595	0.04386902	7386.957	343.5151	0.0008668046	23	514.8703	0.07344274	4899.59	396.2881	0.003877672	32	309.1485	0.03382053	7990.989	283.2202	3.704034E-07	20	448.5827	RBP1	RBP1_P150_F	8400726	NM_002899.2	RBP1	5947	3	36.1	140741330	-150	Y	GGGTCAGGTTTGTCCAGGCCGCGCCACCTTCGTTTCAGACGTTCAGTT	CRBP, RBPC, CRBP1, CRABP-I	retinol-binding protein 1, cellular; go_function: lipid binding; go_function: retinal binding; go_function: retinol binding; go_process: transport; go_process: vitamin A metabolism	retinol binding protein 1, cellular
RBP1_P426_R	1841	0.1108209	1618.219	214.1465	0.4083314	27	74.75292	0.2832881	5505.59	2215.67	5.83504E-06	24	505.2515	0.2090295	3402.429	925.5856	0.02742741	30	145.8966	0.08115142	1460.673	137.8365	0.5298335	15	172.8159	0.1887203	3612.167	863.5264	0.01860699	28	248.5339	0.3366403	5795.247	2991.707	2.763664E-09	15	494.144	0.2369011	5981.845	1888.085	2.992255E-05	25	486.4935	0.2735975	7072.137	2701.365	8.852966E-06	29	362.3002	0.2623979	4315.917	1570.938	0.0008958241	38	259.7072	0.213634	5166.931	1430.88	0.000120038	20	313.981	RBP1	RBP1_P426_R	8400726	NM_002899.2	RBP1	5947	3	36.1	140741606	-426	Y	GAAAGCTGGGAGGTTCAACTACGGGCGAGAAAATTGGGGCACTTTCCACG	CRBP, RBPC, CRBP1, CRABP-I	retinol-binding protein 1, cellular; go_function: lipid binding; go_function: retinal binding; go_function: retinol binding; go_process: transport; go_process: vitamin A metabolism	retinol binding protein 1, cellular
RET_P717_F	2861	0.07989433	5552.311	490.7997	3.301387E-05	22	209.5635	0.09814896	11400.69	1251.626	6.296334E-16	37	799.869	0.1121807	13083.65	1665.825	6.206496E-24	34	862.2484	0.07265767	4981.041	398.1017	0.008092255	22	392.8794	0.08237292	10866.4	984.4244	5.481045E-15	21	1275.149	0.1193607	11102.01	1518.305	1.175398E-19	18	1377.328	0.07283813	12947.27	1024.998	1.301576E-16	31	954.2158	0.08343732	17069.95	1563.029	5.845963E-21	24	589.6331	0.1119879	7289.395	931.8824	3.896651E-07	35	629.6322	0.0910882	12097.01	1222.345	7.144416E-19	34	617.97	RET	RET_P717_F	50593520	NM_020630.3	RET	5979	10	36.1	42891816	-717	N	CTGAAAGGACGCCGGAGCCAGTTTCCGGTTTCCAAGGGTTGGACCAGT	PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, RET-ELE1	isoform c is encoded by transcript variant 4; hydroxyaryl-protein kinase; RET transforming sequence; oncogene RET; cadherin family member 12; proto-oncogene; receptor tyrosine kinase; fusion gene; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_component: cAMP-dependent protein kinase complex; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: calcium ion binding; go_function: transferase activity; go_function: receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: cAMP-dependent protein kinase activity; go_function: cAMP-dependent protein kinase regulator activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: signal transduction; go_process: signal transduction; go_process: homophilic cell adhesion; go_process: posterior midgut development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction	ret proto-oncogene isoform c
RET_seq_53_S374_F	6099	0.090832	4915.031	501.0354	0.0003011903	27	213.7189	0.04416171	7130.019	334.0419	1.363814E-05	29	279.7002	0.03864105	8747.346	355.612	8.914032E-09	21	364.5841	0.04028776	4280.79	183.9012	0.03553945	34	187.2774	0.04118342	6278.293	273.9626	0.00011993	32	266.7372	0.07490701	7569.832	621.0448	4.691717E-08	20	474.7148	0.06121273	7513.871	496.4551	1.982298E-05	14	451.0202	0.05867875	7559.224	477.4498	0.0004727862	29	279.4332	0.06868173	6486.865	485.7601	3.620239E-05	31	379.5215	0.04366659	7127.312	330.0022	7.532285E-06	22	379.9601	RET	RET_seq_53_S374_F	50593520	NM_020630.3	RET	5979	10	36.1	42892087	-446	Y	GCGGGGTCGCACCCCGAGCCAGTCGGCCAGACCTGCATCCCGCGTAGCATCC	PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, RET-ELE1	isoform c is encoded by transcript variant 4; hydroxyaryl-protein kinase; RET transforming sequence; oncogene RET; cadherin family member 12; proto-oncogene; receptor tyrosine kinase; fusion gene; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_component: cAMP-dependent protein kinase complex; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: calcium ion binding; go_function: transferase activity; go_function: receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: cAMP-dependent protein kinase activity; go_function: cAMP-dependent protein kinase regulator activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: signal transduction; go_process: signal transduction; go_process: homophilic cell adhesion; go_process: posterior midgut development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction	ret proto-oncogene isoform c
RET_seq_54_S260_F	6103	0.04476136	3440.581	165.9075	0.03473205	31	145.1999	0.04360722	10282.63	473.4015	1.94172E-11	29	522.5482	0.03184652	11624.84	385.6779	1.491595E-15	25	698.4425	0.02461673	6578.865	168.5612	0.0004798177	18	188.5029	0.03873399	9503.721	386.9797	2.366793E-10	21	494.0405	0.05029464	10578.05	565.4898	3.735909E-15	32	497.2715	0.04076207	10105.22	433.6629	2.603692E-09	28	615.4389	0.0429627	12114.06	548.3058	1.501295E-09	29	555.6552	0.05031615	8777.518	470.3486	4.741064E-09	20	597.8593	0.04646726	8289.912	408.8546	6.677131E-08	27	398.7998	RET	RET_seq_54_S260_F	50593520	NM_020630.3	RET	5979	10	36.1	42892544	11	Y	AGCTTCAGTCCCGCGACCGAAGCAGGGCGCGCAGCAGCGCTGAGTGCCCCGG	PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, RET-ELE1	isoform c is encoded by transcript variant 4; hydroxyaryl-protein kinase; RET transforming sequence; oncogene RET; cadherin family member 12; proto-oncogene; receptor tyrosine kinase; fusion gene; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_component: cAMP-dependent protein kinase complex; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: calcium ion binding; go_function: transferase activity; go_function: receptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_function: cAMP-dependent protein kinase activity; go_function: cAMP-dependent protein kinase regulator activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: signal transduction; go_process: signal transduction; go_process: homophilic cell adhesion; go_process: posterior midgut development; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation; go_process: cell surface receptor linked signal transduction	ret proto-oncogene isoform c
RHOC_P536_F	5160	0.04224727	3368.301	152.9896	0.04098718	27	118.4406	0.05956493	7338.003	471.1055	4.332287E-06	30	538.7995	0.05244627	9256.007	517.8468	3.794577E-10	30	518.0937	0.211395	310.1303	109.9403	0.8017104	26	12.52659	0.07005952	6236.502	477.3772	7.336148E-05	26	385.2379	0.1085164	7574.926	934.2347	1.065043E-08	31	478.8438	0.04734285	8002.764	402.6716	5.933559E-06	37	340.7896	0.04512253	9140.021	436.6352	1.455656E-05	35	342.3975	0.08939403	5710.091	570.3756	0.0003026042	25	190.7211	0.06297415	8514.648	578.9597	1.238856E-08	30	467.4828	RHOC	RHOC_P536_F	34222243	NM_175744.3	RHOC	389	1	36.1	113051779	-536	Y	TCCTAGGATCGTACAGCCCAACGTCATCCCCCAAACTTGAAGACC	ARH9, ARHC, RHOH9	Aplysia RAS-related homolog 9 (oncogene RHO H9); RAS homolog gene family, member C (oncogene RHO H9); Aplysia ras-related homolog 9; go_component: membrane; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: signal transducer activity; go_process: small GTPase mediated signal transduction; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	ras homolog gene family, member C
RHOH_P121_F	5163	0.06774513	1848.765	141.6129	0.3546194	31	64.33295	0.04884713	5828.821	304.4788	0.0006423921	32	235.3382	0.06289922	6892.061	469.3147	9.421777E-06	24	251.0455	0.06312346	1882.74	133.59	0.4210603	24	80.89967	0.04704692	3874.293	196.2093	0.03809345	27	147.9908	0.04490108	4400.292	211.5676	0.008595603	42	168.4503	0.05747235	6262.695	387.977	0.0007397015	24	226.0378	0.06849275	6751.017	503.748	0.0021021	24	244.0764	0.06536496	4741.56	338.601	0.006305886	27	297.1064	0.06891853	5004.997	377.8712	0.003011679	39	263.4794	RHOH	RHOH_P121_F	45827772	NM_004310.2	RHOH	399	4	36.1	39874876	-121	Y	GTGGGGGATAAATTAAACGCAAACCCAGCGGTGCGGCAAAGGCCTTATTCTG	TTF, ARHH	rho-related GTP-binding protein; TTF, translocation three four; go_component: cytoplasm; go_function: GTP binding; go_function: nucleotide binding; go_function: Rho GTPase binding; go_function: GTPase inhibitor activity; go_function: kinase inhibitor activity; go_process: protein transport; go_process: T cell differentiation; go_process: regulation of transcription; go_process: small GTPase mediated signal transduction; go_process: negative regulation of I-kappaB kinase/NF-kappaB cascade	ras homolog gene family, member H
RHOH_P953_R	5169	0.4162984	1881.876	1413.482	0.06206354	29	96.33044	0.8674363	1034.81	7425.68	4.204555E-07	28	344.7265	0.8954954	1063.247	9967.813	5.004281E-13	25	467.7249	0.2932096	1298.082	579.9894	0.4567982	27	82.28021	0.8980994	918.8556	8979.668	2.278051E-10	26	540.5993	0.8525983	1334.543	8297.658	3.324378E-11	31	337.4296	0.8942448	1007.517	9364.939	5.126569E-09	26	558.3778	0.8952295	1172.221	10870.71	1.202996E-08	32	407.3979	0.8514528	1130.126	7050.919	4.573619E-07	26	477.7578	0.878211	1217.592	9501.052	4.771257E-12	41	348.3129	RHOH	RHOH_P953_R	45827772	NM_004310.2	RHOH	399	4	36.1	39874044	-953	N	GGCCTTTGCACATACTATTTGCCTCTACGTGGAATGTTCTTTCCTCCTTCTCATC	TTF, ARHH	rho-related GTP-binding protein; TTF, translocation three four; go_component: cytoplasm; go_function: GTP binding; go_function: nucleotide binding; go_function: Rho GTPase binding; go_function: GTPase inhibitor activity; go_function: kinase inhibitor activity; go_process: protein transport; go_process: T cell differentiation; go_process: regulation of transcription; go_process: small GTPase mediated signal transduction; go_process: negative regulation of I-kappaB kinase/NF-kappaB cascade	ras homolog gene family, member H
RIPK1_P744_R	5140	0.6916962	436.0208	1202.592	0.4765162	36	53.97746	0.9264963	745.0219	10651.29	7.322246E-13	26	638.1974	0.913592	949.8621	11100.19	1.165481E-15	30	445.6218	0.8535423	362.8567	2697.487	0.1883717	34	118.335	0.9266241	652.8743	9507.634	6.208305E-11	31	432.0369	0.8842379	1072.966	8959.597	3.468657E-12	24	480.244	0.9185476	780.5618	9930.195	1.27633E-09	20	554.5546	0.9364085	703.5668	11832.81	2.314912E-09	35	412.7852	0.9114652	769.6473	8953.018	5.000639E-10	25	359.131	0.9419978	611.9769	11563.03	1.1586E-15	23	552.9025	RIPK1	RIPK1_P744_R	57242760	NM_003804.3	RIPK1	8737	6	36.1	3021313	-744	N	CCCCTGTGTGAGCTACTGCCTGCCTCCGGTGCTCTGTTTCTGTCCCTAGAGTTCTTTT	RIP, FLJ39204	receptor interacting protein; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: signal transducer activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	receptor (TNFRSF)-interacting serine-threonine kinase 1
RIPK1_P868_F	5133	0.5378953	1788.902	2198.704	0.01555869	26	89.59109	0.8769981	1399.113	10688.61	1.666921E-14	31	426.4649	0.8886654	1336.828	11468.67	8.737926E-18	24	461.7141	0.2856614	2840.294	1175.813	0.06542452	24	142.1091	0.9112483	908.9799	10359.6	1.644074E-13	28	542.4417	0.8600053	1485.364	9739.094	2.198842E-15	33	364.8392	0.8871249	1251.847	10624.64	7.094946E-12	34	486.5972	0.920611	1083.271	13721.45	4.429958E-13	38	477.9456	0.8782318	1172.299	9176.235	2.102863E-11	24	846.7906	0.9177733	1056.162	12904.5	8.174031E-21	26	522.3307	RIPK1	RIPK1_P868_F	57242760	NM_003804.3	RIPK1	8737	6	36.1	3021189	-868	N	TTCATCAAAGGGTTGCACATTGAGCAGTGCCGTGTTAAGGGGGGATTCTTCA	RIP, FLJ39204	receptor interacting protein; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: signal transducer activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: apoptosis; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	receptor (TNFRSF)-interacting serine-threonine kinase 1
RIPK2_E123_F	2902	0.06478229	5725.81	403.5524	2.379694E-05	24	233.9467	0.1302369	9519.951	1440.475	6.981557E-12	33	541.7634	0.1350863	11818.7	1861.518	1.977541E-20	27	761.45	0.1914855	4101.129	994.9796	0.01324003	36	201.6767	0.1273347	10996.15	1619.092	4.685718E-17	37	537.9179	0.1465408	12805.01	2215.817	2.448983E-28	29	951.6359	0.1455132	11464.54	1969.361	2.600958E-15	29	682.2915	0.1286588	13901.43	2067.395	2.911769E-15	34	530.18	0.1431747	8968.85	1515.396	1.025848E-11	26	638.8054	0.1178949	12519.98	1686.682	1.381825E-21	31	695.9607	RIPK2	RIPK2_E123_F	40255024	NM_003821.4	RIPK2	8767	8	36.1	90839296	123	Y	TGGGCGCCCTCGTGACCTAGTGTTGCGGGGCAAAAAGGGTCTTGC	RICK, RIP2, CARD3, GIG30, CARDIAK	receptor interacting protein 2; go_component: intracellular; go_function: ATP binding; go_function: protein binding; go_function: nucleotide binding; go_function: transferase activity; go_function: LIM domain binding; go_function: signal transducer activity; go_function: protein serine/threonine kinase activity; go_process: regulation of apoptosis; go_process: signal transduction; go_process: inflammatory response; go_process: protein amino acid phosphorylation; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	receptor-interacting serine-threonine kinase 2
RIPK3_P124_F	2305	0.5630194	2658.546	3554.197	1.724827E-05	31	213.2619	0.1787737	7641.428	1685.24	1.344023E-08	42	533.9018	0.1786539	9327.563	2050.623	6.800538E-14	33	267.4403	0.6298423	1024.485	1913.369	0.2108208	40	78.63403	0.1835733	7221.289	1646.19	2.594706E-08	20	402.3463	0.2114477	7776.501	2112.057	7.917119E-12	28	527.1755	0.1719544	8462.596	1778.133	8.686049E-09	15	468.1595	0.1625795	8026.442	1577.693	1.359003E-05	29	388.3245	0.1866686	6490.808	1512.663	9.170624E-07	27	493.2069	0.199432	9118.677	2296.494	1.036255E-13	27	475.334	RIPK3	RIPK3_P124_F	40254843	NM_006871.2	RIPK3	11035	14	36.1	23879137	-124	N	AAAGCTAGTGCCTTTCTCCTTGACTAGCGTTTCCTGAGCACCTGCCGCAGCC	RIP3, RIP3 beta, RIP3 gamma	receptor-interacting protein 3; Ser/Thr kinase; receptor interacting protein 3; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation	receptor-interacting serine-threonine kinase 3
RIPK3_P24_F	2308	0.1857679	965.5508	243.1066	0.6273605	17	30.98623	0.04451312	4970.428	236.2152	0.00554473	25	163.1688	0.03732663	6505.115	256.1063	6.902182E-05	25	362.65	0.276355	2581.904	1024.2	0.1071447	20	183.6446	0.03262341	6058.907	207.7004	0.0002759418	28	246.0859	0.05399631	4497.934	262.4424	0.006118109	28	184.3743	0.04559179	5786.663	281.2041	0.002720694	25	277.3035	0.07356695	6315.48	509.4457	0.004416754	27	278.0189	0.08748519	3595.805	354.3266	0.05320814	31	300.1584	0.04517926	4961.902	239.5141	0.004551174	28	169.527	RIPK3	RIPK3_P24_F	40254843	NM_006871.2	RIPK3	11035	14	36.1	23879037	-24	N	TCCGGGTTGTTACCCTTTTTCCGAGTTGACTGAACAACTTCCCTTATAGGCGC	RIP3, RIP3 beta, RIP3 gamma	receptor-interacting protein 3; Ser/Thr kinase; receptor interacting protein 3; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation	receptor-interacting serine-threonine kinase 3
RIPK4_E166_F	2906	0.07565005	4598.624	384.5417	0.001166627	32	215.866	0.09777346	11190.14	1223.503	2.567384E-15	34	758.6138	0.08870851	17040.31	1668.501	3.678E-38	31	828.3208	0.03015581	4816.333	152.8658	0.01634531	32	222.0852	0.1053957	14112.31	1674.389	3.32771E-27	33	733.619	0.1255405	13744.57	1987.575	3.10171E-31	26	1144.3	0.09990591	15141.16	1691.692	1.684747E-24	35	1185.897	0.0942741	17053.44	1785.446	1.930565E-21	33	818.1293	0.1399589	8964.267	1475.075	1.302429E-11	32	572.6517	0.08147459	16430.71	1466.299	5.541201E-35	26	894.4789	RIPK4	RIPK4_E166_F	41327753	NM_020639.2	RIPK4	54101	21	36.1	42060152	166	Y	AGCCAGGTCTTCCAGTGGACATGGCGCACCTTGTACACCTGCCCGAAGCCG	DIK, PKK, RIP4, ANKK2, ANKRD3	PKC-delta-interacting protein kinase; serine/threonine-protein kinase ANKRD3; go_component: cellular component unknown; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	ankyrin repeat domain 3
RIPK4_P172_F	2311	0.03412872	7089.703	254.0456	1.296504E-07	33	224.6295	0.0939472	14289.28	1492.002	3.819927E-25	16	1389.07	0.07214207	20326.99	1588.223	3.678E-38	39	1107.538	0.02384936	7773.909	192.3757	2.053166E-05	27	321.7694	0.0847713	14641.71	1365.422	5.279658E-28	36	1356.259	0.1173055	18943.07	2530.726	3.678E-38	29	1157.392	0.1072707	14626.35	1769.524	3.452078E-23	36	976.6261	0.1147831	21703.31	2827.162	4.553376E-37	34	913.1375	0.09440458	9865.386	1038.85	1.038141E-12	34	554.7198	0.07301526	23235.61	1838.062	3.678E-38	26	754.372	RIPK4	RIPK4_P172_F	41327753	NM_020639.2	RIPK4	54101	21	36.1	42060490	-172	Y	GCAGAGCTTCTCACGCTTCTCACGGGTCTCGACGTGCGCATCAGCTGCCC	DIK, PKK, RIP4, ANKK2, ANKRD3	PKC-delta-interacting protein kinase; serine/threonine-protein kinase ANKRD3; go_component: cellular component unknown; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	ankyrin repeat domain 3
ROR1_P6_F	2320	0.5121676	4278.504	4596.924	3.572043E-11	26	358.146	0.08665959	7056.646	679.037	5.558144E-06	24	320.7905	0.05713793	8671.909	531.5822	5.649014E-09	25	431.9622	0.3354234	2388.523	1256.001	0.1025679	25	219.1565	0.06541352	7083.667	502.7988	4.015246E-06	30	372.8982	0.1050568	7371.942	877.1266	3.59561E-08	29	411.418	0.0793655	7908.333	690.3775	3.206071E-06	30	390.9644	0.07599268	9376.91	779.4049	3.252474E-06	32	306.3835	0.1043849	5704.839	676.5605	0.0002258578	28	391.8542	0.1080502	8472.744	1038.496	1.895002E-09	19	482.1337	ROR1	ROR1_P6_F	4826867	NM_005012.1	ROR1	4919	1	36.1	64012296	-6	Y	GTGACAAGTTGAGCGAGAGAGGGAGCGTGGAGAGCTGGAGCAGCCGCCAC	NTRKR1, MGC99659, dJ537F10.1	neurotrophic tyrosine kinase receptor-related 1; go_component: cytoplasm; go_component: plasma membrane; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	receptor tyrosine kinase-like orphan receptor 1
ROR2_E112_F	3066	0.184209	6271.611	1438.736	2.150939E-08	24	355.1115	0.07099128	9347.734	721.9596	5.129516E-10	39	636.1824	0.0571842	13656.12	834.3439	4.663557E-23	28	702.6086	0.0546949	5696.054	335.3569	0.002309149	31	343.9916	0.0704644	12900	985.478	8.126836E-21	32	529.231	0.09656025	10488.99	1131.759	1.538873E-16	37	577.2215	0.07085684	9783.205	753.6973	2.624983E-09	20	1158.753	0.05230265	14683.18	815.8718	2.329354E-14	33	324.5309	0.1016232	8024.958	919.0845	1.864808E-08	33	498.2992	0.06571382	14048.99	995.181	2.505833E-24	32	520.6535	ROR2	ROR2_E112_F	19743897	NM_004560.2	ROR2	4920	9	36.1	93752153	112	Y	CACCCCTTTCTACGATGCGTCCGCTCCTCCTTCTCCCTGGCGCTTC	BDB, BDB1, NTRKR2	neurotrophic tyrosine kinase receptor-related 2; Tyrosine-protein kinase transmembrane receptor ROR2; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: development; go_process: signal transduction; go_process: protein amino acid phosphorylation	receptor tyrosine kinase-like orphan receptor 2 precursor
ROR2_P317_R	2324	0.06135466	3539.201	237.8768	0.02455388	26	160.4055	0.03847665	7803.47	316.2679	1.463997E-06	29	456.387	0.03876885	8594.345	350.6646	1.803439E-08	28	541.9003	0.03649463	3761.887	146.2764	0.0749385	26	148.9211	0.04106939	7186.027	312.0483	5.494847E-06	23	696.4622	0.04173653	8180.271	360.6417	9.152244E-09	29	367.2376	0.03129805	7578.531	248.0876	3.391532E-05	22	380.7161	0.04604184	9970.519	486.0436	1.436661E-06	25	596.4954	0.06369879	6674.983	460.9181	2.107399E-05	30	391.236	0.04280562	9070.905	410.1218	2.177902E-09	28	478.8115	ROR2	ROR2_P317_R	19743897	NM_004560.2	ROR2	4920	9	36.1	93752582	-317	Y	GGCGGGTCTGCCCACGCAGGAGAGGCGCCCAGAGCGGGTGCCCCCGACT	BDB, BDB1, NTRKR2	neurotrophic tyrosine kinase receptor-related 2; Tyrosine-protein kinase transmembrane receptor ROR2; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: development; go_process: signal transduction; go_process: protein amino acid phosphorylation	receptor tyrosine kinase-like orphan receptor 2 precursor
RRAS_P100_R	5966	0.1751183	1033.143	240.5605	0.605193	35	37.79074	0.1252243	4513.745	660.4586	0.005933423	38	188.5311	0.1389201	5330.29	876.0822	0.0003620051	35	216.1431	0.0477305	2705.308	140.6102	0.2286564	35	75.08875	0.1010137	4739.903	543.8311	0.003447021	37	180.8322	0.0877987	4950.276	486.0853	0.001093576	31	233.1532	0.08511279	5629.043	532.9781	0.002226601	34	160.7301	0.1113333	6202.82	789.6249	0.003328627	26	224.5273	0.1120663	5197.457	668.593	0.0009464013	34	206.7081	0.1146138	3319.385	442.6414	0.06540534	26	104.9119	RRAS	RRAS_P100_R	20127497	NM_006270.2	RRAS	6237	19	36.1	54835312	-100	Y	TCCGGACACTTAAGGAGGGGGACGGGCCAAAGAAAGGGAGGA	.	Oncogene RRAS; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_process: intracellular protein transport; go_process: Ras protein signal transduction	related RAS viral (r-ras) oncogene homolog
RUNX1T1_E145_R	5716	0.2179788	4621.507	1316.062	4.890276E-05	33	295.945	0.3354264	7034.712	3601.063	3.508334E-11	21	397.2968	0.3876033	8171.882	5235.509	1.388276E-19	29	849.2135	0.04135601	5633.088	247.3261	0.003133372	21	271.5179	0.341331	7073.607	3717.458	2.312227E-12	31	493.1879	0.3936845	7207.574	4744.854	1.532066E-17	32	836.327	0.3479986	7698.826	4162.538	7.619548E-12	31	485.4225	0.3358758	7511.056	3849.234	1.037177E-07	30	759.9863	0.3267552	6713.908	3307.089	1.136594E-10	27	365.231	0.4212832	7754.355	5717.664	2.518161E-19	29	507.175	RUNX1T1	RUNX1T1_E145_R	28329418	NM_175635.1	RUNX1T1	862	8	36.1	93176474	145	N	GGATAGCAGAGGTGATGGGAGATAGCGTCAAGGCCAGGGGTAGATGCCTC	CDR, ETO, MTG8, MTG8b, AML1T1, ZMYND2, CBFA2T1, MGC2796	isoform MTG8c is encoded by transcript variant 3; acute myelogenous leukemia 1 translocation 1, cyclin-D related; myeloid translocation gene on 8q22; eight twenty one protein; core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related; go_component: nucleus; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: generation of precursor metabolites and energy	acute myelogenous leukemia 1 translocation 1 protein isoform MTG8c
RUNX1T1_P103_F	5176	0.5413324	17994.76	21355.94	3.678E-38	28	1494.521	0.156837	8063.169	1518.434	4.528119E-09	24	468.5016	0.2188314	7400.236	2101.067	1.412473E-09	25	261.2096	0.4576622	14572.84	12381.96	3.678E-38	33	2404.824	0.1830246	7288.003	1655.112	1.871409E-08	23	483.5611	0.2753223	7891.114	3036.014	1.508975E-14	38	323.6662	0.1853672	8289.402	1908.982	1.027318E-08	25	423.3112	0.2449374	7505.285	2467.105	5.291853E-06	28	572.339	0.1954161	7851.775	1931.315	3.720096E-10	35	404.2141	0.1837003	7841.463	1787.149	1.098321E-09	23	284.3359	RUNX1T1	RUNX1T1_P103_F	28329418	NM_175635.1	RUNX1T1	862	8	36.1	93176722	-103	Y	CCCTCCTTCCTCCCTGCTCGCCTCCCTCCCCTGTTCACGGA	CDR, ETO, MTG8, MTG8b, AML1T1, ZMYND2, CBFA2T1, MGC2796	isoform MTG8c is encoded by transcript variant 3; acute myelogenous leukemia 1 translocation 1, cyclin-D related; myeloid translocation gene on 8q22; eight twenty one protein; core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related; go_component: nucleus; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: generation of precursor metabolites and energy	acute myelogenous leukemia 1 translocation 1 protein isoform MTG8c
RUNX3_E27_R	3879	0.2171717	5557.801	1569.583	3.565165E-07	28	318.614	0.5367945	6979.569	8204.293	3.284724E-23	27	1067.952	0.5532152	9297.095	11635.61	3.678E-38	24	954.6794	0.1343652	7434.558	1169.526	3.097106E-06	22	370.6804	0.4220795	10570.16	7792.862	2.575353E-37	21	1055.766	0.4682069	9760.617	8681.59	3.678E-38	21	1748.819	0.5195754	9553.864	10440.58	3.88152E-35	28	1639.037	0.6942083	7297.636	16794.11	1.054296E-35	26	1068.308	0.2617775	8716.541	3126.392	4.245133E-15	30	825.816	0.5776363	10210.82	14101.36	3.678E-38	21	990.8959	RUNX3	RUNX3_E27_R	72534651	NM_001031680.1	RUNX3	864	1	36.1	25164035	27	N	CGGCAGCCAGGGTGGAGGAGCTCCGAAGCTGACAGAGCAGAGTGGGCC	AML2, CBFA3, PEBP2aC	isoform 1 is encoded by transcript variant 1; core-binding factor, runt domain, alpha subunit 3; encoded by distal 5' portion of the mRNA; go_component: nucleus; go_function: ATP binding; go_function: transcription factor activity; go_process: transcription; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	runt-related transcription factor 3 isoform 1
RUNX3_P247_F	1869	0.1425076	2015.816	351.6297	0.239025	28	85.91926	0.145541	5463.725	947.6757	0.0003093597	32	435.1843	0.1242457	7216.936	1038.074	3.299845E-07	24	497.7464	0.06820912	1669.897	129.5603	0.4772953	28	106.1733	0.2122541	6194.519	1696.025	1.319534E-06	26	304.7059	0.1211479	7240.89	1011.926	3.53425E-08	28	390.4167	0.1514765	6750.672	1222.967	2.209368E-05	33	313.3464	0.3734309	6213.008	3762.51	5.24868E-06	36	295.3027	0.087247	5069.989	494.1819	0.002042825	24	378.1156	0.2270468	4551.413	1366.303	0.0008046543	26	144.0932	RUNX3	RUNX3_P247_F	72534651	NM_001031680.1	RUNX3	864	1	36.1	25164309	-247	Y	CGGCCTTGGCTCATTGGCTGGGCCGCGGTCACCTGGGCCGTGATGTCACGGCC	AML2, CBFA3, PEBP2aC	isoform 1 is encoded by transcript variant 1; core-binding factor, runt domain, alpha subunit 3; encoded by distal 5' portion of the mRNA; go_component: nucleus; go_function: ATP binding; go_function: transcription factor activity; go_process: transcription; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	runt-related transcription factor 3 isoform 1
RUNX3_P393_R	1870	0.1994523	879.7429	244.0979	0.655634	18	43.1803	0.1616157	7392.095	1444.254	9.901617E-08	23	377.8801	0.1499069	8799.422	1569.34	1.849543E-11	27	426.6758	0.02901404	6181.036	187.6837	0.001130051	19	209.4889	0.1309505	7698.944	1175.164	2.521773E-08	20	549.3729	0.08358191	8909.45	821.7069	1.920574E-11	26	565.8041	0.09204584	9423.488	965.4645	4.796301E-09	25	487.292	0.3357052	6710.006	3441.476	3.294782E-06	24	604.4164	0.1123498	7552.981	968.6373	1.143749E-07	32	311.018	0.3349387	6768.815	3459.279	5.997057E-11	21	339.5861	RUNX3	RUNX3_P393_R	72534651	NM_001031680.1	RUNX3	864	1	36.1	25164455	-393	Y	TTTTATTTGTGAGGCTGGCCTCAGCACGCGGCCCAAGAAACAGAACTGAAAGCGG	AML2, CBFA3, PEBP2aC	isoform 1 is encoded by transcript variant 1; core-binding factor, runt domain, alpha subunit 3; encoded by distal 5' portion of the mRNA; go_component: nucleus; go_function: ATP binding; go_function: transcription factor activity; go_process: transcription; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	runt-related transcription factor 3 isoform 1
RYK_P493_F	5179	0.3091	1028.97	505.087	0.5137309	27	50.7587	0.1910591	6132.971	1472.129	8.598006E-06	33	307.9265	0.2463611	7081.467	2347.589	1.986568E-09	24	423.1729	0.2280219	2447.322	752.4114	0.1646976	27	115.232	0.300323	5384.256	2354.012	2.318829E-06	28	323.4857	0.3768098	5333.937	3285.612	6.269252E-09	25	283.428	0.3063428	5240.444	2358.523	6.461537E-05	41	292.6945	0.239859	6536.541	2094.131	0.0001345368	27	376.6079	0.2605123	5029.51	1807.063	5.616157E-05	28	290.2787	0.4699242	5462.999	4931.725	2.577469E-11	29	394.4322	RYK	RYK_P493_F	88971122	XM_940269.1	RYK	6259	3	36.1	135452769	-493	Y	AGAAATCATCCTTTATCTTACCATCGGTGATCAACTTTATCGTTTCCGTATCTATT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to RYK receptor-like tyrosine kinase isoform 2
S100A12_P1035_R	1873	0.9131479	398.1953	5237.939	0.0001433944	33	160.6382	0.3324825	455.6282	276.7518	0.7706853	39	33.95157	0.9547867	402.0072	10601.08	5.859179E-13	31	342.2514	0.7618522	344.0475	1420.54	0.4864093	24	106.9027	0.9516851	350.9037	8881.702	5.199048E-09	29	458.8576	0.9462707	418.8114	9137.214	5.048982E-11	35	434.2747	0.9474541	421.34	9400.268	4.411519E-08	17	429.1934	0.9496068	419.0051	9780.104	2.899856E-06	25	491.647	0.8828752	502.2113	4539.41	0.006859566	27	334.2304	0.9236662	383.9736	5856.254	0.0003368623	35	254.5187	S100A12	S100A12_P1035_R	5032058	NM_005621.1	S100A12	6283	1	36.1	151615734	-1035	N	GATCTGGAGGCAAAAGTCTGTCTCTCCGATCCATGTGTCACCTTGACTGACACAA	p6, CGRP, MRP6, CAAF1, ENRAGE	S100 calcium-binding protein A12 (calgranulin C); go_component: cytosol; go_component: insoluble fraction; go_function: zinc ion binding; go_function: calcium ion binding; go_process: inflammatory response; go_process: xenobiotic metabolism; go_process: defense response to bacteria; go_process: defense response to fungi	S100 calcium-binding protein A12
S100A12_P1221_R	1871	0.6325158	2614.433	4672.096	1.700108E-07	39	286.1118	0.935344	1535.865	23665.18	3.678E-38	29	1465.179	0.9427485	1497.676	26308.61	3.678E-38	22	1315.984	0.8698415	347.6206	2991.422	0.1430535	35	96.6935	0.9253402	1599.367	21062.09	3.678E-38	24	1890.37	0.9149151	2244.399	25209.25	3.678E-38	22	1408.265	0.9109629	2461.052	26202.83	3.678E-38	27	1104.782	0.9059951	2674.675	26741.6	3.678E-38	34	951.0814	0.8862295	1175.901	9938.791	3.166748E-13	40	734.2847	0.95947	1072.717	27761.86	3.678E-38	33	876.8909	S100A12	S100A12_P1221_R	5032058	NM_005621.1	S100A12	6283	1	36.1	151615920	-1221	N	GAGGTTTATTTGGCCAAAGTTAAGGATGCGTGCCCAGAGGTAGGTCTACGTCTT	p6, CGRP, MRP6, CAAF1, ENRAGE	S100 calcium-binding protein A12 (calgranulin C); go_component: cytosol; go_component: insoluble fraction; go_function: zinc ion binding; go_function: calcium ion binding; go_process: inflammatory response; go_process: xenobiotic metabolism; go_process: defense response to bacteria; go_process: defense response to fungi	S100 calcium-binding protein A12
S100A2_E36_R	3887	0.07243344	6933.684	549.2586	6.635427E-08	27	403.4975	0.5931848	3921.181	5863.358	1.858852E-09	29	268.6384	0.6392544	3707.74	6747.455	1.171847E-11	26	541.3765	0.1312308	2456.734	386.2042	0.2292484	29	118.1163	0.577051	3845.516	5383.07	5.29408E-09	24	443.7443	0.5345539	4796.946	5624.028	3.494816E-13	25	475.9991	0.6192941	3651.496	6102.557	5.689803E-08	27	432.0634	0.6139381	4592.208	7461.821	1.160212E-08	37	443.101	0.6211777	3566.693	6012.497	1.000722E-09	22	589.5647	0.6836686	3541.838	7870.889	1.05078E-13	28	340.93	S100A2	S100A2_E36_R	45269153	NM_005978.3	S100A2	6273	1	36.1	151804894	36	N	CACAGTGGGAAGTGGGAGGTGTCGTGGGGACTGGGCATCCTG	CAN19, S100L, MGC111539	S100 calcium-binding protein A2; go_component: cellular component unknown; go_function: calcium ion binding; go_process: biological process unknown	S100 calcium binding protein A2
S100A2_P1186_F	1876	0.2881197	2679.071	1124.775	0.02321034	34	115.0074	0.8999786	1209.714	11784.62	7.970628E-17	36	609.3854	0.9156908	1318.694	15408.59	3.38286E-31	27	952.4329	0.8305067	587.1855	3367.167	0.07074565	31	110.5113	0.9046596	1313.333	13410.73	1.601992E-23	28	502.9348	0.8717163	1692.534	12180.67	5.624925E-24	31	483.4863	0.9094307	1116.318	12213.37	4.572879E-15	23	1070.538	0.904907	1605.494	16229.52	3.768155E-19	26	717.0978	0.8700249	1361.745	9784.6	2.642833E-13	24	655.4065	0.9168651	1095.931	13189.49	7.76425E-22	19	1091.161	S100A2	S100A2_P1186_F	45269153	NM_005978.3	S100A2	6273	1	36.1	151806116	-1186	N	TCTACACCTTGGCACAGCCACCGAGTGTCCCTTGCTCCCCTCAGTACTT	CAN19, S100L, MGC111539	S100 calcium-binding protein A2; go_component: cellular component unknown; go_function: calcium ion binding; go_process: biological process unknown	S100 calcium binding protein A2
S100A4_E315_F	1714	0.04572497	5767.312	281.1377	3.235697E-05	30	330.1052	0.1589998	9073.506	1734.346	1.501301E-11	37	762.5044	0.09239613	11850.76	1216.615	1.479919E-18	32	613.7166	0.04878761	3566.008	188.0293	0.09030484	25	226.6517	0.08536109	10369.86	977.1274	1.051823E-13	34	562.6118	0.141454	9602.576	1598.595	2.562334E-15	21	779.2646	0.1164604	9984.529	1329.254	9.401889E-11	28	792.6902	0.0913212	12470.2	1263.291	3.090806E-11	28	666.3486	0.1295416	7527.46	1135.118	6.317524E-08	30	683.318	0.07329547	13036.26	1038.981	3.587195E-21	27	637.6631	S100A4	S100A4_E315_F	9845515	NM_019554.1	S100A4	6275	1	36.1	151784591	315	N	CATACCAACACGTACTATAGCAACAGCGTGTGCAAGCCCACATCTCAGAAGCA	42A, 18A2, CAPL, MTS1, P9KA, PEL98	S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog); malignant transformation suppression 1; go_function: calcium ion binding	S100 calcium-binding protein A4
S100A4_P194_R	6015	0.6065459	707.9494	1245.528	0.3669501	36	82.40944	0.4139786	5880.511	4224.767	4.355118E-10	23	672.9957	0.397546	6636.361	4445.175	3.76036E-13	29	505.9637	0.3357572	807.5084	458.7216	0.6151552	25	59.9495	0.3607268	4746.687	2734.871	5.823791E-06	22	412.3383	0.40618	5527.9	3849.551	1.324576E-10	39	476.6225	0.4373188	5262.334	4167.634	1.873808E-07	35	499.3901	0.3750925	7832.762	4761.537	1.898204E-09	23	363.8731	0.4164026	4056.285	2965.552	3.080459E-05	29	477.0089	0.4178714	5975.729	4361.361	3.457937E-11	32	443.8242	S100A4	S100A4_P194_R	9845515	NM_019554.1	S100A4	6275	1	36.1	151785100	-194	N	CCCGTGGGTAACGGGTAAGCCCTAGCGGTTACTAGCAGGGGACTGGAT	42A, 18A2, CAPL, MTS1, P9KA, PEL98	S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog); malignant transformation suppression 1; go_function: calcium ion binding	S100 calcium-binding protein A4
S100A4_P887_R	5985	0.659821	1890.823	3861.458	9.55088E-05	26	250.966	0.9176154	1452.903	17296.54	5.569744E-36	36	1013.753	0.9335133	1528.865	22870.24	3.678E-38	30	1240.156	0.7978873	1044.018	4516.28	0.005808999	22	293.9536	0.9283472	1249.095	17479.12	3.678E-38	21	1412.031	0.9103935	1664.457	17926.72	3.678E-38	28	1273.27	0.9177897	1571.894	18664.9	4.900143E-36	33	1015.074	0.91845	1965.891	23266.93	3.678E-38	31	1376.806	0.8977507	1316.062	12433.04	1.18727E-20	37	722.0358	0.9208397	1590.484	19664.72	3.678E-38	43	981.0313	S100A4	S100A4_P887_R	9845515	NM_019554.1	S100A4	6275	1	36.1	151785793	-887	N	GGGGCTCACGGATAGATCTCAGGTTCGGAGAGGGTATCAGGAGGG	42A, 18A2, CAPL, MTS1, P9KA, PEL98	S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog); malignant transformation suppression 1; go_function: calcium ion binding	S100 calcium-binding protein A4
SCGB3A1_E55_R	3888	0.1737587	1888.691	418.2222	0.2561012	39	77.32826	0.2483123	6058.91	2034.532	1.607924E-06	31	414.6334	0.2304091	7499.646	2275.271	3.774858E-10	31	418.6353	0.6841499	587.0308	1488.149	0.406026	31	119.0038	0.257976	6387.682	2255.542	6.70748E-08	29	342.7492	0.3609573	5486.245	3155.338	5.634495E-09	25	312.7912	0.2158101	6667.689	1862.477	3.995958E-06	24	526.812	0.224195	8052.837	2356.037	1.638805E-06	37	372.8395	0.2625909	4814.651	1750.104	0.0001307917	34	500.1594	0.1997	6090.918	1544.829	4.02707E-06	28	235.2118	SCGB3A1	SCGB3A1_E55_R	50363225	NM_052863.2	SCGB3A1	92304	5	36.1	179951038	55	Y	CTCACCGGAGCTGCAGGACAGGGCCACGCAGAGCCCCAGGAGGGCGGCG	HIN1, HIN-1, LU105, UGRP2, PnSP-2, MGC87867	cytokine high in normal-1; pneumo secretory protein 2; go_component: extracellular space; go_function: cytokine activity; go_process: regulation of cell proliferation; go_process: negative regulation of cell growth	secretoglobin, family 3A, member 1
SCGB3A1_P103_R	1883	0.1915838	462.9401	133.4093	0.8082336	31	17.96097	0.1718304	1008.359	229.9647	0.6443449	37	62.87935	0.1594766	1577.084	318.2014	0.4885579	33	54.88731	0.1554887	634.3675	135.2094	0.731883	27	37.79654	0.1409512	1093.959	195.9026	0.6387798	22	117.4201	0.1589228	1213.293	248.1486	0.586863	37	41.43549	0.179179	1248.65	294.4001	0.6249153	21	81.02231	0.2215827	1397.012	426.1364	0.5873712	31	61.94796	0.2523824	1048.191	387.6087	0.6344193	41	57.52994	0.1646251	992.4771	215.2915	0.6686722	31	59.43134	SCGB3A1	SCGB3A1_P103_R	50363225	NM_052863.2	SCGB3A1	92304	5	36.1	179951196	-103	Y	GCGCTCCTGAGAAAGCCCTGCCCGCTCCGCTCACGGCCGTGCCCTGGCCAA	HIN1, HIN-1, LU105, UGRP2, PnSP-2, MGC87867	cytokine high in normal-1; pneumo secretory protein 2; go_component: extracellular space; go_function: cytokine activity; go_process: regulation of cell proliferation; go_process: negative regulation of cell growth	secretoglobin, family 3A, member 1
SEMA3A_P343_F	2799	0.3133689	2439.36	1158.929	0.03529778	20	157.0838	0.407482	4666.905	3278.26	2.710227E-06	28	330.9657	0.3376151	4989.253	2593.973	4.281169E-06	29	375.3782	0.1239894	2663.213	391.1014	0.1894411	28	159.1277	0.334666	4213.839	2169.88	0.0001971596	25	306.4329	0.3929632	4397.282	2911.301	2.016039E-06	29	409.6893	0.2853469	5195.227	2114.28	0.0001418463	34	382.7194	0.2998424	5194.093	2267.195	0.001442909	33	358.2563	0.330636	4375.452	2210.674	0.0001225697	30	300.4584	0.3368918	5416.024	2802.414	4.604177E-07	30	355.0438	SEMA3A	SEMA3A_P343_F	5174672	NM_006080.1	SEMA3A	10371	7	36.1	83662191	-343	N	CCTTTTATCTAAGCTCCTCTGATAGCCGGTGGCAGTCTCTAATCCTGCTCCCTGCTTC	SemD, SEMA1, SEMAD, SEMAL, coll-1, Hsema-I, SEMAIII, sema III	semaphorin L; sema domain, immunoglobulin domain (Ig), short basic domain, secreted, 3A; semaphorin-like; semaphorin III; collapsin 1; go_component: extracellular region; go_process: cell differentiation; go_process: nervous system development	semaphorin 3A
SEMA3A_P658_R	2804	0.1805626	2850.121	650.0576	0.04267086	22	135.1333	0.4874668	4896.847	4752.467	3.372445E-09	24	679.1842	0.4268085	6655.914	5030.573	1.087998E-14	34	506.4368	0.1098535	1805.364	235.1422	0.4148688	30	102.1782	0.4369532	5175.5	4094.059	4.399729E-09	23	483.0061	0.5960597	4661.176	7025.656	9.775677E-17	21	593.1942	0.3396332	5829.502	3049.601	1.273907E-06	31	556.4828	0.3812502	6772.802	4234.761	2.982071E-07	32	455.8766	0.4934867	4764.734	4739.622	1.430085E-09	27	546.1202	0.4148802	6151.973	4432.972	9.641428E-12	29	439.0076	SEMA3A	SEMA3A_P658_R	5174672	NM_006080.1	SEMA3A	10371	7	36.1	83662506	-658	N	GAGATTAGAGCCGGGAGCAGAACCCTCAGGCGTGCCTGTGAAAGGCATGTAGCTATAA	SemD, SEMA1, SEMAD, SEMAL, coll-1, Hsema-I, SEMAIII, sema III	semaphorin L; sema domain, immunoglobulin domain (Ig), short basic domain, secreted, 3A; semaphorin-like; semaphorin III; collapsin 1; go_component: extracellular region; go_process: cell differentiation; go_process: nervous system development	semaphorin 3A
SEMA3B_E96_F	3894	0.1402865	9334.136	1539.445	5.183728E-17	19	347.2105	0.2743825	9053.162	3461.146	1.424429E-15	25	838.5468	0.2000435	13516.25	3404.989	5.782458E-32	38	737.6384	0.07231716	5569.175	441.9384	0.002407128	38	262.3251	0.2172395	11617.66	3252.002	5.211158E-24	32	751.3159	0.2284926	13461.66	4016.473	3.678E-38	18	808.0474	0.2379161	11867.06	3736.014	6.597597E-21	27	732.3763	0.2026438	15855.66	4055.047	4.855432E-24	20	794.5726	0.2325493	8990.97	2754.703	7.690431E-15	27	946.1016	0.2103671	14964.63	4013.387	3.678E-38	30	590.1971	SEMA3B	SEMA3B_E96_F	54607087	NM_004636.2	SEMA3B	7869	3	36.1	50280140	96	N	GAGAGATGCTGCTGCGGAAGTCCTCGGTGGAGTGTGAGAAGGCAGC	SemA, SEMA5, SEMAA, semaV, LUCA-1, FLJ34863	isoform 1 precursor is encoded by transcript variant 1; semaphorin A; semaphorin V; go_component: membrane; go_component: endoplasmic reticulum; go_function: receptor activity; go_process: development; go_process: axon guidance; go_process: cell-cell signaling	semaphorin 3B isoform 1 precursor
SEMA3B_P110_R	1886	0.2490218	3325.108	1135.754	0.004968922	34	137.1549	0.2571881	8526.981	2986.969	3.916415E-13	29	694.9957	0.1917132	10763.65	2576.692	2.225932E-19	29	721.7925	0.2621489	4748.363	1722.56	0.0009019094	27	188.8966	0.2132826	7229.098	1986.951	5.601387E-09	25	340.6086	0.1730825	10382.81	2194.161	1.627029E-19	30	430.1158	0.1914735	8432.446	2020.636	3.698026E-09	27	557.7437	0.2086408	10733.79	2856.314	5.307844E-11	33	541.4601	0.1903323	9015.195	2142.75	2.472965E-13	17	575.3551	0.1748153	9918.113	2122.337	2.630061E-15	32	536.045	SEMA3B	SEMA3B_P110_R	54607087	NM_004636.2	SEMA3B	7869	3	36.1	50279934	-110	N	CTTGTGCCCATTCCACTCCCGCCTGGCTGCCGTCTCCAGCTGGTCCC	SemA, SEMA5, SEMAA, semaV, LUCA-1, FLJ34863	isoform 1 precursor is encoded by transcript variant 1; semaphorin A; semaphorin V; go_component: membrane; go_component: endoplasmic reticulum; go_function: receptor activity; go_process: development; go_process: axon guidance; go_process: cell-cell signaling	semaphorin 3B isoform 1 precursor
SEMA3C_E49_R	2926	0.4889641	4131.188	4048.442	1.853753E-09	31	202.2688	0.1853079	12061.83	2766.299	4.257674E-22	33	875.6678	0.1280896	15578.81	2303.324	6.559641E-36	23	850.0104	0.1671103	6780.039	1380.405	1.175041E-05	34	363.084	0.1069644	12295.69	1484.709	1.723522E-20	24	843.8881	0.2322599	11367.83	3469.295	1.297402E-27	28	728.2883	0.1190429	14357.48	1953.627	6.138454E-23	35	875.4279	0.1215397	15753.81	2193.459	2.122921E-19	26	865.0117	0.1911369	8432.437	2016.242	1.239482E-11	35	581.2729	0.090859	15196.9	1528.763	2.318279E-30	21	823.1595	SEMA3C	SEMA3C_E49_R	32307182	NM_006379.2	SEMA3C	10512	7	36.1	80386554	49	Y	CGCGGCTGGCCAGACGCAAGAATGCGCGGCCGCAGGCTGGAGCCCTAGCT	SemE, SEMAE	semaphorin E; go_process: development; go_process: immune response; go_process: response to drug; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	semaphorin 3C
SEMA3C_P642_F	2331	0.09713459	1814.334	205.9532	0.3447348	23	94.28211	0.1855278	3855.102	900.9291	0.01357214	20	205.3158	0.2174243	4030.074	1147.466	0.004933025	22	224.9814	0.0266213	6260.016	173.9424	0.0009790249	34	204.0778	0.2333651	3730.286	1165.947	0.008079365	21	216.7267	0.3004481	3033.395	1345.751	0.01424818	23	183.4965	0.2332484	3928.586	1225.51	0.01561888	21	146.9659	0.1912954	4281.665	1036.463	0.03894082	26	194.1585	0.2001934	3622.65	931.7875	0.01852873	41	195.9986	0.1715614	4155.814	881.337	0.006514685	19	243.0211	SEMA3C	SEMA3C_P642_F	32307182	NM_006379.2	SEMA3C	10512	7	36.1	80387245	-642	N	CAGTAATTCTGTTGACCCCTCCACGTTGACTCATATCCAGTACGTTGTCCCC	SemE, SEMAE	semaphorin E; go_process: development; go_process: immune response; go_process: response to drug; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	semaphorin 3C
SEMA3F_E333_R	1032	0.2790122	4385.467	1735.813	2.454415E-05	38	218.4296	0.1786543	6008.172	1328.614	2.049966E-05	31	282.0797	0.2611843	7178.707	2573.151	4.226071E-10	28	311.8667	0.1931475	3102.522	766.6322	0.07862501	22	162.9693	0.233138	6035.779	1865.373	1.268095E-06	26	388.3351	0.2609726	6138.573	2203.026	2.344319E-08	34	238.4212	0.2351843	6657.28	2077.894	2.055012E-06	29	324.4987	0.1902405	9181.235	2180.482	1.032672E-07	25	348.4532	0.2653507	5517.597	2029.041	5.045963E-06	28	449.9879	0.2228787	6903.298	2008.549	2.71979E-08	27	376.605	SEMA3F	SEMA3F_E333_R	31377801	NM_004186.2	SEMA3F	6405	3	36.1	50168185	333	Y	GGATTCTTACCTGTCCTGGAGGCCCGGACCCCTTACCTACGGGGCGGCGT	SEMA4, SEMAK, SEMA-IV, sema IV	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, 3F; semaphorin IV; semaphorin III/F; go_component: extracellular space; go_process: development	semaphorin 3F
SEMA3F_P692_R	5157	0.2126826	2214.557	625.2446	0.1290154	22	113.6349	0.0286149	9597.633	285.6713	1.195832E-09	33	407.6023	0.02725022	13456.18	379.7572	6.373885E-21	32	680.8304	0.04853651	3875.237	202.7867	0.06040634	28	150.3991	0.02447579	11093.37	280.8404	8.999944E-14	23	583.434	0.03618753	9751.822	369.8989	2.066528E-12	26	438.9627	0.04621897	10220.14	500.1002	1.226633E-09	38	357.1189	0.03728039	12792.02	499.2311	1.60454E-10	37	546.8753	0.04917914	8506.521	445.1536	1.802948E-08	29	538.0901	0.03867022	10015.97	406.9225	2.231107E-11	28	433.7385	SEMA3F	SEMA3F_P692_R	31377801	NM_004186.2	SEMA3F	6405	3	36.1	50167160	-692	Y	AGCGCAGGCTCGTTGCTCCCTGGCGCTGCAGCCCTTCTCGCCAGGGAGT	SEMA4, SEMAK, SEMA-IV, sema IV	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, 3F; semaphorin IV; semaphorin III/F; go_component: extracellular space; go_process: development	semaphorin 3F
SEPT5_P441_F	5988	0.2349879	5587.544	1747.036	1.35427E-07	31	273.7259	0.7431748	3244.948	9679.271	1.22376E-16	33	602.0188	0.6781383	5665.73	12147.96	1.27601E-35	28	878.9811	0.2359006	4451.909	1405.312	0.003281142	40	169.7939	0.7022592	4148.034	10019.52	1.046381E-21	34	672.0131	0.723534	3445.399	9278.601	5.371716E-20	20	829.0783	0.6123446	5418.167	8716.557	5.135472E-17	28	588.4655	0.6377028	5734.839	10270.28	2.472442E-15	32	591.1674	0.7465705	3041.488	9254.417	2.475794E-16	43	519.2238	0.6595637	3864.613	7681.068	4.902977E-14	26	454.0791	SEPT5.	SEPT5_P441_F	58331273	NM_001009939.1	5-Sep	5413	22	36.1	18081546	-441	Y	GTCTGCTCGCAGAGCAGGTCTGCGCAGCACCGAGCGGTCAGCAGGGGCAATGCT	H5, CDCREL, PNUTL1, CDCREL1, CDCREL-1, HCDCREL-1	isoform 2 is encoded by transcript variant 2; peanut (Drosophila)-like 1; peanut-like 1 (Drosophila); septin HCDCREL-1; cell division control related protein 1; go_component: plasma membrane; go_component: synaptic vesicle; go_component: plasma membrane; go_component: synaptic vesicle; go_function: GTP binding; go_function: GTPase activity; go_function: protein binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: protein binding; go_function: structural molecule activity; go_function: structural molecule activity; go_process: cell cycle; go_process: cytokinesis; go_process: cytokinesis; go_process: regulation of exocytosis; go_process: synaptic vesicle targeting; go_process: regulation of exocytosis; go_process: synaptic vesicle targeting	septin 5 isoform 2
SEPT5_P464_R	5997	0.3632484	4639.733	2703.881	1.297332E-07	24	287.0081	0.8778128	1855.951	14051.87	1.45124E-25	43	910.0071	0.8636862	2567.13	16898.98	3.678E-38	39	1033.859	0.4873912	4218.104	4105.678	7.260082E-06	42	408.6357	0.8339787	2274.366	11927.21	8.146851E-22	25	966.6044	0.8262257	2242.147	11135.95	3.252825E-22	25	1311.404	0.8090739	3217.022	14056.31	7.336853E-26	31	1119.369	0.8336985	3511.133	18103.24	1.685392E-28	24	728.9011	0.8413885	1533.415	8664.794	4.59794E-11	30	655.6749	0.8415393	2077.108	11561.99	7.920872E-20	35	622.2608	SEPT5.	SEPT5_P464_R	58331273	NM_001009939.1	5-Sep	5413	22	36.1	18081523	-464	Y	CCTACAGCCTGCCAGGTGCGTCTGCTCGCAGAGCAGGTCTGCGCAGCACCGAGC	H5, CDCREL, PNUTL1, CDCREL1, CDCREL-1, HCDCREL-1	isoform 2 is encoded by transcript variant 2; peanut (Drosophila)-like 1; peanut-like 1 (Drosophila); septin HCDCREL-1; cell division control related protein 1; go_component: plasma membrane; go_component: synaptic vesicle; go_component: plasma membrane; go_component: synaptic vesicle; go_function: GTP binding; go_function: GTPase activity; go_function: protein binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: protein binding; go_function: structural molecule activity; go_function: structural molecule activity; go_process: cell cycle; go_process: cytokinesis; go_process: cytokinesis; go_process: regulation of exocytosis; go_process: synaptic vesicle targeting; go_process: regulation of exocytosis; go_process: synaptic vesicle targeting	septin 5 isoform 2
SEPT9_P374_F	6004	0.2159229	2289.661	658.0761	0.1098363	44	81.98661	0.68591	3106.171	7001.641	4.304528E-10	25	478.9884	0.7090944	3394.509	8518.011	2.738461E-15	30	415.338	0.6084945	3082.376	4946.183	1.719566E-05	26	293.8163	0.5658541	3930.63	5253.417	6.466595E-09	29	354.7802	0.7176342	2816.281	7411.743	1.106756E-12	36	426.329	0.6087606	4028.365	6423.652	3.714085E-09	31	579.6718	0.6719507	3841.396	8073.249	1.823557E-08	28	416.7768	0.709294	2752.981	6960.992	5.217075E-10	32	492.2363	0.67614	3577.198	7677.082	2.572262E-13	20	530.6091	SEPT9.	SEPT9_P374_F	19923366	NM_006640.2	9-Sep	10801	17	36.1	72827370	-374	Y	GGGGCCAGCCCAGGACAGAGGAAGGCGAGGCAGGCACGCAGGAACTGG	MSF, MSF1, SINT1, PNUTL4, AF17q25, KIAA0991	MLL septin-like fusion; septin D1; Ov/Br septin; OVARIAN/Breast septin alpha; OVARIAN/Breast septin beta; Ovarian/Breast septin epsilon	septin 9
SEPT9_P58_R	6002	0.861123	399.6804	3098.327	0.04284718	30	99.4336	0.9589005	516.208	14376.85	2.680785E-22	27	1014.918	0.959294	568.6577	15757.87	1.211557E-29	24	1433.892	0.08246296	2402.829	224.9398	0.2741857	40	94.26006	0.9221304	699.8525	9471.842	5.867948E-11	27	546.3842	0.9506657	691.3821	15249.84	4.089864E-32	35	668.465	0.9192361	1189.364	14675.24	1.204586E-21	27	953.2767	0.9548811	813.7046	19337.32	1.206585E-24	25	680.0394	0.9188753	653.6962	8536.894	6.163212E-09	20	499.4897	0.9458586	770.2216	15202.91	1.422258E-27	19	1501.968	SEPT9.	SEPT9_P58_R	19923366	NM_006640.2	9-Sep	10801	17	36.1	72827686	-58	Y	CCGGTGGTCTGCCGGACTCCTCGGGGCCCACTTCGGGCCCTCTCT	MSF, MSF1, SINT1, PNUTL4, AF17q25, KIAA0991	MLL septin-like fusion; septin D1; Ov/Br septin; OVARIAN/Breast septin alpha; OVARIAN/Breast septin beta; Ovarian/Breast septin epsilon	septin 9
SERPINA5_E69_F	3896	0.312966	3097.033	1456.351	0.003900461	28	145.4738	0.8182166	2140.433	10084.31	7.644448E-15	27	519.6703	0.815061	2464.104	11300.49	1.072637E-20	18	487.4573	0.4034859	798.8098	607.9605	0.5794966	22	99.32172	0.8227767	2092.792	10180.25	4.117978E-16	24	413.8805	0.8297766	1912.366	9809.543	7.674147E-17	37	708.1116	0.8473097	1722.254	10112.06	8.654372E-12	23	863.0881	0.8363244	2255.011	12033.27	3.588252E-12	40	345.4849	0.8370714	1420.278	7810.668	5.124126E-09	29	646.6121	0.8381753	2031.522	11040.27	3.767197E-18	34	313.0257	SERPINA5	SERPINA5_E69_F	34147643	NM_000624.3	SERPINA5	5104	14	36.1	94117633	69	N	CCCAGGGCTTGAGGGCATGTGAGGCGAGGAGAGGATGGACTCTAGAG	PCI, PAI3, PROCI, PLANH3	Protein C inhibitor (plasminogen activator inhibitor-3); protein C inhibitor (plasminogen activator inhibitor III); go_component: extracellular space; go_function: serine-type endopeptidase inhibitor activity	serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5
SERPINA5_P156_F	1893	0.1493389	5340.076	955.0399	1.24854E-05	22	263.8734	0.2816013	6631.299	2638.566	1.704796E-08	26	410.0171	0.2314149	8987.91	2736.297	8.660901E-15	29	557.916	0.05241134	5409.973	304.7578	0.004334679	32	238.6505	0.264267	7777.549	2829.527	6.183257E-12	36	497.0882	0.3624414	6834.698	3942.26	3.902745E-14	30	584.3742	0.2634823	7453.165	2702.074	1.217869E-08	34	503.2715	0.3248441	8104.074	3947.302	1.170304E-08	25	531.0522	0.4458612	3807.209	3143.748	3.885253E-05	27	268.3524	0.2398469	8433.599	2692.559	5.249979E-13	24	626.9648	SERPINA5	SERPINA5_P156_F	34147643	NM_000624.3	SERPINA5	5104	14	36.1	94117408	-156	N	GCGTCTGCAGGCAGGCCTGCTGGCCGGAAACCTGCCAGGAAAGGAAG	PCI, PAI3, PROCI, PLANH3	Protein C inhibitor (plasminogen activator inhibitor-3); protein C inhibitor (plasminogen activator inhibitor III); go_component: extracellular space; go_function: serine-type endopeptidase inhibitor activity	serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5
SERPINB2_P939_F	1895	0.6482698	403.5211	928.0338	0.5851845	36	35.06979	0.9559694	388.2263	10600.11	6.061082E-12	26	790.9121	0.9647039	422.761	14287.95	8.414785E-24	26	493.7891	0.2760287	273.5097	142.4081	0.8024681	25	16.32688	0.9544591	356.3877	9565.11	2.035799E-10	31	992.2812	0.9530059	479.3827	11749.46	2.116995E-18	18	706.9532	0.9600814	429.0158	12723.35	1.180748E-14	33	751.1515	0.963419	455.8346	14638.79	1.319397E-13	31	472.835	0.9399122	474.4293	8985.406	1.765714E-09	29	578.9742	0.9630282	438.5906	14029.02	2.018638E-22	25	714.0278	SERPINB2	SERPINB2_P939_F	4505594	NM_002575.1	SERPINB2	5055	18	36.1	59704983	-939	N	AGAGCACTAAGGACAAAGGGGCACTTAACACGTGTAAAAGGGCAATGGCTCCTAA	PAI, PAI2, PAI-2, PLANH2, HsT1201	plasminogen activator inhibitor, type II (arginine-serpin); plasminogen activator inhibitor 2; go_component: extracellular space; go_function: plasminogen activator activity; go_function: serine-type endopeptidase inhibitor activity; go_process: anti-apoptosis	serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2
SERPINB5_P19_R	1908	0.6306026	2391.705	4253.619	2.982921E-06	27	192.4518	0.9743106	504.5305	22927.8	3.678E-38	33	1691.409	0.9805871	488.0313	29702.78	3.678E-38	32	1264.574	0.9324434	356.9666	6307.236	0.0005820735	27	174.655	0.970295	459.8213	18286.18	3.678E-38	20	2293.458	0.9733662	549.5325	23738.02	3.678E-38	30	1435.378	0.9715127	516.2329	21015.59	3.678E-38	27	1719.557	0.9783717	589.2212	31177.35	3.678E-38	23	1350.483	0.9507422	590.6011	13329.53	3.389227E-21	18	1065.107	0.9807357	434.2566	27198.77	3.678E-38	34	1675.854	SERPINB5	SERPINB5_P19_R	52851464	NM_002639.2	SERPINB5	5268	18	36.1	59295180	-19	Y	CGCTGCTTCTGCCCAGACACGGTCGCCTCCACATCCAGGTCTTTGTGCTCC	PI5, maspin	protease inhibitor 5 (maspin); go_function: serine-type endopeptidase inhibitor activity; go_process: cell motility	serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5
SERPINE1_E189_R	1037	0.2522176	4534.846	1563.275	2.681034E-05	32	156.9125	0.4851907	6785.972	6489.801	1.388991E-17	37	634.1334	0.4640923	8157.006	7150.511	7.022644E-26	40	886.4024	0.08555147	5140.772	490.3018	0.005085531	30	229.5086	0.4367926	7398.332	5815.291	8.904755E-19	32	622.8285	0.4873312	6784.58	6544.323	4.82419E-22	29	676.4147	0.3609313	9021.915	5151.848	4.099518E-17	27	664.9108	0.4502404	8359.629	6928.24	5.798444E-14	29	571.8246	0.443572	5937.85	4813.24	2.42263E-12	32	451.3589	0.3661539	9674.655	5646.526	2.841793E-25	23	1111.024	SERPINE1	SERPINE1_E189_R	10835158	NM_000602.1	SERPINE1	5054	7	36.1	100557361	189	Y	CGCTATTCCTCTATTTTCTTTTCCTCGGACCTGCAGCCTTGGGTCGACCCTGC	PAI, PAI1, PAI-1, PLANH1	plasminogen activator inhibitor, type I; serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1; go_component: extracellular region; go_function: plasminogen activator activity; go_function: serine-type endopeptidase inhibitor activity; go_process: blood coagulation	plasminogen activator inhibitor-1
SERPINE1_P519_F	5177	0.07952615	3668.863	325.6183	0.01532044	29	160.2162	0.6699131	3253.602	6806.152	5.368836E-10	31	294.376	0.6012683	3681.31	5702.035	2.46111E-09	35	235.0279	0.2523022	465.3707	190.778	0.7558174	27	24.88352	0.6741962	2513.546	5408.296	1.173253E-06	30	361.0742	0.656776	2997.806	5927.803	1.382691E-09	33	310.7595	0.6146706	3358.436	5516.836	1.290383E-06	23	314.2246	0.614891	3675.538	6028.278	1.057154E-05	37	294.996	0.6330616	2927.52	5223.237	5.156565E-07	27	344.9753	0.6228446	3491.084	5930.415	2.860487E-09	20	278.2091	SERPINE1	SERPINE1_P519_F	10835158	NM_000602.1	SERPINE1	5054	7	36.1	100556653	-519	N	GACAGCCCTGGGGGAAAACTTCCACGTTTTGATGGAGGTTATCTTTG	PAI, PAI1, PAI-1, PLANH1	plasminogen activator inhibitor, type I; serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1; go_component: extracellular region; go_function: plasminogen activator activity; go_function: serine-type endopeptidase inhibitor activity; go_process: blood coagulation	plasminogen activator inhibitor-1
SEZ6L_P249_F	1935	0.06427353	2794.035	198.7866	0.1024632	29	133.7297	0.06235583	10491.13	704.3386	2.095445E-12	26	594.381	0.06059809	11649.42	757.921	1.20183E-16	31	546.4061	0.03826003	3867.208	157.8239	0.06468181	40	237.6119	0.05339231	11016.77	627.0285	1.878315E-14	38	608.0433	0.08540183	11509.72	1084.073	1.434337E-19	27	712.0088	0.07519781	10572.39	867.7964	5.328591E-11	34	844.1759	0.08313099	12680.81	1158.814	2.062718E-11	27	593.2172	0.09216885	8877.567	911.4603	3.613091E-10	20	594.3733	0.07564928	10699.49	883.8347	3.944064E-14	38	390.5628	SEZ6L	SEZ6L_P249_F	55956782	NM_021115.3	SEZ6L	23544	22	36.1	24895231	-249	Y	GCTCCCAGGACGCAAGGGGAATTGGCGTTAAACTTTGCAGGGCCGACGG	.	seizure related gene 6 (mouse)-like; go_component: integral to membrane	seizure related 6 homolog (mouse)-like precursor
SEZ6L_P299_F	1931	0.03329074	5593.728	196.0759	8.357614E-05	22	236.2255	0.1319525	8239.647	1267.715	6.237873E-09	38	396.1713	0.09549734	10442.66	1113.094	2.382984E-14	28	565.1183	0.08732919	2507.164	249.4673	0.2467607	17	161.8337	0.119259	8407.963	1152.043	1.153005E-09	29	494.1664	0.1998393	7999.037	2022.726	3.6919E-12	31	565.8135	0.1235923	9429.347	1343.842	9.818425E-10	30	485.354	0.1230446	9781.588	1386.475	1.853117E-07	28	363.6003	0.06217067	7566.481	508.2271	6.952692E-07	31	462.6766	0.1186256	10067.42	1368.45	9.208532E-14	26	336.4075	SEZ6L	SEZ6L_P299_F	55956782	NM_021115.3	SEZ6L	23544	22	36.1	24895181	-299	Y	TGGCCAGGCAGAGCTGCTGGGAGCGTCAGCAGGGAGAGAAAACGCTCG	.	seizure related gene 6 (mouse)-like; go_component: integral to membrane	seizure related 6 homolog (mouse)-like precursor
SFN_E118_F	3909	0.827503	1147.834	5986.115	3.459231E-07	28	407.543	0.9387132	1064.266	17832.75	1.424778E-36	39	1361.462	0.9630705	968.3101	27860.04	3.678E-38	41	1492.713	0.8210113	1380.238	6789.769	1.142729E-05	21	333.5147	0.9504349	867.225	18547.02	3.678E-38	36	1307.788	0.9402248	1112.974	19079.28	3.678E-38	33	1405.285	0.951059	1070.184	22739.9	3.678E-38	27	1376.154	0.9546901	1192.593	27235.22	3.678E-38	33	1580.631	0.9234619	1052.96	13910.89	1.102201E-24	27	1069.902	0.9497803	975.0892	20332.65	3.678E-38	22	2181.464	SFN	SFN_E118_F	45238846	NM_006142.3	SFN	2810	1	36.1	27062338	118	Y	GATCCAGAAGGCCAAGCTGGCAGAGCAGGCCGAACGCTATGAGGACATGGCAGCCTT	.	14-3-3 sigma; go_component: cytoplasm; go_component: extracellular space; go_function: protein domain specific binding; go_function: protein kinase C inhibitor activity; go_process: cell proliferation; go_process: signal transduction; go_process: regulation of progression through cell cycle; go_process: negative regulation of protein kinase activity	stratifin
SFN_P248_F	1942	0.07273702	3264.347	263.9085	0.04044369	31	159.6214	0.1482271	9038.581	1590.313	3.628279E-11	36	519.4468	0.1630926	9751.753	1919.863	1.190098E-14	18	1222.759	0.02442255	6283.979	159.8162	0.0009579325	31	153.4403	0.1795427	8758.241	1938.471	3.838434E-12	24	671.7962	0.1523914	9378.158	1704.076	5.565842E-15	31	530.1557	0.1758153	9293.29	2003.779	1.012947E-10	31	511.6874	0.1692569	11718.09	2407.836	6.8066E-12	38	658.1216	0.1648879	8136.574	1626.262	4.108851E-10	24	469.3657	0.1680852	10284.89	2098.227	3.194606E-16	30	932.3057	SFN	SFN_P248_F	45238846	NM_006142.3	SFN	2810	1	36.1	27061972	-248	N	GATGTGGGCAGCCATGTGATGCCAGCCCCGAACAAGAGGGGGCAGCCTGG	.	14-3-3 sigma; go_component: cytoplasm; go_component: extracellular space; go_function: protein domain specific binding; go_function: protein kinase C inhibitor activity; go_process: cell proliferation; go_process: signal transduction; go_process: regulation of progression through cell cycle; go_process: negative regulation of protein kinase activity	stratifin
SFRP1_E398_R	3910	0.1653465	3041.356	622.3089	0.03099101	30	115.4406	0.09731707	7677.123	838.4415	3.417366E-07	32	687.9646	0.09797002	10431.3	1143.811	2.123135E-14	26	689.5848	0.02836159	5290.329	157.3407	0.007149316	19	261.6846	0.09600414	8780	943.0539	5.323169E-10	31	455.4448	0.1436489	9528.4	1615.119	3.736405E-15	32	324.2871	0.1078144	9730.912	1187.997	5.286029E-10	37	493.6277	0.1021531	10560.6	1212.916	2.864669E-08	32	598.0814	0.1078639	8749.739	1069.98	3.106124E-10	36	692.6346	0.09442902	10388.4	1093.685	7.069133E-14	30	491.2499	SFRP1	SFRP1_E398_R	56117837	NM_003012.3	SFRP1	6422	8	36.1	41285739	398	Y	TGTCCGACTGGAAGCTCACGTAGTCGTACTCGCTGGCCGAGCCCACGGCCAGAAG	FRP, FRP1, FrzA, FRP-1, SARP2	secreted apoptosis-related protein 2; go_process: cell differentiation; go_process: Wnt receptor signaling pathway	secreted frizzled-related protein 1
SFRP1_P157_F	1946	0.03592918	6863.57	259.5197	3.636127E-07	37	232.331	0.07229755	10448.98	822.1014	1.414022E-12	24	821.6553	0.05826188	12740.67	794.4048	5.607824E-20	26	482.3074	0.03858044	3635.51	149.9009	0.08700094	46	134.3418	0.05736645	10203.84	627.0671	1.863894E-12	32	453.313	0.08767393	9903.267	961.3073	2.245882E-14	31	744.9153	0.07339338	9811.192	785.0321	2.055625E-09	42	400.2205	0.06101412	12520.96	820.0942	1.337017E-10	24	920.3129	0.06533297	8895.055	628.7519	1.303766E-09	25	469.2932	0.05852282	10000.15	627.8319	7.696179E-12	39	506.5201	SFRP1	SFRP1_P157_F	56117837	NM_003012.3	SFRP1	6422	8	36.1	41286294	-157	Y	GCGGGTTCGGTTTACTAGAACCAGACGCGGCTCAACACCCCTTAAAAAACA	FRP, FRP1, FrzA, FRP-1, SARP2	secreted apoptosis-related protein 2; go_process: cell differentiation; go_process: Wnt receptor signaling pathway	secreted frizzled-related protein 1
SFTPA1_E340_R	3913	0.8089367	708.1669	3421.67	0.01122929	28	205.3582	0.9499655	456.2007	10560.15	5.25709E-12	24	627.3888	0.9705723	486.7713	19352.64	3.678E-38	30	1075.795	0.3029038	522.1125	270.3217	0.7269208	25	39.24273	0.9555419	461.623	12071.01	7.967694E-17	22	732.6815	0.966151	589.7291	19686.91	3.678E-38	30	1329.157	0.9681636	480.2949	17647.1	1.303094E-28	25	1420.024	0.9699318	572.2368	21684.87	2.752175E-30	26	963.8046	0.9575619	561.0941	14916.74	1.660549E-26	22	1548.233	0.9688342	503.9723	18775.34	3.678E-38	39	771.8115	SFTPA1	SFTPA1_E340_R	38888174	NM_005411.3	SFTPA1	6435	10	36.1	81361004	340	N	GGGGCCAGGCTGCGGGCCCCGTTCATCTTTTTTCATTCTCAGGTCGC	PSAP, PSPA, SP-A, SFTP1, SP-A1, COLEC4	pulmonary surfactant apoprotein; pulmonary surfactant-associated protein; go_component: cytoplasm; go_function: sugar binding; go_function: calcium ion binding; go_process: phosphate transport; go_process: respiratory gaseous exchange; go_process: regulation of liquid surface tension	surfactant, pulmonary-associated protein A1
SFTPA1_P421_F	1949	0.2829165	2611.281	1069.703	0.02992597	31	120.8484	0.843146	1107.834	6492.537	8.73348E-06	30	330.8566	0.854715	1408.083	8872.094	2.938998E-11	21	362.5065	0.1136737	3035.334	402.1148	0.1289766	29	156.7976	0.7933174	1460.084	5988.127	6.54599E-06	35	277.253	0.8274366	1421.174	7293.987	3.935782E-09	31	383.1214	0.8316389	1348.1	7153.055	4.383556E-06	25	411.4488	0.808183	1767.389	7867.876	1.25689E-05	26	364.2286	0.8058779	1358.358	6054.221	8.132825E-06	22	294.3473	0.7979872	1505.878	6343.508	1.858871E-06	33	292.1304	SFTPA1	SFTPA1_P421_F	38888174	NM_005411.3	SFTPA1	6435	10	36.1	81360243	-421	N	TGGGGCTCATGGCTGAGCCAGGTCGCAGGACAGACAAGTTGGCCTGGA	PSAP, PSPA, SP-A, SFTP1, SP-A1, COLEC4	pulmonary surfactant apoprotein; pulmonary surfactant-associated protein; go_component: cytoplasm; go_function: sugar binding; go_function: calcium ion binding; go_process: phosphate transport; go_process: respiratory gaseous exchange; go_process: regulation of liquid surface tension	surfactant, pulmonary-associated protein A1
SFTPB_P689_R	1951	0.2132245	6088.458	1677.138	1.626088E-08	31	276.67	0.8469327	1406.751	8336.963	2.227344E-09	25	629.4067	0.8765623	1306.794	9990	1.09288E-13	27	671.7398	0.1872061	4082.511	963.3337	0.014403	31	326.6934	0.8211512	1391.756	6849.121	3.431818E-07	30	413.0243	0.8050373	1640.416	7186.5	2.266571E-09	31	503.3216	0.8113522	1565.403	7162.704	2.103334E-06	25	715.454	0.8000147	2320.411	9682.533	1.370309E-08	29	619.8451	0.8072132	1456.357	6516.586	1.031657E-06	35	505.3658	0.8734227	1320.267	9800.286	5.415221E-13	31	624.7344	SFTPB	SFTPB_P689_R	33943098	NM_000542.2	SFTPB	6439	2	36.1	85749512	-689	N	GGTAGGGGCTGGGGCATAGCTGCGATGGTTCAGCAGAAAGAAACTGTCC	SP-B, PSP-B, SFTB3, SFTP3	Pulmonary surfactant-associated protein B, 18kD; go_component: lysosome; go_component: extracellular space; go_process: lipid metabolism; go_process: organ morphogenesis; go_process: sphingolipid metabolism; go_process: respiratory gaseous exchange; go_process: regulation of liquid surface tension	surfactant, pulmonary-associated protein B
SFTPC_E13_F	3919	0.3129727	3312.196	1554.413	0.001640344	27	157.768	0.8782158	989.6319	7857.607	9.484944E-08	26	397.3561	0.8990341	1029.012	10053.1	3.748063E-13	24	500.0557	0.08058654	2405.539	219.6103	0.2747584	28	145.9349	0.8969223	955.4839	9184.205	6.89388E-11	33	355.3659	0.8633341	1156.676	7938.57	5.823844E-10	34	357.3929	0.9010094	1038.359	10361.31	6.397274E-11	22	429.8533	0.9092016	1085.79	11873.8	5.29939E-10	32	372.0918	0.8695003	896.1032	6636.893	5.299636E-06	20	453.402	0.881477	932.412	7678.236	9.60834E-08	30	328.8608	SFTPC	SFTPC_E13_F	42476334	NM_003018.2	SFTPC	6440	8	36.1	22075126	13	N	CTCACAGGGGGCTTATCTGGGCTTCGGTTCTGGAGGGCCAGGAACA	SP-C, PSP-C, SFTP2	Surfactant, pulmonary-associated protein C (pulmonary surfactant apoprotein-2, SP-C); surfactant protein c; go_component: extracellular space; go_process: respiratory gaseous exchange; go_process: regulation of liquid surface tension	surfactant, pulmonary-associated protein C
SFTPD_E169_F	3920	0.3292028	3028.249	1535.231	0.003797343	33	99.38392	0.8985143	1571.565	14799.38	3.90619E-27	21	1569.398	0.9277335	1520.344	20801.45	3.678E-38	35	1174.731	0.7935975	836.0989	3599.208	0.0370738	20	204.9251	0.9137095	1425.178	16149.74	4.807654E-34	27	1152.906	0.8943766	2072.955	18399.71	3.678E-38	24	1456.674	0.9043258	1962.192	19492.13	3.678E-38	27	1101.588	0.9190936	2124.503	25270.27	3.678E-38	19	858.6082	0.8624028	1921.945	12672.72	2.034434E-23	40	777.4114	0.9248374	1597.592	20888	3.678E-38	38	1299.205	SFTPD	SFTPD_E169_F	61699225	NM_003019.4	SFTPD	6441	10	36.1	81698672	169	N	CCTGTGCTCCCCACCTCCTGCGCCCATGCCTCCTAGACCAGAACA	SP-D, PSP-D, SFTP4, COLEC7	surfactant protein D; surfactant-associated protein, pulmonary 4; pulmonary surfactant apoprotein; collectin 7; go_component: lysosome; go_component: cytoplasm; go_component: lysosome; go_component: endocytic vesicle; go_component: extracellular region; go_component: endocytic vesicle; go_component: extracellular region; go_function: sugar binding; go_function: bacterial binding; go_function: sugar binding; go_function: calcium ion binding; go_function: bacterial binding; go_process: phosphate transport; go_process: alveolus development; go_process: macrophage chemotaxis; go_process: innate immune response; go_process: surfactant homeostasis; go_process: alveolus development; go_process: macrophage chemotaxis; go_process: innate immune response; go_process: surfactant homeostasis; go_process: respiratory gaseous exchange; go_process: receptor mediated endocytosis; go_process: receptor mediated endocytosis; go_process: regulation of cytokine production; go_process: positive regulation of phagocytosis; go_process: regulation of liquid surface tension; go_process: regulation of cytokine production; go_process: positive regulation of phagocytosis; go_process: negative regulation of T cell proliferation; go_process: oxygen and reactive oxygen species metabolism; go_process: negative regulation of T cell proliferation; go_process: antimicrobial humoral response (sensu Vertebrata); go_process: negative regulation of interleukin-2 biosynthesis; go_process: oxygen and reactive oxygen species metabolism; go_process: negative regulation of interleukin-2 biosynthesis	pulmonary surfactant-associated protein D precursor
SGCE_E149_F	3922	0.0441456	5568.096	261.7778	7.238951E-05	26	199.0688	0.09483328	7663.911	813.416	3.94702E-07	29	314.0793	0.1096147	8768.638	1091.811	2.476389E-10	27	497.692	0.04471232	4006.005	192.1819	0.05153151	33	129.0773	0.09881318	8887.997	985.5144	2.573793E-10	21	422.8297	0.1161741	9960.799	1322.437	1.492035E-15	32	473.0088	0.1324449	7628.507	1179.869	1.613239E-06	31	649.9137	0.1058808	9072.747	1086.229	3.229404E-06	26	434.8578	0.1450971	7295.715	1255.226	1.011865E-07	23	376.9902	0.06768145	9946.466	729.3208	5.984739E-12	24	559.3152	SGCE	SGCE_E149_F	89026228	XM_940371.1	PEG10	23089	7	36.1	94123265	-359	Y	CTGTCAGCAAGAATGTGCCAGTGGTCGCGGGGCTCATCCTGCGTGTCCCCCG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to paternally expressed 10
SGCE_P250_R	1969	0.6193165	1135.377	2009.777	0.08021754	30	122.8315	0.8626742	2272.667	14904.98	5.476161E-30	31	1132.776	0.8757501	2624.126	19200.44	3.678E-38	34	1204.3	0.823023	639.7076	3439.973	0.06027629	27	216.8832	0.8764703	2247.627	16656.92	3.678E-38	25	1216.464	0.8730882	2646.073	18891.58	3.678E-38	30	1093.427	0.8673157	2380.559	16214.64	3.515482E-30	26	1588.328	0.8734389	2983.797	21282.28	3.047409E-36	34	715.4916	0.8719243	1870.5	13414.93	8.13575E-26	31	1320.129	0.8643419	2537.221	16802.99	3.678E-38	28	1620.458	SGCE	SGCE_P250_R	89026228	XM_940371.1	PEG10	23089	7	36.1	94123664	40	Y	GGTGTGTGTCGAAGAAACCTGACTGCGCCCTGAGGAGAACAGCGGAGAA	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to paternally expressed 10
SH3BP2_E18_F	1178	0.2893093	6950.219	2870.016	9.152104E-14	34	423.5219	0.2382465	9417.015	2976.547	2.885779E-15	29	666.7456	0.220543	11702.79	3339.534	6.046805E-25	29	470.9875	0.3070705	3664.718	1668.328	0.008786472	32	281.712	0.224131	8764.911	2560.873	1.187274E-13	29	487.4611	0.3048868	9168.304	4065.214	1.031053E-21	27	444.8453	0.3087684	9245.358	4174.507	2.807103E-15	31	393.8483	0.2831141	10683.08	4258.478	2.509261E-13	32	518.6028	0.2225346	8092.277	2344.882	1.317588E-11	29	623.7878	0.1958645	9573.741	2356.248	5.115435E-15	20	701.0066	SH3BP2	SH3BP2_E18_F	19923154	NM_003023.2	SH3BP2	6452	4	36.1	2790357	18	N	GGGTCCAGCCGGGTGACCCAGGCCGAGGCCGGCAGAAGACAGCCTGAT	CRBM, CRPM, RES4-23	Cherubism; go_function: SH3/SH2 adaptor activity; go_process: intracellular signaling cascade	SH3-domain binding protein 2
SH3BP2_P771_R	4982	0.1012182	12437.96	1411.988	3.10002E-28	27	791.9137	0.1531612	6778.029	1243.976	2.07072E-06	36	448.3479	0.1869949	7259.328	1692.679	1.748553E-08	34	390.6698	0.4816658	4840.358	4590.863	2.074206E-07	22	580.3153	0.1655852	6921.951	1393.469	2.553768E-07	26	450.5868	0.2966326	6579.269	2816.862	1.198646E-10	31	508.7293	0.3892208	5742.349	3723.054	1.648679E-07	29	457.6494	0.2667911	7654.446	2821.593	1.36118E-06	35	355.9083	0.1589648	5222.632	1006.036	0.0003508248	30	369.6179	0.1760913	7007.459	1519.054	1.35454E-07	39	322.1141	SH3BP2	SH3BP2_P771_R	19923154	NM_003023.2	SH3BP2	6452	4	36.1	2789568	-771	Y	AGATGTGGGCCTCCTGTCCCAAGCGCCCACCAACCTCCTTGCAGCGTG	CRBM, CRPM, RES4-23	Cherubism; go_function: SH3/SH2 adaptor activity; go_process: intracellular signaling cascade	SH3-domain binding protein 2
SHB_P473_R	2347	0.06043473	7139.895	465.6846	3.632313E-08	27	160.5506	0.01821773	13075.47	244.481	1.051779E-17	26	1034.587	0.01819469	17153.47	319.7391	3.351784E-34	37	1184.289	0.04118647	3283.843	145.3552	0.1301187	22	155.2632	0.0186938	15331.56	293.9699	1.256005E-26	28	1254.238	0.02347641	13027.08	315.5855	4.321315E-22	22	1230.61	0.02174816	16618.82	371.6872	5.544859E-25	36	882.8009	0.01577696	18817.82	303.25	4.13748E-22	27	892.0765	0.02626461	10685.82	290.9263	6.916737E-13	30	899.9788	0.02873201	17252.28	513.3146	1.901968E-34	23	1547.429	SHB	SHB_P473_R	4506934	NM_003028.1	SHB	6461	9	36.1	38059683	-473	Y	TGAGGAGGGAGAGTGGATTAACACGGAACCTGTCTAGTTTACAGCGTGGC	RP11-3J10.8	SHB adaptor protein (a Src homology 2 protein); SHB (Src homology 2 domain-containing) adaptor protein B; bA3J10.2 (SHB adaptor protein (a Src homology 2 protein)); go_function: catalytic activity; go_function: SH3/SH2 adaptor activity; go_process: intracellular signaling cascade	SHB (Src homology 2 domain containing) adaptor protein B
SHB_P691_R	2342	0.03496106	6628.33	243.7514	1.122857E-06	26	324.8212	0.08057476	16879.6	1488.024	1.795751E-34	20	1490.215	0.0588775	19598.55	1232.36	3.678E-38	28	942.8276	0.04421094	4013.026	190.252	0.0511797	26	143.4497	0.08403497	12380.68	1145.037	1.038101E-19	36	1134.467	0.07318223	12447.85	990.788	1.998187E-22	32	1057.826	0.07182977	16642.01	1295.64	5.480233E-28	19	1293.004	0.0964032	18479.45	1982.21	1.941339E-25	27	906.6224	0.1116246	9954.849	1263.394	1.748626E-13	32	890.2937	0.09700624	17097.53	1847.485	3.678E-38	31	897.6262	SHB	SHB_P691_R	4506934	NM_003028.1	SHB	6461	9	36.1	38059901	-691	Y	GGTGGGAGCCGGGCCCAGCACCAATCCGAGAGCAAGGCTAGGGGAGGTC	RP11-3J10.8	SHB adaptor protein (a Src homology 2 protein); SHB (Src homology 2 domain-containing) adaptor protein B; bA3J10.2 (SHB adaptor protein (a Src homology 2 protein)); go_function: catalytic activity; go_function: SH3/SH2 adaptor activity; go_process: intracellular signaling cascade	SHB (Src homology 2 domain containing) adaptor protein B
SHH_E328_F	1739	0.3046665	917.4354	445.7983	0.57413	39	48.20112	0.3875178	3803.115	2469.503	0.0004476553	24	470.2569	0.3482121	3888.186	2130.654	0.0006092042	26	215.5201	0.1310655	1300.945	211.3112	0.5522792	31	67.09703	0.357379	3046.472	1749.839	0.009934145	30	226.7198	0.3752308	3441.625	2127.068	0.000754727	23	370.1116	0.4332386	3051.649	2409.155	0.009038673	33	313.3553	0.3222504	4026.816	1962.182	0.01601936	33	274.4768	0.3866236	2336.784	1535.955	0.06006346	17	317.0099	0.3500387	3891.61	2149.694	0.0005802359	27	206.5249	SHH	SHH_E328_F	21071042	NM_000193.2	SHH	6469	7	36.1	155297400	328	Y	GATCTTCCCTTCATACCTTCCGCTGGCGCCTAGGGTCTTCTCGGCCAC	HHG1, HLP3, HPE3, SMMCI	go_function: peptidase activity; go_process: development; go_process: proteolysis; go_process: cell-cell signaling; go_process: ventral midline development; go_process: intein-mediated protein splicing; go_process: mesodermal cell fate determination	sonic hedgehog preproprotein
SHH_P104_R	6007	0.02435028	8345.146	210.7741	2.295162E-10	21	370.1941	0.05697291	11051.74	673.7314	1.24817E-13	21	985.6394	0.05163606	13869.09	760.5825	1.585325E-23	24	818.687	0.168281	4113.233	852.46	0.01643928	30	203.3489	0.07005183	9558.359	727.5521	3.28609E-11	30	753.5562	0.08209529	12110.05	1092.038	1.322504E-21	32	649.6429	0.05056048	11699.92	628.381	8.018941E-13	29	711.3167	0.07317176	13216.27	1051.301	3.89535E-12	29	673.0795	0.09604633	6678.914	720.2689	8.525246E-06	25	536.2329	0.06762388	12191.22	891.464	3.504235E-18	30	512.1458	SHH	SHH_P104_R	21071042	NM_000193.2	SHH	6469	7	36.1	155297832	-104	Y	ATGGCAGGCTGCCGGCCGCTGATAACGGAACACATCGGAGTTGGGTCG	HHG1, HLP3, HPE3, SMMCI	go_function: peptidase activity; go_process: development; go_process: proteolysis; go_process: cell-cell signaling; go_process: ventral midline development; go_process: intein-mediated protein splicing; go_process: mesodermal cell fate determination	sonic hedgehog preproprotein
SIN3B_P514_R	2816	0.4405005	798.4508	707.3607	0.5237775	25	68.30255	0.9241436	505.2364	7373.469	3.412179E-06	21	794.7483	0.9382899	572.4752	10224.86	1.84282E-12	26	399.1824	0.25609	1216.648	453.2543	0.5111799	28	95.35498	0.9315753	529.1745	8565.962	9.608409E-09	23	306.3828	0.9326206	516.7385	8536.49	7.227623E-10	33	407.7053	0.9322337	477.3501	7942.372	5.67289E-06	30	582.4434	0.9195919	774.1566	9997.345	5.916699E-07	28	378.4514	0.9088561	567.8526	6659.6	1.545442E-05	38	594.1064	0.9466552	564.3045	11788.72	3.854588E-16	36	281.2339	SIN3B	SIN3B_P514_R	52138512	NM_015260.1	SIN3B	23309	19	36.1	16800704	-514	Y	CCACGCAAGGCCCTATATTAGGGCGCTGGGGGCTCATACCTCATCGTCCC	KIAA0700	SIN3 homolog B, transcriptional regulator (yeast); go_component: nucleus; go_function: protein binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	SIN3 homolog B, transcription regulator
SIN3B_P607_F	2807	0.1869501	1727.33	420.1703	0.3039327	27	61.51388	0.8382303	2322.346	12551.69	3.070551E-22	25	1265.757	0.8600243	2204.355	14158.18	8.818783E-30	18	841.2905	0.07497136	1677.928	144.0968	0.4714026	33	63.58422	0.8292078	2224.603	11286.1	1.152642E-19	18	1012.456	0.85444	1957.054	12074.94	1.478176E-24	35	737.2635	0.8604623	1849.479	12021.51	2.309955E-16	24	692.6023	0.8498079	2710.445	15901.88	6.52801E-21	23	1032.741	0.8441046	1650.947	9480.604	2.876133E-13	21	567.3443	0.87713	2234.769	16667.18	3.678E-38	30	998.3583	SIN3B	SIN3B_P607_F	52138512	NM_015260.1	SIN3B	23309	19	36.1	16800611	-607	Y	CTAAACTGGTCCAGATGGGAAGTGACGGGGCCAAGGATAGGGAAGT	KIAA0700	SIN3 homolog B, transcriptional regulator (yeast); go_component: nucleus; go_function: protein binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	SIN3 homolog B, transcription regulator
SKI_E465_R	1604	0.04005532	4526.35	193.0423	0.002486806	26	198.2824	0.0542695	9028.104	523.8043	5.14888E-09	25	570.8113	0.04870335	11842.67	611.4267	8.877046E-17	39	429.8159	0.03714998	5521.642	216.9018	0.004139889	28	318.2858	0.04125719	7113	310.3941	7.138117E-06	25	735.0614	0.06367075	9693.503	665.962	5.060487E-13	25	399.9357	0.06017845	9382.376	607.1734	2.322513E-08	33	383.7399	0.04515949	13056.14	622.2239	3.808004E-11	30	607.0289	0.07806709	7253.756	622.6986	1.491437E-06	28	373.3557	0.07287098	9047.829	719.006	5.720335E-10	27	845.2311	SKI	SKI_E465_R	4506966	NM_003036.1	SKI	6497	1	36.1	2150459	465	Y	CCGCAGATTCTCAACTCGGTGCTGCGCGACTTCTCGCTGCAGCAGATCAACGC	SKV	Avian sarcoma viral (v-ski) oncogene homolog; v-ski avian sarcoma viral oncogene homolog; ski oncoprotein; go_component: nucleus; go_function: protein binding; go_process: cell differentiation	v-ski sarcoma viral oncogene homolog
SLC14A1_E295_F	5724	0.161264	5039.421	988.1581	3.499751E-05	35	193.3434	0.6994227	4351.622	10358.62	9.804925E-22	31	884.205	0.7384444	4817.145	13882.47	3.678E-38	31	1116.776	0.2012524	757.8828	216.1521	0.6859565	29	75.76777	0.7592024	3607.802	11690.2	1.782744E-25	27	1110.467	0.7072977	4860.221	11986.08	4.511294E-36	24	1090.665	0.7573723	4398.901	14043.5	1.15695E-29	33	1007.687	0.7573807	4864.239	15496.78	3.520625E-25	41	823.1431	0.6619507	4243.473	8505.165	1.279325E-17	34	590.0269	0.7644741	4798.559	15899.83	3.678E-38	33	680.8439	SLC14A1	SLC14A1_E295_F	7706676	NM_015865.1	SLC14A1	6563	18	36.1	41558450	295	N	TCCTGGAAGCTCAAAGGCATGCCTTTATTCGTGATTTCTGAAGCAAGGTGCATGC	JK, UT1, UTE, HUT11, RACH1, UT-B1, HsT1341	blood group Kidd urea transporter; urea transporter JK glycoprotein; urea transporter-B1; kidd (JK) blood group/urea transporter-B1; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: urea transporter activity; go_function: urea transporter activity; go_process: transport; go_process: urea transport; go_process: urea transport	RACH1
SLC14A1_P369_R	5188	0.5760008	1972.688	2815.736	0.002050075	31	154.4603	0.9648629	550.3264	17857.95	1.245224E-34	29	1454.707	0.971354	632.3195	24832.15	3.678E-38	26	1016.599	0.362322	2365.269	1400.74	0.08903331	26	173.6875	0.9567769	679.4182	17253.04	1.649564E-35	28	1613.024	0.9563065	828.8112	20328.58	3.678E-38	26	1134.278	0.9502533	1098.845	22900.14	3.678E-38	22	1472.252	0.9588656	994.4663	25512.66	3.678E-38	24	1146.997	0.9469599	671.8408	13780.19	6.139083E-23	23	1282.71	0.9708851	553.3893	21788.38	3.678E-38	28	1094.962	SLC14A1	SLC14A1_P369_R	7706676	NM_015865.1	SLC14A1	6563	18	36.1	41557786	-369	N	CCAGGAGCAGTCGCTTAGCTTCCGAGTCCACACAGCAGCAACCTGCC	JK, UT1, UTE, HUT11, RACH1, UT-B1, HsT1341	blood group Kidd urea transporter; urea transporter JK glycoprotein; urea transporter-B1; kidd (JK) blood group/urea transporter-B1; go_component: plasma membrane; go_component: integral to membrane; go_component: integral to plasma membrane; go_function: urea transporter activity; go_function: urea transporter activity; go_process: transport; go_process: urea transport; go_process: urea transport	RACH1
SLC22A18_P216_R	1980	0.2951621	653.8098	315.67	0.7048345	24	35.03655	0.8349653	1742.677	9322.713	4.093623E-12	26	647.9072	0.7987972	2682.059	11045.08	1.408033E-20	22	403.4311	0.1724142	447.3046	114.0221	0.774906	25	21.76303	0.7676066	2419.438	8321.825	3.023394E-12	33	666.1487	0.8186513	2166.734	10232.57	6.088658E-19	34	651.4055	0.7600754	2403.823	7932.052	5.939679E-09	31	851.6989	0.7682042	3184.041	10883.78	8.542007E-12	29	588.3991	0.8313056	1644.451	8596.442	3.687078E-11	29	637.7059	0.7946519	2179.191	8819.966	1.055052E-12	23	717.1344	SLC22A18	SLC22A18_P216_R	34734074	NM_002555.3	SLC22A18	5002	11	36.1	2877311	-216	N	GTCAGCCTGGATCCTCTCATCCGGCAGAACTGTCGCCTTGCTTCTCTGAAGCG	HET, ITM, BWR1A, IMPT1, TSSC5, ORCTL2, BWSCR1A, SLC22A1L, p45-BWR1A, DKFZp667A184	organic cation transporter-like 2; solute carrier family 22 (organic cation transporter), member 1-like; Beckwith-Wiedemann syndrome chromosome region 1, candidate A; p45 Beckwith-Wiedemann region 1A; efflux transporter-like protein; tumor-suppressing STF cDNA 5; imprinted multi-membrane spanning polyspecific transporter-related protein; go_component: plasma membrane; go_component: integral to membrane; go_function: transporter activity; go_function: organic cation transporter activity; go_function: tetracycline:hydrogen antiporter activity; go_process: excretion; go_process: transport; go_process: response to drug; go_process: tetracycline transport	tumor suppressing subtransferable candidate 5
SLC22A18_P472_R	1974	0.3843815	2534.576	1644.984	0.00998523	27	184.9138	0.9316078	1025.875	15336.17	4.191874E-27	33	1160.164	0.932135	1075.744	16149.01	3.482957E-33	23	1596.768	0.6030043	1059.66	1761.43	0.2336145	33	87.80193	0.9082451	1264.913	13510.73	1.077671E-23	33	890.9358	0.9319068	1132.776	16871.46	3.678E-38	27	1115.568	0.9118773	1304.633	14534.88	1.419958E-21	29	780.8608	0.9190207	1466.215	17774.71	2.13433E-22	27	1101.362	0.9190215	840.866	10677.85	3.010285E-14	33	892.5476	0.9375911	1016.773	16777.68	1.452057E-34	37	631.6396	SLC22A18	SLC22A18_P472_R	34734074	NM_002555.3	SLC22A18	5002	11	36.1	2877055	-472	N	TCTCTAGACTCACTTTCTGCCCCGTCACCCCACTGTACACCCTTGGTC	HET, ITM, BWR1A, IMPT1, TSSC5, ORCTL2, BWSCR1A, SLC22A1L, p45-BWR1A, DKFZp667A184	organic cation transporter-like 2; solute carrier family 22 (organic cation transporter), member 1-like; Beckwith-Wiedemann syndrome chromosome region 1, candidate A; p45 Beckwith-Wiedemann region 1A; efflux transporter-like protein; tumor-suppressing STF cDNA 5; imprinted multi-membrane spanning polyspecific transporter-related protein; go_component: plasma membrane; go_component: integral to membrane; go_function: transporter activity; go_function: organic cation transporter activity; go_function: tetracycline:hydrogen antiporter activity; go_process: excretion; go_process: transport; go_process: response to drug; go_process: tetracycline transport	tumor suppressing subtransferable candidate 5
SLC22A2_E271_R	3924	0.8891744	736.7762	6713.61	7.771224E-08	26	282.0345	0.962327	542.7719	16419.1	3.284353E-29	26	1620.376	0.9751217	519.0845	24265.44	3.678E-38	24	1421.749	0.6209324	2259.997	3865.798	0.001899307	38	257.8328	0.967317	481.4932	17210.46	1.607283E-34	29	1453.903	0.9663748	512.1658	17593.4	3.678E-38	37	1625.12	0.972474	580.5375	24042.9	3.678E-38	26	1160.286	0.9748718	582.0235	26459.72	3.678E-38	27	1461.181	0.9540318	646.1428	15485.56	6.349076E-29	24	1249.228	0.9719585	565.6525	23072.44	3.678E-38	21	1216.893	SLC22A2	SLC22A2_E271_R	23510414	NM_153191.1	SLC22A2	6582	6	36.1	160599678	271	Y	CCAGGAAGACGATGCCCACGTAGATGGGCGCGAAGGTAGCCGAGAGCAGAGCCAAG	OCT2, MGC32628	isoform b is encoded by transcript variant 2; organic cation transporter 2; organic cation transporter (OCT2); go_component: membrane; go_component: integral to membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: sodium ion binding; go_function: symporter activity; go_function: transporter activity; go_function: ion transporter activity; go_function: organic cation transporter activity; go_process: transport; go_process: ion transport; go_process: fluid secretion; go_process: sodium ion transport; go_process: organic cation transport	solute carrier family 22 member 2 isoform b
SLC22A2_P109_F	1983	0.1061144	10770.73	1290.478	3.979876E-21	22	523.5997	0.9296213	950.9844	13882.3	4.104278E-22	22	751.7668	0.9141592	1249.047	14366.65	5.456589E-27	22	710.0534	0.02610613	6774.19	184.2691	0.0002903215	23	294.5056	0.9201491	898.5389	11506.51	1.794984E-16	28	988.5568	0.9077934	1385.76	14627.62	2.018518E-32	31	868.2202	0.9201524	1034.043	13068.55	6.178687E-17	19	873.3384	0.9109568	1386.823	15210.95	1.612438E-16	32	733.5532	0.8890628	1217.408	10557.84	6.422865E-15	21	634.4219	0.9257342	1066.505	14540.67	2.867336E-26	31	531.715	SLC22A2	SLC22A2_P109_F	23510414	NM_153191.1	SLC22A2	6582	6	36.1	160600058	-109	Y	ATTATAACTGGTTCTCCACAGGCTTGTCGGTGCTCCACGCCAGCAGCACAAA	OCT2, MGC32628	isoform b is encoded by transcript variant 2; organic cation transporter 2; organic cation transporter (OCT2); go_component: membrane; go_component: integral to membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ATP binding; go_function: nucleotide binding; go_function: sodium ion binding; go_function: symporter activity; go_function: transporter activity; go_function: ion transporter activity; go_function: organic cation transporter activity; go_process: transport; go_process: ion transport; go_process: fluid secretion; go_process: sodium ion transport; go_process: organic cation transport	solute carrier family 22 member 2 isoform b
SLC22A3_E122_R	3926	0.3881604	2548.664	1680.353	0.008868878	25	188.2472	0.1068685	7472.654	906.1133	5.702283E-07	32	496.9082	0.09766369	9636.431	1053.815	3.312676E-12	22	717.5309	0.6474962	1174.205	2340.521	0.1186178	31	132.6101	0.1114471	7553.304	959.919	1.148129E-07	32	451.2598	0.1585679	7599.291	1450.932	7.339829E-10	33	427.7165	0.1385214	7768.914	1265.282	7.530198E-07	40	520.1842	0.09083472	9371.229	946.2708	2.104838E-06	24	473.1229	0.09629762	6344.961	686.7686	2.981568E-05	26	474.5431	0.111561	7506.167	955.1041	1.763003E-07	32	397.4063	SLC22A3	SLC22A3_E122_R	24497488	NM_021977.2	SLC22A3	6581	6	36.1	160689537	122	Y	CTGCTGTGCCTGACGGGCGTCACCTTCGCCTTCCTCTTCGTCGGCGTGGTCTTC	EMT, EMTH, OCT3	organic cation transporter 3; extraneuronal monoamine transporter; EMT organic cation transporter 3; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ion transporter activity; go_function: organic cation transporter activity; go_process: ion transport; go_process: organic cation transport	solute carrier family 22 member 3
SLC22A3_P528_F	1985	0.08199248	2308.136	215.0844	0.1980842	32	79.94968	0.1783285	5229.853	1156.746	0.0003307154	22	397.2427	0.1308172	6559.976	1002.366	4.616784E-06	33	385.701	0.3529432	309.1847	223.1936	0.7805606	33	17.11041	0.108312	5819.115	718.9857	0.0001251189	24	349.1376	0.2095863	5249.46	1418.464	2.245328E-05	32	299.194	0.1377244	6774.384	1097.991	2.971108E-05	29	338.9285	0.167802	6698.074	1370.744	0.00044291	29	352.0135	0.2601237	4232.945	1523.365	0.001259296	32	204.9186	0.1118526	5874	752.3608	0.0001102112	27	366.289	SLC22A3	SLC22A3_P528_F	24497488	NM_021977.2	SLC22A3	6581	6	36.1	160688887	-528	Y	CACATGGGCGCAGGAGGCCTCCGCACGCGCAAGGGCCAAGGGCTGGAG	EMT, EMTH, OCT3	organic cation transporter 3; extraneuronal monoamine transporter; EMT organic cation transporter 3; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ion transporter activity; go_function: organic cation transporter activity; go_process: ion transport; go_process: organic cation transport	solute carrier family 22 member 3
SLC22A3_P634_F	1987	0.1454209	7601.041	1310.46	2.880924E-11	27	355.1219	0.7445741	3742.57	11201.21	1.864892E-22	27	1064.279	0.8093482	4134.448	17975.93	3.678E-38	26	1240.219	0.05896834	5600.565	357.2174	0.002682751	32	264.0055	0.7497515	3761.557	11569.33	1.369677E-25	28	868.8256	0.7441853	4461.063	13268.5	3.678E-38	34	1282.387	0.6540125	6066.037	11655.52	2.75638E-27	29	1159.319	0.7363942	5099.201	14524.19	2.504123E-23	26	1488.795	0.7653807	2592.87	8784.745	6.923495E-14	28	596.2097	0.6441911	6496.042	11942.12	3.106773E-37	32	924.3406	SLC22A3	SLC22A3_P634_F	24497488	NM_021977.2	SLC22A3	6581	6	36.1	160688781	-634	Y	TGTAGCTCTCGATGGGTCGAGGGCGATGGCCAGCGCTGTGCTGGG	EMT, EMTH, OCT3	organic cation transporter 3; extraneuronal monoamine transporter; EMT organic cation transporter 3; go_component: membrane; go_component: membrane fraction; go_component: integral to plasma membrane; go_function: ion transporter activity; go_function: organic cation transporter activity; go_process: ion transport; go_process: organic cation transport	solute carrier family 22 member 3
SLC38A4_P45_R	1989	0.1551341	5289.315	989.5851	1.331089E-05	36	180.4746	0.6117494	3802.58	6149.125	8.783971E-10	36	465.0407	0.6264525	4839.774	8284.178	1.003024E-18	32	402.8982	0.8506767	1416.612	8639.949	2.22431E-08	33	507.1007	0.6639943	3619.714	7350.674	8.700566E-13	24	571.446	0.5262361	5498.919	6219.033	7.886887E-17	19	716.4036	0.5865659	4136.356	6010.395	1.259199E-08	32	721.4869	0.7169518	3754.011	9762.086	6.998947E-11	31	683.4922	0.4085138	5168.823	3638.946	3.386292E-08	30	490.4453	0.6653627	4018.581	8189.017	9.484513E-16	19	409.2003	SLC38A4	SLC38A4_P45_R	18482384	NM_018018.2	SLC38A4	55089	12	36.1	45506051	-45	Y	GCTCCAGGCGCTGCGCACACCCCAGTGGCCGCCCAGGACGTGCGGTCACTGG	ATA3, NAT3, PAAT, FLJ10191, MGC126876	N amino acid transporter 3; amino acid transporter system A3; go_component: membrane; go_component: ribosome; go_component: intracellular; go_function: structural constituent of ribosome; go_function: amino acid-polyamine transporter activity; go_process: amino acid transport; go_process: protein biosynthesis	solute carrier family 38, member 4
SLC5A5_E60_F	3929	0.53649	2412.502	2908.098	0.0004109149	21	253.9227	0.7738743	3591.479	12633.42	1.236573E-26	36	894.7213	0.732924	5115.78	14313.42	3.678E-38	36	841.743	0.1614147	1246.853	259.2484	0.5538752	26	103.3803	0.7463311	3540.296	10710.28	5.673705E-22	38	738.7631	0.7945383	3607.448	14337.03	3.678E-38	26	830.5725	0.6894077	4386.615	9958.737	1.510176E-17	30	1194.486	0.7061993	6063.317	14814.57	1.59935E-26	21	698.3292	0.79108	2746.813	10779.52	5.919871E-20	29	757.0177	0.7022116	5206.2	12512.49	2.946705E-34	31	610.1213	SLC5A5	SLC5A5_E60_F	4507034	NM_000453.1	SLC5A5	6528	19	36.1	17843842	60	Y	GGACAGACAGCCGGCTGCATGGGACAGCGGAACCCAGAGTGAGAGGGG	NIS	sodium-iodide symporter; go_component: membrane; go_component: integral to membrane; go_function: sodium ion binding; go_function: symporter activity; go_function: transporter activity; go_function: iodide transporter activity; go_process: ion transport; go_process: sodium ion transport	solute carrier family 5 (sodium iodide symporter), member 5
SLC5A8_E60_R	3930	0.08823348	10470.23	1022.902	4.248186E-19	33	485.3159	0.3063092	10986.25	4895.294	1.775534E-25	33	733.6111	0.3264997	12299.46	6011.011	9.563873E-38	25	596.1385	0.1090577	8097.788	1003.467	6.309672E-07	29	390.5484	0.2829017	10070.99	4012.547	1.93616E-21	27	526.67	0.3519993	10789.12	5915.061	1.957358E-35	35	746.7789	0.3243374	10674.37	5172.007	1.357521E-21	35	872.089	0.3461507	11600.08	6194.07	4.639105E-19	18	666.1288	0.279635	9058.108	3555.041	3.145139E-17	29	877.4362	0.2731846	12429.85	4709.535	5.916781E-32	38	538.337	SLC5A8	SLC5A8_E60_R	33942075	NM_145913.2	SLC5A8	160728	12	36.1	100128060	60	Y	ACTGGAGTGGCCGAGTTCGCCAAGGCGCCGGGGACACCTGAGCAGATGA	AIT, MGC125354	apical iodide transporter; go_component: membrane; go_component: integral to membrane; go_function: transporter activity; go_process: ion transport; go_process: sodium ion transport	solute carrier family 5 (iodide transporter), member 8
SLC5A8_P38_R	2003	0.03305542	5507.198	191.6845	0.0001152745	26	216.9604	0.2806862	6171.634	2447.278	2.306244E-07	23	304.1836	0.1696858	7541.337	1561.609	8.914484E-09	38	250.8908	0.1832728	562.6674	148.702	0.7443112	24	30.76653	0.1658099	7027.146	1416.645	1.523897E-07	31	282.2993	0.2432408	7377.098	2403.32	1.457993E-11	31	421.1571	0.1800203	7145.351	1590.661	2.049353E-06	18	523.3634	0.2031575	7530.367	1945.386	1.869625E-05	26	411.5779	0.1743239	6330.499	1357.662	3.014251E-06	24	315.8343	0.1959581	7782.297	1921.044	7.729422E-10	40	324.9874	SLC5A8	SLC5A8_P38_R	33942075	NM_145913.2	SLC5A8	160728	12	36.1	100128158	-38	Y	TGGGCAGGTTTTGTTCAAGTGGTACCCGAGGGGACGCACCATTTAAATAAGCAGG	AIT, MGC125354	apical iodide transporter; go_component: membrane; go_component: integral to membrane; go_function: transporter activity; go_process: ion transport; go_process: sodium ion transport	solute carrier family 5 (iodide transporter), member 8
SLC6A8_P193_R	2016	0.4382549	3711.716	2973.774	2.516103E-06	22	356.2017	0.8457295	1833.924	10602.01	2.254504E-15	34	617.1717	0.8157758	2636.207	12116.38	6.056465E-24	24	563.5924	0.3494839	3085.662	1711.468	0.02153613	29	160.4987	0.8209653	2144.517	10292.25	1.468052E-16	31	972.2472	0.8494645	2241.192	13211.24	4.453622E-30	26	790.7986	0.8409549	2278.669	12577.27	7.136513E-19	19	851.4565	0.7862481	4045.626	15248.95	1.584746E-22	37	555.5803	0.8304382	1532.297	7994.265	1.286777E-09	20	789.9138	0.7996458	2851.21	11778.76	5.979962E-23	35	595.1685	SLC6A8	SLC6A8_P193_R	5032096	NM_005629.1	SLC6A8	6535	X	36.1	152606393	-193	Y	GTAGCAACCATCCTGCCTCCCGCTGGAGCGGCGTCTCCTCCCCG	CT1, CRTR, MGC87396	go_component: membrane; go_component: integral to plasma membrane; go_function: sodium ion binding; go_function: symporter activity; go_function: creatine:sodium symporter activity; go_function: neurotransmitter:sodium symporter activity; go_process: ion transport; go_process: sodium ion transport; go_process: muscle contraction; go_process: neurotransmitter uptake; go_process: neurotransmitter transport	solute carrier family 6 (neurotransmitter transporter, creatine), member 8
SLC6A8_P409_F	2017	0.9188549	1911.893	22781.87	3.678E-38	26	1114.486	0.8361579	4681.516	24402.17	3.678E-38	22	1982.351	0.8527524	4958.202	29293.48	3.678E-38	33	1569.41	0.9572135	915.176	22711.38	3.678E-38	23	741.5034	0.8486241	4217.503	24204.22	3.678E-38	26	1534.072	0.8495197	5067.443	29172.22	3.678E-38	29	1322.94	0.9069309	2741.233	27686.98	3.678E-38	18	3156.577	0.9077479	3765.928	38040.2	3.678E-38	27	1368.26	0.8533996	2465.53	14934.62	6.226052E-34	25	1714.662	0.8863868	3873.736	31002.28	3.678E-38	26	1589.098	SLC6A8	SLC6A8_P409_F	5032096	NM_005629.1	SLC6A8	6535	X	36.1	152606177	-409	Y	GAGAGCTCAAGGAAGGAGGGAGCACCGGGAGGAGACGGCTGCAGCC	CT1, CRTR, MGC87396	go_component: membrane; go_component: integral to plasma membrane; go_function: sodium ion binding; go_function: symporter activity; go_function: creatine:sodium symporter activity; go_function: neurotransmitter:sodium symporter activity; go_process: ion transport; go_process: sodium ion transport; go_process: muscle contraction; go_process: neurotransmitter uptake; go_process: neurotransmitter transport	solute carrier family 6 (neurotransmitter transporter, creatine), member 8
SLC6A8_seq_28_S227_F	6110	0.08544239	3887.589	372.5399	0.008224077	32	111.7889	0.04054367	3982.977	172.534	0.03844072	33	156.1541	0.04836255	4768.232	247.4053	0.007051707	31	155.7553	0.03526992	4421.68	165.3098	0.02970244	23	186.9857	0.4483654	3139.042	2632.675	0.001050984	28	190.9052	0.5608487	2716.604	3597.14	7.587899E-05	26	273.4669	0.477671	3102.834	2928.999	0.0029346	28	305.4492	0.3800134	4569.677	2862.223	0.001523456	27	348.9325	0.2851483	3447.978	1415.258	0.01001957	34	190.2732	0.5427453	2227.892	2763.125	0.007186627	35	216.5262	SLC6A8	SLC6A8_seq_28_S227_F	.	.	.	.	X	36.1	152607268	.	Y	GCCGAGAACGGCATCTATAGCGTGTCCGGCGACGAGAAGAAGGGCCCCCTC	.	.	.
SLIT2_E111_R	5725	0.0344129	7039.851	254.4597	1.638827E-07	29	336.5853	0.1172866	9281.972	1246.588	5.906915E-11	23	500.7886	0.09778585	10717.88	1172.488	3.139094E-15	41	411.4148	0.03547147	5325.447	199.5261	0.006203146	36	144.7573	0.1139889	9100.442	1183.674	3.316355E-11	28	439.3978	0.2134421	9695.359	2658.091	8.529979E-19	21	437.2198	0.1019785	9778.57	1121.801	5.722328E-10	26	425.3238	0.1226165	10884.65	1535.131	3.440725E-09	33	442.8173	0.0858848	7965.601	757.7957	4.872589E-08	29	520.1948	0.0768069	11855.75	994.6828	1.617076E-17	28	577.11	SLIT2	SLIT2_E111_R	4759145	NM_004787.1	SLIT2	9353	4	36.1	19864444	111	Y	CACTCTGGGTTGCTAGCCCCGCCGGGCACTGGGCCTCAGACACTGCGCGGTT	SLIL3, Slit-2	slit (Drosophila) homolog 2; go_component: extracellular space; go_component: integral to membrane; go_function: calcium ion binding; go_function: receptor binding; go_function: follicle stimulating hormone receptor activity; go_process: chemotaxis; go_process: sensory perception; go_process: cell differentiation; go_process: mesoderm migration; go_process: neuron recognition; go_process: motor axon guidance; go_process: glial cell migration; go_process: ureteric bud development; go_process: nervous system development; go_process: sensory perception of smell; go_process: induction of negative chemotaxis; go_process: induction of negative chemotaxis; go_process: positive regulation of axonogenesis; go_process: G-protein coupled receptor protein signaling pathway	slit homolog 2
SLIT2_P208_F	5211	0.06750558	3641.639	270.8665	0.01837477	33	132.7256	0.2385273	7088.527	2251.768	1.269183E-08	16	432.0939	0.2077996	9182.267	2434.802	1.651883E-14	19	784.1139	0.9396931	435.505	8344.154	1.78659E-06	24	327.3087	0.1708696	8410.146	1753.796	6.101833E-11	20	387.4201	0.4417111	7451.524	5974.669	2.209211E-22	29	564.9043	0.2038373	8352.51	2164.052	2.853481E-09	18	398.1013	0.162939	10191.89	2003.379	7.292022E-09	37	383.3828	0.2052697	7154.387	1873.724	1.283594E-08	29	464.8775	0.133954	9462.499	1479.061	1.443524E-12	25	632.6652	SLIT2	SLIT2_P208_F	4759145	NM_004787.1	SLIT2	9353	4	36.1	19864125	-208	Y	CCACTGGCATCGGATTTGCAGAAGCGTGCGTGGGATCAGAGGACCGCCCTC	SLIL3, Slit-2	slit (Drosophila) homolog 2; go_component: extracellular space; go_component: integral to membrane; go_function: calcium ion binding; go_function: receptor binding; go_function: follicle stimulating hormone receptor activity; go_process: chemotaxis; go_process: sensory perception; go_process: cell differentiation; go_process: mesoderm migration; go_process: neuron recognition; go_process: motor axon guidance; go_process: glial cell migration; go_process: ureteric bud development; go_process: nervous system development; go_process: sensory perception of smell; go_process: induction of negative chemotaxis; go_process: induction of negative chemotaxis; go_process: positive regulation of axonogenesis; go_process: G-protein coupled receptor protein signaling pathway	slit homolog 2
SMAD2_P708_R	6035	0.00971241	22982.4	226.3845	3.678E-38	33	809.8045	0.03365483	9499.983	334.3379	1.489225E-09	27	783.3492	0.0264828	14331.07	392.5714	7.603154E-24	27	529.7859	0.01213513	13189.94	163.2562	1.142424E-14	27	1263.758	0.03257387	10072.5	342.5147	1.690999E-11	25	966.0885	0.03500412	13364.13	488.396	6.685617E-24	28	1022.527	0.03383734	10692.28	377.9716	2.750244E-10	28	797.8198	0.03072307	13354	426.45	2.585576E-11	30	504.9018	0.04444873	7248.148	341.8089	4.315081E-06	26	519.0734	0.03173526	13320.05	439.8475	3.398343E-20	34	520.8669	SMAD2	SMAD2_P708_R	51173728	NM_005901.3	SMAD2	4087	18	36.1	43711929	-708	Y	GCGCCTGAGAGAGAAAAGGGGTTCGGGAGAAGCCCGAGGACCCG	JV18, MADH2, MADR2, JV18-1, hMAD-2, hSMAD2, MGC22139, MGC34440	Mad-related protein 2; Mad, mothers against decapentaplegic homolog 2 (Drosophila); Mad protein homolog; mother against DPP homolog 2; go_component: nucleus; go_component: transcription factor complex; go_function: double-stranded DNA binding; go_function: transcription factor binding; go_function: transcriptional activator activity; go_process: transcription; go_process: mesoderm formation; go_process: cell fate commitment; go_process: regulation of binding; go_process: intracellular signaling cascade; go_process: paraxial mesoderm morphogenesis; go_process: anterior/posterior pattern formation; go_process: transforming growth factor beta receptor signaling pathway; go_process: positive regulation of transcription from RNA polymerase II promoter	Sma- and Mad-related protein 2
SMAD2_P848_R	6021	0.1156083	2863.114	387.3403	0.06711869	36	110.3041	0.1954845	5594.091	1383.573	6.190198E-05	33	204.8682	0.224101	6768.647	1983.854	4.173384E-08	28	339.7957	0.0628079	1953.059	137.5901	0.4020962	32	126.6612	0.1639159	5218.551	1042.712	0.0002801568	25	308.4571	0.2806512	5378.448	2137.395	8.726866E-07	41	392.9277	0.2838648	5544.682	2237.464	3.853644E-05	26	472.2935	0.1745763	6715.31	1441.431	0.000369898	31	235.9299	0.2553514	4592.096	1608.991	0.0003793258	21	327.4587	0.1497002	6476.922	1157.905	4.040263E-06	24	253.012	SMAD2	SMAD2_P848_R	51173728	NM_005901.3	SMAD2	4087	18	36.1	43712069	-848	Y	GGGTCTTTGGAGAGCACTTAGGGCCCGGGTAGGGGATGCCAGGTATAA	JV18, MADH2, MADR2, JV18-1, hMAD-2, hSMAD2, MGC22139, MGC34440	Mad-related protein 2; Mad, mothers against decapentaplegic homolog 2 (Drosophila); Mad protein homolog; mother against DPP homolog 2; go_component: nucleus; go_component: transcription factor complex; go_function: double-stranded DNA binding; go_function: transcription factor binding; go_function: transcriptional activator activity; go_process: transcription; go_process: mesoderm formation; go_process: cell fate commitment; go_process: regulation of binding; go_process: intracellular signaling cascade; go_process: paraxial mesoderm morphogenesis; go_process: anterior/posterior pattern formation; go_process: transforming growth factor beta receptor signaling pathway; go_process: positive regulation of transcription from RNA polymerase II promoter	Sma- and Mad-related protein 2
SMAD4_P474_R	5229	0.0564702	5631.596	343.0357	4.264119E-05	20	286.4155	0.02599599	12364.91	332.6862	4.806096E-16	30	856.8369	0.0209653	15632.91	336.9085	2.700222E-28	14	1340.352	0.05886661	2063.44	135.3202	0.3749272	25	53.51806	0.03553017	12036.06	447.0811	1.093085E-16	27	752.204	0.0280393	12969.35	377.027	4.194793E-22	30	1057.73	0.02986717	13165.29	408.3944	1.210598E-15	36	946.7176	0.02080873	13951.48	298.6071	4.174593E-12	29	727.1296	0.04178201	8098.829	357.5006	1.499725E-07	31	523.2918	0.03858093	15240.33	615.5942	3.753505E-27	33	541.1323	SMAD4	SMAD4_P474_R	34147555	NM_005359.3	SMAD4	4089	18	36.1	46810137	-474	Y	CGCCAGCGTCTGTTTCTTCCCGAAGTGAACTCCTACAACCTAGCCACCT	JIP, DPC4, MADH4	Mothers against decapentaplegic, Drosophila, homolog of, 4; MAD (mothers against decapentaplegic, Drosophila) homolog 4; MAD, mothers against decapentaplegic homolog 4 (Drosophila); deleted in pancreatic carcinoma locus 4; go_component: cytoplasm; go_component: nucleus; go_function: protein binding; go_function: transcription factor activity; go_function: transcription cofactor activity; go_process: transcription; go_process: SMAD protein heteromerization; go_process: regulation of transcription, DNA-dependent	MAD, mothers against decapentaplegic homolog 4
SMARCA3_E20_F	3933	0.2182437	5504.613	1564.646	4.649747E-07	24	237.648	0.04545482	11648.38	559.45	8.421289E-15	27	883.3095	0.04642608	11051.92	542.947	1.886719E-14	26	1079.221	0.2271749	4723.034	1417.749	0.001840676	24	253.8588	0.04601312	11263.37	548.0832	6.940937E-15	40	485.8816	0.05186239	12952.09	713.9393	3.134899E-23	28	792.9166	0.05444677	11413.2	662.9518	2.738798E-12	21	667.3505	0.05079747	13784.71	743.0533	1.374545E-12	25	589.2026	0.06883971	9797.809	731.7346	8.05338E-12	31	452.6485	0.04055933	14624.63	622.4681	5.10839E-25	29	551.7417	SMARCA3	SMARCA3_E20_F	21071053	NM_139048.1	SMARCA3	6596	3	36.1	150286987	20	Y	GAGTCCAGTCAGACGTCGACGCCGTCTCCTTCTGCAACAATCTGGGAG	HLTF, ZBU1, HLTF1, RNF80, HIP116, SNF2L3, HIP116A	SNF2-like 3; DNA-binding protein/plasminogen activator inhibitor-1 regulator; sucrose nonfermenting-like 3; helicase-like transcription factor; alternative translation initiation; go_component: nucleus; go_component: ubiquitin ligase complex; go_function: ATP binding; go_function: DNA binding; go_function: zinc ion binding; go_function: helicase activity; go_function: metal ion binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: ubiquitin-protein ligase activity; go_process: transcription; go_process: chromatin modification; go_process: protein ubiquitination; go_process: regulation of transcription, DNA-dependent	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a3
SMARCA3_P109_R	2019	0.04463833	6586.021	312.3978	9.998386E-07	22	273.2392	0.03092517	9454.947	304.918	2.073764E-09	28	458.0671	0.03349192	10959.69	383.2458	8.355903E-14	31	599.8578	0.2544245	264.3706	124.3399	0.8073888	26	13.79834	0.02907387	10398.15	314.3617	3.527287E-12	24	550.4418	0.04438201	9363.315	439.5071	1.28556E-11	28	514.9816	0.05118215	8869.255	483.8292	2.468808E-07	31	535.7609	0.03561165	10431.06	388.877	5.147983E-07	30	594.4031	0.04573089	9053.634	438.6644	1.51429E-09	22	460.106	0.02885856	10659.22	319.7224	1.177992E-12	20	844.7395	SMARCA3	SMARCA3_P109_R	21071053	NM_139048.1	SMARCA3	6596	3	36.1	150287116	-109	Y	AGCACAGAAGGGAGGGCAACTCCGCCCCGCTGCCATTCAAAGACGGCGGG	HLTF, ZBU1, HLTF1, RNF80, HIP116, SNF2L3, HIP116A	SNF2-like 3; DNA-binding protein/plasminogen activator inhibitor-1 regulator; sucrose nonfermenting-like 3; helicase-like transcription factor; alternative translation initiation; go_component: nucleus; go_component: ubiquitin ligase complex; go_function: ATP binding; go_function: DNA binding; go_function: zinc ion binding; go_function: helicase activity; go_function: metal ion binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: ubiquitin-protein ligase activity; go_process: transcription; go_process: chromatin modification; go_process: protein ubiquitination; go_process: regulation of transcription, DNA-dependent	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a3
SMARCA3_P17_R	2021	0.1040409	2494.68	301.3002	0.1374289	32	105.3766	0.1052538	5118.598	613.8914	0.001719743	31	292.9932	0.07391296	5604.861	455.317	0.0005441004	25	423.2062	0.4043779	1410.25	1025.334	0.3176945	21	138.9275	0.09833218	4220.737	471.2018	0.01225835	31	495.7505	0.08863036	5122.925	507.9275	0.0006316323	28	272.319	0.1325774	4698.022	733.3329	0.009542502	23	354.2662	0.1100647	5584.027	702.9848	0.01035878	33	218.1762	0.1273941	4070.335	608.8387	0.01454472	20	189.9715	0.09623265	6555.008	708.6216	1.45679E-05	35	283.2415	SMARCA3	SMARCA3_P17_R	21071053	NM_139048.1	SMARCA3	6596	3	36.1	150287024	-17	Y	CTTCTGCAACAATCTGGGAGACCAGCGTCGCTCTGTGACTGGCACTAGGAAAG	HLTF, ZBU1, HLTF1, RNF80, HIP116, SNF2L3, HIP116A	SNF2-like 3; DNA-binding protein/plasminogen activator inhibitor-1 regulator; sucrose nonfermenting-like 3; helicase-like transcription factor; alternative translation initiation; go_component: nucleus; go_component: ubiquitin ligase complex; go_function: ATP binding; go_function: DNA binding; go_function: zinc ion binding; go_function: helicase activity; go_function: metal ion binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: ubiquitin-protein ligase activity; go_process: transcription; go_process: chromatin modification; go_process: protein ubiquitination; go_process: regulation of transcription, DNA-dependent	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a3
SMARCA4_P362_R	5180	0.03125372	6662.715	218.1789	1.080162E-06	41	214.3653	0.03436191	12147.25	435.8145	9.495857E-16	24	706.0724	0.03768585	13257.42	523.099	9.552689E-21	33	586.8939	0.0256174	6729.928	179.565	0.0003267415	34	245.7737	0.03495685	11709.24	427.7673	9.588845E-16	44	518.0837	0.04396798	10646.37	494.2263	3.808342E-15	31	635.1991	0.04326372	10756.5	490.9321	1.262972E-10	28	844.9338	0.04576225	14825.39	715.7748	1.93875E-14	38	617.5518	0.04721202	8595.539	430.8765	1.293353E-08	26	610.3837	0.03403686	13136.12	466.3905	1.021807E-19	30	525.2601	SMARCA4	SMARCA4_P362_R	21071055	NM_003072.2	SMARCA4	6597	19	36.1	10932244	-362	Y	CGGTCTTGGTCCAGGCGGCCCGTCCTACGGTCCAGGGTTCCTATTTC	BRG1, BAF190, SNF2L4, SNF2LB, hSNF2b, SNF2-BETA	SNF2-like 4; global transcription activator homologous sequence; sucrose nonfermenting-like 4; mitotic growth and transcription activator; BRM/SWI2-related gene 1; homeotic gene regulator; nuclear protein GRB1; brahma protein-like 1; go_component: nucleoplasm; go_function: ATP binding; go_function: DNA binding; go_function: helicase activity; go_function: hydrolase activity; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: helicase activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: regulation of transcription from RNA polymerase II promoter	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4
SMARCB1_P220_R	2354	0.2164316	1094.405	329.9098	0.5526578	21	63.4327	0.6278381	3892.518	6735.389	3.645811E-11	25	729.2006	0.5266531	3290.562	3772.392	2.602809E-05	29	334.9944	0.2219425	352.7907	129.1595	0.7902133	33	19.9232	0.6095321	3753.525	6015.466	4.269833E-10	42	489.449	0.4569607	5135.73	4405.8	5.464459E-11	32	533.1829	0.6342645	3809.444	6779.823	2.115598E-09	32	531.608	0.5809486	5170.389	7306.562	2.834569E-09	26	479.7114	0.471404	2424.496	2251.356	0.01464042	31	319.6406	0.4915819	5650.947	5560.506	3.268419E-13	22	764.6714	SMARCB1	SMARCB1_P220_R	55956799	NM_003073.3	SMARCB1	6598	22	36.1	22458930	-220	Y	CCTCCTTCAGGCCTCACTTCGTTGCTTTTCCCCTGGGCTCAGTTCC	RDT, INI1, SNF5, Snr1, BAF47, Sfh1p, hSNFS, SNF5L1	isoform a is encoded by transcript variant 1; sucrose nonfermenting, yeast, homolog-like 1; integrase interactor 1; malignant rhabdoid tumor suppressor; go_component: nucleoplasm; go_component: nuclear chromosome; go_function: protein binding; go_process: cell cycle; go_process: transcription; go_process: DNA integration; go_process: chromatin remodeling; go_process: negative regulation of progression through cell cycle; go_process: regulation of transcription from RNA polymerase II promoter	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 isoform a
SMO_E57_F	5735	0.0620162	2197.198	151.8827	0.244139	25	57.11494	0.05786559	6809.115	424.3556	2.836379E-05	31	390.2486	0.04792498	7561.796	385.6749	1.102075E-06	28	391.7751	0.05865441	2445.504	158.6081	0.279379	32	97.49176	0.06422331	6811.184	474.3216	1.14765E-05	18	315.0573	0.06354243	7259.646	499.3817	3.151683E-07	32	249.3412	0.05591684	7474.709	448.6403	2.560986E-05	26	285.0658	0.04582414	9553.904	463.6272	4.700506E-06	24	455.5155	0.200842	5334.467	1365.774	8.627534E-05	24	377.648	0.03986965	7670.477	322.6709	1.089147E-06	32	343.3243	SMO	SMO_E57_F	34147561	NM_005631.3	SMO	6608	7	36.1	128616006	57	Y	TTGGGGAGTCGTGCATCCCGTTCCGGGCCTCCGCAGCCCAACATGGGC	Gx, SMOH	seven transmembrane helix receptor; go_component: membrane; go_component: membrane fraction; go_component: integral to membrane; go_function: protein binding; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: non-G-protein coupled 7TM receptor activity; go_process: development; go_process: G-protein coupled receptor protein signaling pathway	smoothened
SMO_P455_R	5241	0.07225235	6197.229	490.4239	2.493062E-06	29	168.2852	0.1766415	7999.691	1737.69	2.290527E-09	29	565.4334	0.1124783	11575.46	1479.667	1.609549E-18	33	665.7772	0.02337576	8532.166	206.6132	2.033064E-06	25	360.8665	0.08495363	9997.272	937.4387	1.058376E-12	22	463.7172	0.178382	8957.546	1966.49	1.539028E-14	30	634.3264	0.073875	10568.16	850.976	5.860047E-11	32	490.3965	0.09013592	12336.65	1232.04	5.751136E-11	22	794.2682	0.1325184	7704.57	1192.243	2.295965E-08	33	511.8	0.1311726	10468.6	1595.612	2.277302E-15	39	770.9681	SMO	SMO_P455_R	34147561	NM_005631.3	SMO	6608	7	36.1	128615494	-455	Y	CCGAGTCTCTCCTTGCAGGTCCGGCCCACGATTTCCACTCATCTC	Gx, SMOH	seven transmembrane helix receptor; go_component: membrane; go_component: membrane fraction; go_component: integral to membrane; go_function: protein binding; go_function: receptor activity; go_function: G-protein coupled receptor activity; go_function: non-G-protein coupled 7TM receptor activity; go_process: development; go_process: G-protein coupled receptor protein signaling pathway	smoothened
SNCG_E119_F	3934	0.2128209	2297.338	648.1418	0.1102152	27	105.538	0.816841	1934.558	9073.595	5.480821E-12	31	425.2313	0.8203021	2091.143	10002.34	8.878427E-16	16	491.7377	0.1738713	744.3602	177.7084	0.6979467	26	49.97582	0.8407575	1693.187	9467.547	3.021274E-13	33	446.84	0.8329715	1730.661	9129.513	2.309357E-14	27	514.025	0.8162693	1848.473	8656.58	2.991205E-09	30	405.3593	0.8559462	1879.502	11761.91	4.377404E-11	26	407.8192	0.8402449	1606.894	8977.55	5.996282E-12	25	535.0805	0.8328001	1643.408	8683.678	3.638218E-11	26	360.9401	SNCG	SNCG_E119_F	4507112	NM_003087.1	SNCG	6623	10	36.1	88708514	119	N	GGAAAAGACCAAGCAGGGGGTGACGGAAGCAGCTGAGAAGACCAAGGAG	SR, BCSG1	breast cancer-specific protein 1; persyn; synuclein, gamma (breast cancer-specific gene 1); synoretin; go_component: cytoplasm	synuclein, gamma (breast cancer-specific protein 1)
SNCG_P53_F	2022	0.2013301	3941.509	1018.79	0.001248281	28	238.7169	0.819353	1736.324	8328.94	5.234848E-10	31	456.4022	0.7864743	2596.083	9930.424	5.538797E-17	33	389.1697	0.07061229	3155.384	247.335	0.1338308	28	190.0804	0.8386177	1742.433	9574.146	1.251271E-13	22	575.3383	0.9009418	1080.454	10736.32	3.971501E-17	20	610.4347	0.7644244	2300.679	7790.02	1.568384E-08	25	473.6899	0.8808531	1549.248	12192.88	2.991133E-11	27	606.5638	0.868246	1391.668	9829.945	1.714963E-13	20	811.5503	0.7782615	1979.021	7296.985	5.522853E-09	21	369.5949	SNCG	SNCG_P53_F	4507112	NM_003087.1	SNCG	6623	10	36.1	88708342	-53	Y	CGTCAATAGGAGGCATCGGGGACAGCCGCTGCGGCAGCACTCGAGCCAGCTCAAG	SR, BCSG1	breast cancer-specific protein 1; persyn; synuclein, gamma (breast cancer-specific gene 1); synoretin; go_component: cytoplasm	synuclein, gamma (breast cancer-specific protein 1)
SNCG_P98_R	2024	0.4159939	4858.502	3531.995	5.828249E-10	35	351.4291	0.7380401	5422.378	15558.63	3.678E-38	28	970.1724	0.7405819	6534.586	18940.29	3.678E-38	25	1049.717	0.2707063	5232.589	1979.402	0.0001550189	26	268.4038	0.7601504	5335.432	17226.4	3.678E-38	30	1064.428	0.7661622	5341.435	17828.7	3.678E-38	30	1112.046	0.7109672	6393.781	15973.5	3.678E-38	30	891.8644	0.7958774	5823.882	23097.31	3.678E-38	19	891.9252	0.7740769	3272.891	11556.49	3.217864E-24	21	1266.507	0.7229285	6060.678	16074.3	3.678E-38	33	777.6902	SNCG	SNCG_P98_R	4507112	NM_003087.1	SNCG	6623	10	36.1	88708297	-98	Y	GCTGGCTGGGCTCCAGCTGGCCTCCGCATCAATATTTCATCGGCGTCAATAGGA	SR, BCSG1	breast cancer-specific protein 1; persyn; synuclein, gamma (breast cancer-specific gene 1); synoretin; go_component: cytoplasm	synuclein, gamma (breast cancer-specific protein 1)
SNRPN_E14_F	3936	0.5741175	2217.069	3123.56	0.0003852058	21	204.3205	0.8763668	1910.878	14253.99	1.979233E-26	31	1209.701	0.8910876	2115.615	18127.48	3.678E-38	24	1849.95	0.7853836	501.2859	2200.391	0.2582738	28	144.727	0.882503	1757.196	13949.13	6.46622E-27	21	1048.576	0.8818102	1902.409	14939.91	4.701669E-36	31	844.3893	0.892159	1978.626	17196.29	3.469645E-32	28	1073.048	0.873683	2977.57	21286.3	3.095872E-36	24	909.4619	0.8897055	1489.588	12822.62	1.791362E-22	28	763.6161	0.8815241	2497.777	19328.84	3.678E-38	38	889.5676	SNRPN	SNRPN_E14_F	29540553	NM_022806.2	SNRPN	6638	15	36.1	22619901	14	N	GCTGCAGACCACGCCCACCAAGGGCTGGCCGCAGCCACTGTAGCTGAGCTCAGAGCCT	SMN, SM-D, RT-LI, HCERN3, SNRNP-N, SNURF-SNRPN	tissue-specific splicing protein; SM protein N; small nuclear ribonucleoprotein N; go_component: nucleus; go_component: ribonucleoprotein complex; go_component: small nucleolar ribonucleoprotein complex; go_function: RNA binding; go_process: mRNA processing	small nuclear ribonucleoprotein polypeptide N
SNRPN_P230_R	2029	0.6896017	2897.932	6660.408	5.130881E-13	25	476.2407	0.9409313	929.873	16405.31	1.457799E-30	26	1131.134	0.9490598	899.3796	18619.33	3.678E-38	32	848.7152	0.8013384	975.8318	4339.567	0.009065754	23	264.946	0.9482809	804.0327	16575.65	2.93774E-33	31	825.8425	0.935486	988.8008	15788.16	9.247208E-36	29	1229.095	0.9515114	811.3488	17883.77	1.603794E-30	24	1475.788	0.9567789	847.4399	20973.32	4.561645E-29	38	701.2311	0.932283	627.9288	10021.65	4.215941E-12	23	581.6324	0.9592871	795.3074	21095.44	3.678E-38	22	985.5903	SNRPN	SNRPN_P230_R	29540553	NM_022806.2	SNRPN	6638	15	36.1	22619657	-230	N	TCTCTTGAATCTTGACAATCCCCGAACACTGCTCCCCGCTTTATTTGTTTAGTC	SMN, SM-D, RT-LI, HCERN3, SNRNP-N, SNURF-SNRPN	tissue-specific splicing protein; SM protein N; small nuclear ribonucleoprotein N; go_component: nucleus; go_component: ribonucleoprotein complex; go_component: small nucleolar ribonucleoprotein complex; go_function: RNA binding; go_process: mRNA processing	small nuclear ribonucleoprotein polypeptide N
SNRPN_seq_12_S127_F	6123	0.08655506	5528.412	533.33	3.077468E-05	28	297.1844	0.6970547	5074.264	11905.6	2.831285E-29	23	1153.938	0.7142074	5145.415	13108.5	1.681855E-37	34	662.2023	0.3351457	3521.951	1825.785	0.008559779	28	163.4366	0.6959947	4508.324	10550.37	1.190492E-24	32	1027.118	0.6603321	5226.44	10354.88	1.313393E-30	31	843.2457	0.6738158	4494.659	9491.427	1.203187E-16	24	975.355	0.7094432	5411.813	13458.02	1.632519E-21	29	769.5721	0.6174214	3855.145	6382.979	3.740396E-11	32	764.7315	0.7151902	5639.255	14411.93	3.678E-38	26	850.1599	SNRPN	SNRPN_seq_12_S127_F	29540557	NM_005678.3	SNURF	8926	15	36.1	22751217	-11	Y	GTGTGCGAAGCCTGCCGCTGCTGCAGCGAGTCTGGCGCAGAGTGGAGCG	.	go_component: nucleus; go_function: molecular function unknown; go_process: biological process unknown	SNRPN upstream reading frame protein
SNRPN_seq_18_S99_F	6124	0.5992172	1179.54	1913.062	0.08743782	29	214.6706	0.8799935	1397.767	10982.95	3.10944E-15	33	946.9047	0.893809	1514.898	13592.58	3.577006E-25	38	765.6227	0.395503	2555.413	1737.351	0.04530279	37	160.7921	0.8718345	1306.669	9568.738	1.463461E-12	36	827.095	0.8635432	1900.208	12657.97	1.561862E-26	26	622.6584	0.8568794	2052.507	12887.3	4.273229E-19	27	1003.983	0.8813616	2080.705	16200.4	3.763064E-20	32	870.4593	0.8642374	1246.104	8569.028	3.177208E-10	24	1076.564	0.8896499	1601.073	13714.16	2.979104E-25	29	721.2355	SNRPN	SNRPN_seq_18_S99_F	29540557	NM_005678.3	SNURF	8926	15	36.1	22751285	57	Y	CCGGCACAGCTGACCTTGCCCGCTCCATCGCGTCACTGACCGCTCCTCAGACAGATGCG	.	go_component: nucleus; go_function: molecular function unknown; go_process: biological process unknown	SNRPN upstream reading frame protein
SNURF_E256_R	3937	0.2154564	1823.33	528.1973	0.2434544	30	81.70038	0.8417688	1918.195	10736.53	6.20663E-16	27	824.0288	0.8441378	2253.792	12747.96	8.374892E-25	26	757.2133	0.05400127	2475.313	147.0088	0.2753773	22	131.7872	0.8218658	2097.375	10138.13	5.205485E-16	23	465.6001	0.8302752	2106.684	10794.85	1.382083E-20	29	584.1496	0.8539939	1901.854	11708.9	9.869105E-16	33	575.316	0.8322357	2391.026	12357.34	5.588706E-13	26	592.1358	0.8432906	1680.314	9580.299	1.368877E-13	28	654.329	0.8254068	2488.49	12237.35	2.89469E-23	21	779.7733	SNURF	SNURF_E256_R	29540557	NM_005678.3	SNURF	8926	15	36.1	22751484	256	Y	AGGCTTGCTGTTGTGCCGTTCTGCCCCGATGGTATCCTGTCCGCTCGCATTGGGGCG	.	go_component: nucleus; go_function: molecular function unknown; go_process: biological process unknown	SNRPN upstream reading frame protein
SNURF_P2_R	2037	0.262156	5488.274	1985.514	6.937437E-08	30	292.8005	0.650129	4387.195	8338.087	4.072359E-16	27	805.7689	0.6027161	6229.757	9602.821	8.734245E-28	25	668.1586	0.03381283	5150.863	183.76	0.008761888	40	221.0199	0.6442533	4770.365	8820.177	6.596148E-20	27	587.0649	0.6173706	5521.755	9070.674	1.153959E-26	34	639.0519	0.596172	5695.504	8555.912	2.613307E-17	23	490.1688	0.6594501	5781.52	11389.14	1.035998E-17	31	710.6632	0.6182601	3796.221	6310.261	7.362313E-11	33	560.5844	0.6003735	6233.912	9515.668	8.99146E-27	36	525.5175	SNURF	SNURF_P2_R	29540557	NM_005678.3	SNURF	8926	15	36.1	22751226	-2	Y	AGCCTGCCGCTGCTGCAGCGAGTCTGGCGCAGAGTGGAGCGGCCGCCGGAGATGCC	.	go_component: nucleus; go_function: molecular function unknown; go_process: biological process unknown	SNRPN upstream reading frame protein
SNURF_P78_F	2035	0.2206397	4979.207	1437.942	7.662346E-06	30	271.0052	0.7791633	3315.366	12050.21	8.646728E-24	27	789.5621	0.8113716	3527.645	15604.06	3.678E-38	24	810.7282	0.3100418	444.2731	244.5763	0.7490376	26	27.93957	0.8184779	2913.736	13588.84	7.59854E-30	26	1042.214	0.7656258	3534.599	11873.07	6.787632E-30	35	860.5488	0.775624	2977.488	10638.28	9.599814E-16	28	934.4723	0.815353	3246.672	14778.03	1.425691E-19	25	1046.549	0.7176413	3135.226	8222.634	7.772452E-14	30	858.0641	0.8188047	3508.572	16306.8	3.678E-38	23	956.9028	SNURF	SNURF_P78_F	29540557	NM_005678.3	SNURF	8926	15	36.1	22751150	-78	Y	CCTGCACTGCGGCAAACAAGCACGCCTGCGCGGCCGCAGAGGCAGGCTGGCG	.	go_component: nucleus; go_function: molecular function unknown; go_process: biological process unknown	SNRPN upstream reading frame protein
SOD3_P225_F	2044	0.5447199	667.9067	918.7622	0.4949992	32	44.29713	0.9237149	903.376	12149.61	5.557414E-17	33	553.7847	0.9259722	846.782	11842.76	1.893205E-17	24	557.6767	0.2790425	300.0486	154.8365	0.7952895	24	19.27462	0.9052161	969.7532	10216.48	2.617971E-13	20	612.6174	0.9097201	908.2498	10159.79	6.101788E-15	30	422.0911	0.9282294	832.7664	12063.73	4.523857E-14	24	520.9545	0.9226267	854.9369	11387.01	6.245901E-09	28	529.0306	0.9141124	780.9945	9376.53	5.669078E-11	23	447.8584	0.9379953	735.528	12639.7	4.88541E-19	20	682.1893	SOD3	SOD3_P225_F	4507150	NM_003102.1	SOD3	6649	4	36.1	24404928	-225	N	CTCTGAAAACTCATTAGTTGAGGATAACTACGCCTACCAACAGAATGCAGAGGTGCAAG	EC-SOD	extracellular superoxide dismutase; extracellular superoxide dismutase, EC-SOD; go_component: soluble fraction; go_component: extracellular matrix (sensu Metazoa); go_function: heparin binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: antioxidant activity; go_function: oxidoreductase activity; go_function: copper, zinc superoxide dismutase activity; go_process: superoxide metabolism	superoxide dismutase 3, extracellular
SOD3_P460_R	2043	0.2962095	4920.872	2113.171	5.454633E-07	27	339.0303	0.7673473	3231.676	10988.71	2.900356E-20	27	607.4402	0.7660521	3536.3	11906.91	2.296172E-26	36	660.3419	0.03078379	4092.515	133.1607	0.04965467	25	178.7193	0.6982003	3201.63	7638.177	1.776011E-12	33	830.8214	0.8182681	2345.098	11009.32	3.933101E-22	27	877.9895	0.8061904	2388.269	10350.46	1.020206E-13	29	846.2908	0.7628781	3762.41	12426.3	1.07403E-15	27	676.6236	0.7483594	2499.797	7731.593	3.873215E-11	29	514.4022	0.804486	2630.567	11235.53	1.603865E-20	17	810.5907	SOD3	SOD3_P460_R	4507150	NM_003102.1	SOD3	6649	4	36.1	24404693	-460	N	TAGCACAAGTCCTAGAATACCAGAACGGAGACGTGCTTTCTTGGACCTTAAACGAAA	EC-SOD	extracellular superoxide dismutase; extracellular superoxide dismutase, EC-SOD; go_component: soluble fraction; go_component: extracellular matrix (sensu Metazoa); go_function: heparin binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: copper ion binding; go_function: antioxidant activity; go_function: oxidoreductase activity; go_function: copper, zinc superoxide dismutase activity; go_process: superoxide metabolism	superoxide dismutase 3, extracellular
SOX1_P1018_R	5941	0.1516304	3352.655	617.0986	0.01619217	26	182.3283	0.0574834	7677.823	474.3637	1.303374E-06	23	356.6023	0.05152666	9407.407	516.4984	1.806256E-10	31	414.1765	0.1684853	1704.029	365.5406	0.4074537	36	128.0022	0.08593061	6837.399	652.1769	5.661829E-06	29	769.4493	0.1096378	9181.271	1142.881	6.251616E-13	25	393.8092	0.0612491	9903.176	652.6604	2.428354E-09	32	497.4319	0.08285232	11537.72	1051.316	1.932804E-09	17	404.2029	0.0979642	6762.955	745.3406	5.790241E-06	23	378.0617	0.1051429	10487.6	1244.009	1.660176E-14	28	422.086	SOX1	SOX1_P1018_R	30179899	NM_005986.2	SOX1	6656	13	36.1	111768896	-1018	Y	CACGACGATCCTTTCTTAGTCTTCGCTTTTCAACCCAATCGTTAATCATT	.	SRY-related HMG-box gene 1; go_component: nucleus; go_function: DNA binding; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: establishment and/or maintenance of chromatin architecture	SRY (sex determining region Y)-box 1
SOX1_P294_F	5935	0.3545351	3089.892	1752.115	0.001760419	25	147.3306	0.1988032	7480.174	1880.89	1.162841E-08	36	404.7832	0.1019123	10057.38	1152.629	1.804585E-13	31	529.7059	0.1165405	2888.311	394.1996	0.1515933	24	120.9957	0.1585888	7569.222	1445.492	1.369384E-08	35	370.9966	0.1896926	7774.227	1843.353	3.603105E-11	27	535.0451	0.1590184	8922.021	1705.944	1.802365E-09	20	625.4734	0.1774195	9634.985	2099.705	3.240104E-08	22	588.3273	0.1375518	7215.682	1166.777	2.031652E-07	26	459.8153	0.1160743	8166.98	1085.593	6.133326E-09	29	386.7874	SOX1	SOX1_P294_F	30179899	NM_005986.2	SOX1	6656	13	36.1	111769620	-294	Y	GGGCCGGGCCCAGCGCACCGCTCCCGGCCCCAAAAGCGGAGCTGCAACTT	.	SRY-related HMG-box gene 1; go_component: nucleus; go_function: DNA binding; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: establishment and/or maintenance of chromatin architecture	SRY (sex determining region Y)-box 1
SOX17_P287_R	5958	0.2052692	1768.119	482.5123	0.2725309	41	68.29025	0.405515	4357.567	3040.632	1.685757E-05	33	528.0738	0.3111755	5980.013	2746.637	4.663392E-08	30	408.8063	0.04151497	3056.54	136.7196	0.1657525	31	116.2771	0.3181338	5080.512	2417.037	5.505054E-06	23	321.192	0.4956762	4381.922	4405.071	2.763124E-09	22	384.3243	0.2970297	5332.041	2295.229	5.971438E-05	35	423.0435	0.3152377	6049.765	2831.111	7.673165E-05	33	374.2485	0.3548685	4744.357	2664.743	8.233031E-06	34	269.138	0.2781303	6650.94	2601.08	6.148523E-09	40	265.3636	SOX17	SOX17_P287_R	31077196	NM_022454.2	SOX17	64321	8	36.1	55532761	-287	Y	TTCATCTAAACGACCTTGGGCAAGTACGTCGATTCCAAGGTACAATCAGCCC	FLJ22252	SRY-related HMG-box transcription factor SOX17; go_component: nucleus; go_function: DNA binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	SRY-box 17
SOX17_P303_F	5943	0.4207254	3900.44	2905.507	1.499156E-06	24	282.9138	0.2316616	7457.324	2278.608	2.305235E-09	25	374.5817	0.1913176	7434.189	1782.433	5.319948E-09	28	271.6801	0.3425519	4582.869	2439.928	0.0002481999	26	312.2291	0.2106059	6592.466	1785.512	1.988005E-07	30	345.9529	0.3227781	6393.877	3095.118	7.269706E-11	27	379.756	0.198647	7464.508	1875.162	2.589782E-07	22	373.9703	0.22973	7388.384	2233.381	1.300245E-05	29	579.6335	0.2314982	6432.049	1967.669	1.893086E-07	36	382.2798	0.1741864	7876.244	1682.406	1.521725E-09	37	361.7839	SOX17	SOX17_P303_F	31077196	NM_022454.2	SOX17	64321	8	36.1	55532745	-303	Y	GAATGGACGCTCGGTATGTTCATCTAAACGACCTTGGGCAAGTACGTCGATTC	FLJ22252	SRY-related HMG-box transcription factor SOX17; go_component: nucleus; go_function: DNA binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	SRY-box 17
SOX2_P546_F	5959	0.1131158	4069.979	531.851	0.003427505	37	171.2307	0.1321552	8424.369	1298.089	2.446413E-09	21	568.3915	0.0862264	11472.11	1091.979	4.330589E-17	25	961.9362	0.2732163	380.008	180.4471	0.7750775	25	24.76628	0.09935877	9404.362	1048.522	1.389061E-11	27	571.0475	0.2152884	7781.479	2162.311	5.778496E-12	37	609.6417	0.1185681	9773.503	1328.16	2.398343E-10	25	524.3761	0.1445241	10819.19	1844.688	1.493478E-09	21	1079.155	0.1588883	6483.592	1243.659	2.609036E-06	33	328.5159	0.08262847	11123.82	1010.939	1.482158E-15	28	380.9466	SOX2	SOX2_P546_F	29826338	NM_003106.2	SOX2	6657	3	36.1	182911870	-546	Y	AAGGTAAGAGAGGAGAGCGGAAGAGCGCAGTACGGGAGCGGCACCAGAGG	ANOP3, MGC2413	transcription factor SOX2; SRY-related HMG-box gene 2; go_component: nucleus; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: establishment and/or maintenance of chromatin architecture	sex-determining region Y-box 2
SPARC_E50_R	1222	0.7722923	4214.682	14633.66	3.678E-38	32	970.3259	0.1262852	15795.47	2297.504	2.081339E-33	34	1369.818	0.1057777	18268.54	2172.817	3.678E-38	31	1173.939	0.4726815	5310.856	4850.222	1.507364E-08	44	431.5035	0.14148	15613.48	2589.508	1.223903E-36	41	740.0157	0.1844437	14553.5	3313.991	3.678E-38	37	900.911	0.1323917	15404.55	2365.899	1.916205E-27	29	1392.097	0.145073	18730.49	3195.356	2.33266E-29	27	1326.304	0.1458097	10801.6	1860.896	2.269429E-17	36	968.6224	0.09379389	20618.13	2144.363	3.678E-38	36	807.954	SPARC	SPARC_E50_R	48675809	NM_003118.2	SPARC	6678	5	36.1	151046660	50	Y	GGCAGGCGGCAGGCAGAGCGCGCTCTCCGGGCAGTCTGAAGGACCGCG	ON	Osteonectin (secreted protein, acidic, cysteine-rich); osteonectin; cysteine-rich protein; go_component: basement membrane; go_function: copper ion binding; go_function: calcium ion binding; go_function: collagen binding; go_function: calcium ion binding; go_process: ossification; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	secreted protein, acidic, cysteine-rich (osteonectin)
SPARC_P195_F	5009	0.08280376	3419.896	317.7734	0.02665018	34	124.4925	0.326701	8370.323	4110.007	1.738846E-15	26	568.3948	0.3345013	10416.6	5285.984	2.627976E-27	22	925.251	0.1729446	3734.892	801.9095	0.03199369	25	277.6432	0.3321967	7724.94	3892.492	2.193427E-14	32	1031.811	0.3845695	8555.408	5408.582	2.625449E-24	27	696.775	0.2507919	8648.469	2928.486	2.858843E-11	35	699.2016	0.3115586	10509.04	4801.188	5.268362E-14	27	739.8108	0.3065626	7738.987	3465.548	1.892339E-13	23	522.9539	0.3264784	10815.28	5290.998	4.677971E-28	29	808.5924	SPARC	SPARC_P195_F	48675809	NM_003118.2	SPARC	6678	5	36.1	151046905	-195	N	ACCCTGCCTGCCTCATCTGTTCCGGGGCTGCTGCCTAAACCGACTCACAGAG	ON	Osteonectin (secreted protein, acidic, cysteine-rich); osteonectin; cysteine-rich protein; go_component: basement membrane; go_function: copper ion binding; go_function: calcium ion binding; go_function: collagen binding; go_function: calcium ion binding; go_process: ossification; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	secreted protein, acidic, cysteine-rich (osteonectin)
SPDEF_E116_R	3942	0.1258187	6394.412	934.7239	1.38975E-07	30	249.546	0.594295	2981.532	4513.967	1.231627E-05	28	233.3208	0.6016318	3113.54	4853.219	1.023454E-06	37	259.971	0.1570321	2382.192	462.3946	0.2289209	27	142.4439	0.6209961	2716.746	4615.225	9.791135E-06	30	279.136	0.4813306	4229.677	4017.985	3.618915E-08	30	269.0064	0.5862043	3451.684	5031.5	4.641393E-06	44	269.9324	0.548229	4068.341	5058.327	4.338269E-05	30	226.7202	0.5450615	3235.071	3995.747	1.527782E-05	27	476.8966	0.56512	2811.711	3783.725	0.0001208915	27	211.0376	SPDEF	SPDEF_E116_R	6912579	NM_012391.1	SPDEF	25803	6	36.1	34631953	116	N	CCCAGCCCAGGGCTGCCTGCTGGCACCGTGGCAAGGCCCAACCTGAGGG	PDEF, bA375E1.3, RP11-375E1__A.3	prostate epithelium-specific Ets transcription factor; go_component: nucleus; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	SAM pointed domain containing ets transcription factor
SPDEF_P6_R	2048	0.2893665	1689.447	728.6541	0.2252276	32	87.82603	0.8209736	2613.859	12445.13	8.135937E-23	28	1276.172	0.8120938	3642.496	16174.33	3.678E-38	21	811.8875	0.1314711	693.1659	120.0632	0.7223671	23	29.92841	0.7547142	3317.641	10515.66	1.181375E-20	27	1044.949	0.7396736	3701.477	10801.26	2.545032E-26	26	1129.652	0.7460594	3594.228	10853.38	8.274863E-18	31	1107.1	0.7038966	5114.878	12396.8	1.924005E-18	29	819.8818	0.6882144	2791.243	6381.932	6.672404E-09	20	697.7214	0.806205	3450.154	14768.97	2.584574E-36	29	1021.496	SPDEF	SPDEF_P6_R	6912579	NM_012391.1	SPDEF	25803	6	36.1	34632075	-6	N	TGTGCTGGGAGGAAGTCAGACAGCCGCGAGATGAAGAGTTGGCCAGGGC	PDEF, bA375E1.3, RP11-375E1__A.3	prostate epithelium-specific Ets transcription factor; go_component: nucleus; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_process: transcription; go_process: development; go_process: regulation of transcription, DNA-dependent	SAM pointed domain containing ets transcription factor
SPI1_E205_F	1229	0.4928403	3097.285	3107.012	1.782407E-05	31	286.3238	0.6440142	3678.459	6835.616	6.3347E-11	29	820.7018	0.6205922	5078.274	8470.032	5.102036E-20	33	592.8433	0.9393867	657.2237	11735.47	1.245968E-12	30	811.6423	0.5741044	4335.454	5978.963	2.840075E-11	30	768.5165	0.6052228	5033.211	7869.595	1.368606E-20	38	611.5658	0.51345	6202.49	6650.938	5.65488E-14	27	686.5862	0.5412598	7159.506	8565.367	8.64795E-15	31	561.3257	0.6316836	4144.632	7279.787	5.259074E-14	26	782.0806	0.6235674	5222.081	8816.124	4.685138E-21	33	493.332	SPI1	SPI1_E205_F	4507174	NM_003120.1	SPI1	6688	11	36.1	47356469	205	Y	GGGAAACCCTTCCATTTTGCACGCCTGTAACATCCAGCCGGGCTCCGA	OF, PU.1, SFPI1, SPI-A	Oncogene SPI1; go_component: nucleus; go_function: RNA binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	spleen focus forming virus (SFFV) proviral integration oncogene spi1
SPI1_P48_F	5208	0.03178477	29917.17	985.4101	3.678E-38	22	748.9273	0.8111244	2318.269	10385.24	4.639207E-16	37	588.8497	0.7956253	2958.099	11905.1	2.527986E-24	42	592.3218	0.495166	12996.02	12845.21	3.678E-38	17	2802.518	0.7400349	2259.064	6715.477	1.632265E-08	35	802.3409	0.7932776	2488.247	9932.152	5.211472E-19	24	1080.895	0.6835343	3239.266	7212.482	3.718142E-09	39	504.9922	0.7205518	3841.462	10162.98	1.092964E-11	24	500.7854	0.7846161	1926.845	7383.538	3.552709E-09	34	542.0192	0.7805291	3154.465	11574.22	2.832876E-23	30	695.5183	SPI1	SPI1_P48_F	4507174	NM_003120.1	SPI1	6688	11	36.1	47356722	-48	N	GTCCCCTTGGGGTGACATCACCGCCCCAACCCGTTTGCATAAATCTC	OF, PU.1, SFPI1, SPI-A	Oncogene SPI1; go_component: nucleus; go_function: RNA binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	spleen focus forming virus (SFFV) proviral integration oncogene spi1
SPI1_P929_F	5021	0.8858954	1366.646	11386.87	9.519951E-24	19	630.6072	0.8483061	2530.106	14708.13	3.296678E-30	31	1013.425	0.8815354	2260.522	17565.45	3.678E-38	26	936.2536	0.895403	788.8711	7609.185	5.811313E-06	24	339.7225	0.8542313	2208.647	13529.09	4.989694E-27	22	799.0328	0.834295	2937.236	15291.94	3.678E-38	28	1086.197	0.858458	2720.901	17108.88	1.559179E-34	27	813.6332	0.8665324	2859.28	19213	9.107992E-30	24	1133.045	0.8383902	2277.936	12336.12	1.749111E-23	30	1049.416	0.9062848	1875.891	19108.1	3.678E-38	33	995.2417	SPI1	SPI1_P929_F	4507174	NM_003120.1	SPI1	6688	11	36.1	47357603	-929	N	CATCTATATGTCCATTAATCAGCCCGTCCACCTGCTATCAGTCCATCAGTC	OF, PU.1, SFPI1, SPI-A	Oncogene SPI1; go_component: nucleus; go_function: RNA binding; go_function: protein binding; go_function: sequence-specific DNA binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of transcription from RNA polymerase II promoter	spleen focus forming virus (SFFV) proviral integration oncogene spi1
SPP1_E140_R	1241	0.03735022	6837.276	269.1621	3.924421E-07	26	302.7567	0.068569	11774.78	874.1838	6.422992E-16	24	661.9127	0.09213087	12721.79	1301.159	1.605246E-21	15	592.0199	0.03115447	5605.145	183.4563	0.003755757	27	317.7302	0.1252842	10112.37	1462.703	2.811666E-14	24	523.9861	0.1082911	9982.674	1224.463	2.463949E-15	27	757.5771	0.09068767	10082.28	1015.5	2.439356E-10	24	887.9226	0.09068701	11574.76	1164.34	1.150444E-09	18	393.2603	0.1036502	8808.543	1030.147	2.828204E-10	22	994.3171	0.09612872	13302.69	1425.406	2.845521E-23	18	412.0231	SPP1	SPP1_E140_R	38146097	NM_000582.2	SPP1	6696	4	36.1	89115966	140	N	AGTTGCAGCCTTCTCAGCCAAACGCCGACCAAGGTACAGCTTCAGTTTGCTACT	OPN, BNSP, BSPI, ETA-1, MGC110940	Secreted phosphoprotein-1 (osteopontin, bone sialoprotein); go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: integrin binding; go_function: cytokine activity; go_function: growth factor activity; go_process: ossification; go_process: cell adhesion; go_process: anti-apoptosis; go_process: ossification; go_process: cell-matrix adhesion; go_process: cell-cell signaling; go_process: immune cell chemotaxis; go_process: T-helper 1 type immune response; go_process: induction of positive chemotaxis; go_process: negative regulation of bone mineralization; go_process: regulation of myeloid cell differentiation; go_process: positive regulation of T cell proliferation	secreted phosphoprotein 1
SPP1_P647_F	5214	0.3725523	4672.985	2834	5.901517E-08	24	281.115	0.5538413	5497.617	6948.629	2.1227E-15	31	785.9324	0.5798471	6817.714	9547.04	8.647764E-30	32	1543.077	0.3583165	4010.944	2295.554	0.001293692	26	196.7808	0.5968549	5241.296	7907.771	1.379216E-18	26	857.4685	0.6426013	5367.158	9829.923	4.840785E-29	30	910.1978	0.5968657	6326.187	9514.372	1.410288E-21	23	629.6687	0.5407886	8216.113	9793.44	1.541393E-19	31	902.5714	0.6037447	4676.806	7278.063	2.127444E-15	23	520.8723	0.6274924	6952.617	11880.2	3.678E-38	26	1047.854	SPP1	SPP1_P647_F	38146097	NM_000582.2	SPP1	6696	4	36.1	89115179	-647	N	GGGAACAAGGATAGGTAGGCTGGGCGATTTGCCCAAGGTTGCACAGGTCAGCA	OPN, BNSP, BSPI, ETA-1, MGC110940	Secreted phosphoprotein-1 (osteopontin, bone sialoprotein); go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: integrin binding; go_function: cytokine activity; go_function: growth factor activity; go_process: ossification; go_process: cell adhesion; go_process: anti-apoptosis; go_process: ossification; go_process: cell-matrix adhesion; go_process: cell-cell signaling; go_process: immune cell chemotaxis; go_process: T-helper 1 type immune response; go_process: induction of positive chemotaxis; go_process: negative regulation of bone mineralization; go_process: regulation of myeloid cell differentiation; go_process: positive regulation of T cell proliferation	secreted phosphoprotein 1
SRC_E100_R	1746	0.2779739	3667.121	1450.31	0.0007780743	29	188.0915	0.9299874	936.9217	13773.58	9.786943E-22	31	971.7463	0.923924	1243.556	16317.15	1.456827E-34	32	847.0099	0.2174154	4649.038	1319.364	0.002625697	38	189.6042	0.9113614	1077.524	12107.03	1.084728E-18	26	756.6764	0.9041901	1449.874	14626.67	1.084779E-32	34	801.6899	0.9148274	1324.332	15298.56	7.269971E-24	34	746.8216	0.9240595	1467.22	19070.26	1.237085E-25	31	1303.075	0.8885188	1196.257	10331.33	2.855536E-14	28	663.5477	0.9163873	1243.645	14726.23	1.461316E-27	37	616.1766	SRC	SRC_E100_R	38202216	NM_198291.1	SRC	6714	20	36.1	35406602	100	N	CCTCTAGCCTCAGTTTATCACCGCAAGAGCTACCATTCATCTAGCACAACC	ASV, SRC1, c-SRC, p60-Src	v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog; protooncogene SRC, Rous sarcoma; tyrosine-protein kinase SRC-1; tyrosine kinase pp60c-src; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: SH2 domain binding; go_function: SH3/SH2 adaptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: protein kinase cascade; go_process: signal complex formation; go_process: protein amino acid phosphorylation	proto-oncogene tyrosine-protein kinase SRC
SRC_P164_F	6034	0.7903588	2168.372	8551.887	1.624649E-16	32	729.1704	0.8982707	1342.087	12733.63	7.695909E-20	34	919.5916	0.9106982	1215.522	13415.67	1.566675E-23	17	758.2763	0.7886556	1329.759	5335.31	0.0005809125	40	438.9911	0.9003837	1129.781	11115.39	4.900873E-16	32	636.0298	0.9085414	1129.193	12210.69	4.418436E-22	20	722.3282	0.9018499	1364.907	13460.26	8.607421E-19	27	596.0831	0.907666	1516.721	15892.77	3.198724E-18	32	810.8115	0.8842209	1185.403	9816.803	5.992965E-13	37	781.6183	0.8950142	1424.154	12993.56	2.924862E-22	33	536.7168	SRC	SRC_P164_F	38202216	NM_198291.1	SRC	6714	20	36.1	35406338	-164	N	TTCTTGCAAGTAGGTAAGGGCCAGCTCCAGCGTGTCACTGGGTAAATGTCCCTG	ASV, SRC1, c-SRC, p60-Src	v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog; protooncogene SRC, Rous sarcoma; tyrosine-protein kinase SRC-1; tyrosine kinase pp60c-src; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: SH2 domain binding; go_function: SH3/SH2 adaptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: protein kinase cascade; go_process: signal complex formation; go_process: protein amino acid phosphorylation	proto-oncogene tyrosine-protein kinase SRC
SRC_P297_F	6030	0.8525624	445.4701	3154.197	0.03520213	37	120.4719	0.9684544	423.8094	16081.03	1.344711E-27	33	1133.358	0.9713065	424.4264	17752.41	3.619399E-37	31	1442.657	0.2342489	294.938	120.8145	0.8024982	20	20.82602	0.962322	387.9774	12463.27	1.006213E-17	27	1389.765	0.9698539	444.8445	17528.64	3.678E-38	30	1054.289	0.9677397	427.5953	15826.71	9.010368E-23	27	1046.126	0.9652775	499.8729	16676.32	1.008368E-17	25	1062.639	0.9449724	591.0359	11866.95	8.693069E-17	36	646.0877	0.9663563	441.9393	15566.24	1.062394E-27	31	783.4592	SRC	SRC_P297_F	38202216	NM_198291.1	SRC	6714	20	36.1	35406205	-297	N	GAAGAAAAAAGAGGCTTGATTGGTAGCGTATTCCGATGTCCAAGGGGTAAATAC	ASV, SRC1, c-SRC, p60-Src	v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog; protooncogene SRC, Rous sarcoma; tyrosine-protein kinase SRC-1; tyrosine kinase pp60c-src; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: SH2 domain binding; go_function: SH3/SH2 adaptor activity; go_function: protein-tyrosine kinase activity; go_function: protein-tyrosine kinase activity; go_process: protein kinase cascade; go_process: signal complex formation; go_process: protein amino acid phosphorylation	proto-oncogene tyrosine-protein kinase SRC
ST6GAL1_P164_R	2050	0.5820767	923.9047	1426.078	0.2438865	29	77.98536	0.1255346	5165.926	755.9541	0.001090782	24	198.8566	0.134854	4232.936	675.3932	0.008865403	17	250.2377	0.2527788	2068.769	733.6767	0.2373766	26	88.2969	0.1304705	3050.278	472.6904	0.08784584	36	253.7685	0.191113	3684.181	894.0757	0.009265376	28	270.0648	0.1768225	3513.379	776.1714	0.05913408	31	338.8189	0.173192	5627.75	1199.796	0.00439754	37	222.6466	0.2045866	4405.506	1158.852	0.002041881	30	220.3263	0.1912758	4436.434	1072.937	0.002234973	33	210.7286	ST6GAL1	ST6GAL1_P164_R	27765090	NM_173216.1	ST6GAL1	6480	3	36.1	188131046	-164	Y	CTCCAGTCCCTTCCACTGTGCGTCTTCTGTCCCCCGTTCTTCC	CD75, SIAT1, ST6GalI, MGC48859, ST6Gal I	isoform a is encoded by transcript variant 1; sialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase); sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase); CMP-N-acetylneuraminate beta-galactosamide alpha-2,6-sialyltransferase; alpha 2,6-ST; go_component: Golgi stack; go_component: integral to membrane; go_component: integral to Golgi membrane; go_function: beta-galactoside alpha-2,6-sialyltransferase activity; go_process: growth; go_process: development; go_process: oligosaccharide metabolism; go_process: humoral immune response; go_process: protein amino acid glycosylation	sialyltransferase 1 isoform a
ST6GAL1_P528_F	2051	0.08024883	3512.888	315.2266	0.02204629	31	157.6859	0.1359766	8248.18	1313.804	4.92953E-09	29	249.4323	0.06171061	9266.647	616.0376	2.217767E-10	22	302.3795	0.08045484	3036.915	274.4618	0.1471913	27	215.2637	0.06860553	7398.652	552.3428	1.0511E-06	23	455.0087	0.07496183	8441.714	692.1904	4.769475E-10	28	388.7588	0.0728288	7941.583	631.662	3.480282E-06	24	392.5231	0.1422795	8685.202	1457.298	3.374818E-06	34	280.5359	0.05892203	6993.011	444.102	7.458348E-06	28	454.6885	0.0604309	8700.611	566.0349	5.759274E-09	34	401.2332	ST6GAL1	ST6GAL1_P528_F	27765090	NM_173216.1	ST6GAL1	6480	3	36.1	188130682	-528	Y	GCCGGTAGCAGAGACCGGGTGTACAGCACCCGCATGTTAGGACCAAAAGCCGGACACTG	CD75, SIAT1, ST6GalI, MGC48859, ST6Gal I	isoform a is encoded by transcript variant 1; sialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase); sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase); CMP-N-acetylneuraminate beta-galactosamide alpha-2,6-sialyltransferase; alpha 2,6-ST; go_component: Golgi stack; go_component: integral to membrane; go_component: integral to Golgi membrane; go_function: beta-galactoside alpha-2,6-sialyltransferase activity; go_process: growth; go_process: development; go_process: oligosaccharide metabolism; go_process: humoral immune response; go_process: protein amino acid glycosylation	sialyltransferase 1 isoform a
STAT5A_E42_F	5736	0.1782926	7814.018	1717.17	6.116123E-13	19	325.3467	0.08568849	13074.82	1234.732	1.580575E-20	25	1277.666	0.1022441	17774.3	2035.679	3.678E-38	31	1398.274	0.1151168	7402.542	976.0255	6.162171E-06	25	380.5034	0.1475057	11980.5	2090.269	2.125255E-21	37	1052.395	0.1979254	11635.12	2895.838	1.98543E-26	18	1169.301	0.199371	12131.66	3045.901	9.809449E-20	23	795.7717	0.2071303	17015.02	4471.15	3.76971E-28	37	1003.265	0.1765331	9249.245	2004.272	1.426282E-13	33	670.2391	0.06596216	16620.41	1180.803	1.362891E-34	33	1170.576	STAT5A	STAT5A_E42_F	21618341	NM_003152.2	STAT5A	6776	17	36.1	37693133	42	N	TGCTGTGGCAAGGCCTGTAGAGAGTTTCGAAGTTAGGAGGACTCAAGACGGT	MGF, STAT5	go_component: nucleus; go_function: calcium ion binding; go_function: signal transducer activity; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: immune response; go_process: JAK-STAT cascade; go_process: intracellular signaling cascade; go_process: regulation of transcription from RNA polymerase II promoter	signal transducer and activator of transcription 5A
STAT5A_P704_R	5243	0.3036865	3361.686	1509.762	0.001617619	24	183.0238	0.6457509	4785.382	8905.428	9.781485E-19	28	858.5491	0.6642138	6035.857	12137.25	3.755776E-37	39	673.7708	0.04159881	6045.824	266.7557	0.001276791	20	325.7853	0.5798176	5591.61	7853.959	1.812461E-19	20	645.4242	0.5416747	6558.183	7869.016	4.933252E-26	32	1052.289	0.6063914	6576.279	10285.44	1.375733E-24	32	808.1853	0.6412879	7607.255	13778.65	7.048898E-28	25	677.1863	0.6161345	3990.771	6566.009	6.958649E-12	23	1285.244	0.6650544	5361.871	10844.87	2.007846E-28	32	671.2858	STAT5A	STAT5A_P704_R	21618341	NM_003152.2	STAT5A	6776	17	36.1	37692387	-704	N	CAGCCACCGACAGGCTGCATGACGGTGGCAAAGTCACTTCCCCTCTCTG	MGF, STAT5	go_component: nucleus; go_function: calcium ion binding; go_function: signal transducer activity; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: immune response; go_process: JAK-STAT cascade; go_process: intracellular signaling cascade; go_process: regulation of transcription from RNA polymerase II promoter	signal transducer and activator of transcription 5A
STK11_P295_R	2879	0.2816025	3515.238	1417.126	0.001355114	34	156.3317	0.1266656	6199.001	913.5869	4.118547E-05	36	224.6891	0.09506889	7084.988	754.8297	1.659141E-06	26	283.6413	0.291551	876.6105	401.9086	0.612071	31	67.0414	0.1537995	6216.337	1148.013	8.759038E-06	42	218.6722	0.1731071	6514.293	1384.678	1.723204E-07	34	298.4849	0.2176531	6132.323	1733.865	3.024918E-05	39	338.013	0.215662	7337.854	2045.116	2.346943E-05	26	275.9827	0.1795772	5919.521	1317.576	1.495343E-05	32	268.0186	0.08705699	7047.827	681.6069	2.878194E-06	22	265.39	STK11	STK11_P295_R	58530881	NM_000455.4	STK11	6794	19	36.1	1156503	-295	Y	CGAGGTCACAGCCGTGGCCTCGTCTCCCCATGCCTGCTTCCCG	PJS, LKB1	serine/threonine kinase 11 (Peutz-Jeghers syndrome); go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation	serine/threonine protein kinase 11
STK23_E182_R	3962	0.6767384	1996.392	4388.733	8.719279E-06	17	341.9383	0.8343923	1986.631	10513.21	1.550798E-15	36	519.5198	0.7667487	3193.485	10826.41	1.642028E-21	28	326.5574	0.5419789	3251.445	3965.783	0.0001529811	21	522.2813	0.8911223	1628.755	14149.2	3.57781E-27	35	904.8408	0.885498	1702.799	13941.91	7.174709E-31	29	1379.977	0.8641946	2248.53	14944.82	1.304785E-25	26	932.9902	0.8982752	2400.894	22084	6.329114E-37	26	834.176	0.8851773	1240.067	10330.68	2.207536E-14	14	748.52	0.8699391	1803.702	12733.3	1.202317E-22	23	795.6584	STK23	STK23_E182_R	63025195	NM_014370.2	STK23	26576	X	36.1	152699886	182	Y	CACAGGCCTCCTGCGGGCCCGAGTCCTCGGGCTCCGAACTAGCCC	MSSK1, SRPK3, MGC102944	go_component: cellular component unknown; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	serine/threonine kinase 23
STK23_P24_F	2059	0.4055775	2914.957	2057.121	0.001205587	22	208.718	0.7024817	3703.913	8981.562	5.166958E-16	28	548.7449	0.5680503	5827.047	7794.568	3.016788E-20	28	646.1752	0.5388561	2044.676	2506.098	0.03134162	33	95.60384	0.8410555	2826.064	15483.28	4.35119E-37	22	1378.84	0.8498205	2710.567	15904.15	3.678E-38	31	1651.082	0.8205178	4236.02	19822.48	3.678E-38	16	1070.412	0.838369	4481.01	23761.39	3.678E-38	20	1232.997	0.8732591	1644.267	12018.2	2.225625E-20	41	583.7339	0.795117	2922.79	11730.95	4.997914E-23	40	739.8324	STK23	STK23_P24_F	63025195	NM_014370.2	STK23	26576	X	36.1	152699680	-24	Y	GCCAAGGCTATAAATTCGCAGGCCGCGGCCGGGCCCCACAGGAGCAGCCGCCCG	MSSK1, SRPK3, MGC102944	go_component: cellular component unknown; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: protein serine/threonine kinase activity; go_process: protein amino acid phosphorylation; go_process: protein amino acid phosphorylation	serine/threonine kinase 23
SYBL1_E23_R	3963	0.05803897	13755.17	853.6871	1.392641E-31	27	760.3446	0.6769462	4271.176	9159.623	5.211167E-18	34	683.2056	0.7524186	4238.661	13185.52	5.335423E-34	31	881.7139	0.1447971	9457.625	1618.232	4.116469E-10	31	674.1083	0.7289922	2952.861	8211.985	2.95234E-13	27	977.7458	0.745596	4006.456	12035.02	1.531905E-32	30	677.9584	0.8235787	2461.029	11955.52	9.939079E-18	34	986.8303	0.6613026	6058.883	12025.15	1.049483E-19	22	749.8738	0.7257571	3030.387	8284.263	1.000184E-13	19	633.1784	0.7750636	4127.566	14566.93	3.678E-38	30	883.4904	SYBL1	SYBL1_E23_R	27545446	NM_005638.3	SYBL1	6845	X	36.1	154764230	23	Y	GTCCCAGCCTCCTCTGGGAGCGGGCAGTTGGCGACCCTGCACTGACCC	VAMP7, VAMP-7, TI-VAMP	tetanus insensitive VAMP (Ti-VAMP); go_component: Golgi stack; go_component: integral to membrane; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: transcription factor activity; go_process: protein transport; go_process: vesicle-mediated transport; go_process: regulation of transcription, DNA-dependent	synaptobrevin-like 1
SYBL1_P349_F	2065	0.09080142	1769.961	186.7525	0.3658633	44	90.4947	0.5149882	4656.306	5050.272	2.623614E-09	31	578.7417	0.6224278	4314.872	7277.918	1.910341E-14	28	523.029	0.07465442	2347.291	197.4409	0.2926218	35	162.5832	0.5514063	4290.934	5397.285	6.286909E-10	38	420.4214	0.6421989	4063.929	7473.625	2.713157E-16	33	593.1473	0.3546108	5233.918	2930.736	1.247877E-05	39	437.8248	0.4541447	6211.467	5251.061	7.581561E-08	29	428.2923	0.5401648	3192.059	3867.156	2.722378E-05	33	389.643	0.6003539	4506.879	6920.518	9.664954E-14	27	489.0022	SYBL1	SYBL1_P349_F	27545446	NM_005638.3	SYBL1	6845	X	36.1	154763858	-349	Y	ATTTTGTCTGTGAGGAAACGGGCGACGCTGCCTACTGAGACTAAGCAGGA	VAMP7, VAMP-7, TI-VAMP	tetanus insensitive VAMP (Ti-VAMP); go_component: Golgi stack; go_component: integral to membrane; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: transcription factor activity; go_process: protein transport; go_process: vesicle-mediated transport; go_process: regulation of transcription, DNA-dependent	synaptobrevin-like 1
SYK_E372_F	4178	0.04971866	5145.388	274.4384	0.0002974867	22	299.6516	0.05693881	10722.62	653.4327	8.149466E-13	23	625.4809	0.03732277	12371.35	483.5112	6.272119E-18	29	679.5063	0.06591813	2404.968	176.7755	0.2843334	32	91.98431	0.0465312	10715.37	527.8118	1.898533E-13	36	603.121	0.04929845	11424.15	597.5825	9.372985E-18	34	617.3185	0.04861618	10656.55	549.665	1.515556E-10	22	673.7735	0.05342961	13096.53	744.8844	2.048591E-11	28	713.9001	0.06703805	7498.902	546.0197	7.808883E-07	36	563.5757	0.03587462	13983.89	524.0546	1.49418E-22	33	547.5387	SYK	SYK_E372_F	34147655	NM_003177.3	SYK	6850	9	36.1	92604263	372	Y	AGGTCAGACCGTGCGGAAAGTGACCCGGGCACCCCAGGGCGCCCAGGCC	.	go_component: cytoplasm; go_component: T cell receptor complex; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: integrin binding; go_function: transferase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: cell proliferation; go_process: leukocyte adhesion; go_process: organ morphogenesis; go_process: neutrophil chemotaxis; go_process: protein complex assembly; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: integrin-mediated signaling pathway	spleen tyrosine kinase
SYK_P584_F	2883	0.4037135	2966.795	2076.362	0.0009751028	26	183.7113	0.7516867	3583.279	11149.91	8.339921E-22	25	553.1333	0.7286252	4052.125	11148.21	1.685078E-25	23	708.9742	0.2273379	3376.087	1022.758	0.03905268	29	228.4283	0.6974711	3656.284	8659.995	3.140888E-16	38	553.8048	0.8044514	3000.934	12756.68	2.427273E-31	22	1041.298	0.6839981	4040.273	8961.777	2.608872E-14	38	631.9069	0.6611251	4751.269	9464.541	4.780175E-12	31	686.3701	0.7137365	3060.719	7880.572	8.439102E-13	31	451.5076	0.7857495	3434.031	12960.82	4.056503E-29	19	509.5707	SYK	SYK_P584_F	34147655	NM_003177.3	SYK	6850	9	36.1	92603307	-584	N	TTTATTTGGTTGTGGACGTCAGAGCCGTCATGGTAAGAAGGAAGCAAAGCCTT	.	go_component: cytoplasm; go_component: T cell receptor complex; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: integrin binding; go_function: transferase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: cell proliferation; go_process: leukocyte adhesion; go_process: organ morphogenesis; go_process: neutrophil chemotaxis; go_process: protein complex assembly; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: integrin-mediated signaling pathway	spleen tyrosine kinase
TAL1_E122_F	1055	0.3186164	4978.889	2374.9	1.235967E-07	35	349.0205	0.09822962	10550.85	1160.194	1.350453E-13	17	518.9877	0.07077545	14806.04	1135.336	3.446998E-28	23	714.0005	0.528056	831.3165	1042.046	0.4580234	25	61.21067	0.06617563	11632.05	831.3942	1.239109E-16	36	758.4361	0.08306354	12387.35	1131.205	1.046338E-22	28	914.4307	0.08026004	11707.37	1030.357	1.025432E-13	20	951.1343	0.08335197	14838.01	1358.333	1.037164E-15	26	844.2405	0.09272061	7636.143	790.6053	1.69423E-07	25	647.6242	0.06521758	12391.2	871.4817	1.048631E-18	26	587.4565	TAL1	TAL1_E122_F	4507362	NM_003189.1	TAL1	6886	1	36.1	47467908	122	Y	CCGACAGGCTGTCTGGAACATTTTCGAACCCTCCAACTGGGATCGGTCTGGTT	SCL, TCL5, tal-1	tal-1 product; go_component: nucleus; go_function: DNA binding; go_function: transcription regulator activity; go_process: cell differentiation; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent	T-cell acute lymphocytic leukemia 1
TAL1_P594_F	5221	0.1110527	4226.639	540.5103	0.002176609	38	145.9688	0.2334572	7862.692	2425.106	1.861591E-10	31	445.5603	0.1789532	7488.465	1653.962	7.457746E-09	23	690.2447	0.07775263	1382.76	125.0083	0.553443	26	93.68189	0.2185774	7075.108	2007.001	1.017853E-08	33	486.1258	0.3813564	6301.078	3945.878	9.894875E-13	26	620.7553	0.1452358	8637.288	1484.581	1.388358E-08	35	383.089	0.2210847	8345.005	2397.002	6.437676E-07	28	488.7272	0.2275459	6377.276	1908.045	3.013691E-07	29	399.8368	0.1559164	8691.391	1623.918	3.862223E-11	29	359.269	TAL1	TAL1_P594_F	4507362	NM_003189.1	TAL1	6886	1	36.1	47468624	-594	Y	TCACACATCGAAGTCTTGGATTAACTGCGAAGGCCTCCTTCTATTTGCCGCGGCTT	SCL, TCL5, tal-1	tal-1 product; go_component: nucleus; go_function: DNA binding; go_function: transcription regulator activity; go_process: cell differentiation; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent	T-cell acute lymphocytic leukemia 1
TAL1_P817_F	5047	0.3030789	1650.599	761.3052	0.2268908	33	84.88815	0.4989907	2967.365	3055.007	0.00085047	21	289.4518	0.4690301	3334.627	3033.965	0.0002270811	33	142.6752	0.250342	531.3087	210.8202	0.7377812	27	37.01246	0.4713254	2662.883	2463.173	0.004922481	27	206.5225	0.5365798	2566.181	3087.088	0.0005919922	32	197.272	0.5057405	2509.283	2669.894	0.01495791	27	242.6404	0.5158916	2841.93	3135.077	0.01629407	35	232.6602	0.4540093	2286.37	1984.345	0.03114857	24	312.546	0.4477122	3218.567	2690.198	0.0008236716	39	166.1862	TAL1	TAL1_P817_F	4507362	NM_003189.1	TAL1	6886	1	36.1	47468847	-817	Y	TTTGCCTTATGACCAAGTCTCTGTGTCCGTGCCTCTCTCCATTTTCTCTTCCTA	SCL, TCL5, tal-1	tal-1 product; go_component: nucleus; go_function: DNA binding; go_function: transcription regulator activity; go_process: cell differentiation; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent	T-cell acute lymphocytic leukemia 1
TBX1_P520_F	5962	0.06753704	17232.13	1255.343	3.678E-38	28	1502.013	0.70846	4156.152	10342.71	4.295258E-21	42	1048.305	0.6606176	6078.334	12026.31	7.395585E-37	33	1154.072	0.1935059	7137.574	1736.545	1.32187E-06	32	509.3492	0.780328	3360.218	12291.53	1.013014E-26	22	1790.543	0.7706437	4639.096	15923.49	3.678E-38	19	1285.876	0.7932191	4360.421	17110.35	3.678E-38	35	920.2674	0.4491521	10077.54	8298.599	2.284549E-20	29	724.8683	0.7613292	2447.49	8126.167	6.354923E-12	25	686.5334	0.6364731	5558.884	9907.735	8.903904E-26	25	995.8229	TBX1	TBX1_P520_F	18104949	NM_080646.1	TBX1	6899	22	36.1	18123706	-520	N	GGAGCCACGTGTGTGCAGGGGAGGCGGAACTGGGCAGACAGATGGG	DGS, TGA, CAFS, CTHM, DGCR, DORV, VCFS, TBX1C	isoform A is encoded by transcript variant A; brachyury; T-box 1 transcription factor C; Testis-specific T-box protein; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: morphogenesis; go_process: heart development; go_process: regulation of transcription from RNA polymerase II promoter	T-box 1 isoform A
TBX1_P885_R	5961	0.06202922	3624.14	246.2822	0.0201348	31	106.9646	0.1155346	8313.908	1099.079	9.334205E-09	31	436.6861	0.1212852	9806.23	1367.315	2.224875E-13	37	485.4728	0.3059489	3124.276	1421.313	0.03158229	29	196.1725	0.1106943	7356.575	928.14	2.885439E-07	31	323.5588	0.2058153	6951.972	1827.54	2.867281E-09	27	383.8025	0.1272996	7262.042	1073.891	7.373458E-06	29	502.9403	0.1188417	10247.79	1395.605	4.320457E-08	28	510.4043	0.137656	6411.107	1039.368	7.113788E-06	32	272.5997	0.1103823	7794.93	979.5895	4.866234E-08	32	277.4491	TBX1	TBX1_P885_R	18104949	NM_080646.1	TBX1	6899	22	36.1	18123341	-885	Y	CTCAGTGCTTCCCTTTGCACGGTGCGCGGCGGAGCCCGATTCTGCTCTCTCC	DGS, TGA, CAFS, CTHM, DGCR, DORV, VCFS, TBX1C	isoform A is encoded by transcript variant A; brachyury; T-box 1 transcription factor C; Testis-specific T-box protein; go_component: nucleus; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: morphogenesis; go_process: heart development; go_process: regulation of transcription from RNA polymerase II promoter	T-box 1 isoform A
TCF4_P175_R	5246	0.1582177	1294.932	262.1854	0.5055218	33	79.0637	0.04437259	3954.542	188.2643	0.0392244	32	200.3975	0.04827563	4076.582	211.8545	0.02942891	24	174.3405	0.09161251	1537.36	165.1307	0.5026543	24	90.65707	0.0454494	4085.154	199.2694	0.02637269	33	133.55	0.0567983	4286.077	264.1235	0.009859133	28	155.2298	0.04872133	3935.99	206.71	0.07193408	20	396.0168	0.05112194	4631.416	254.9107	0.06450688	29	162.8428	0.0728109	3943.03	317.4936	0.03170984	26	264.6873	0.03809562	4124.409	167.3051	0.02776502	20	221.4995	TCF4	TCF4_P175_R	4507398	NM_003199.1	TCF4	6925	18	36.1	51406615	-175	Y	TCGGGCAGGCTAGGATGCATCCCCCTCGCACCCACCCCGAGGGGAAAAAA	E2-2, ITF2, SEF2, SEF2-1, SEF2-1A, SEF2-1B	transcription factor-4 (immunoglobulin transcription factor-2); go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: RNA polymerase II transcription factor activity; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor 4 isoform b
TCF4_P317_F	5250	0.07417551	3266.158	269.6909	0.03985789	31	122.9476	0.2120863	5074.901	1392.951	0.0002654459	25	231.9983	0.3025769	4396.259	1950.702	0.0002418597	30	241.3081	0.2778692	330.6633	165.7152	0.7874774	22	22.17673	0.2045339	4272.744	1124.34	0.002646154	26	238.7156	0.2821244	4634.092	1860.493	4.116405E-05	28	257.3171	0.2460646	4578.839	1527.049	0.002510342	34	220.1727	0.2679428	4907.503	1832.814	0.005078988	23	178.4858	0.3309299	3866.563	1961.909	0.00104445	33	239.0339	0.3005082	4177.912	1837.831	0.0006212546	29	197.2123	TCF4	TCF4_P317_F	4507398	NM_003199.1	TCF4	6925	18	36.1	51406757	-317	Y	CCTGAACAGTTCAGTTTTTGCCCGTTGCATCCCTCGGAGGCACTTTGAAA	E2-2, ITF2, SEF2, SEF2-1, SEF2-1A, SEF2-1B	transcription factor-4 (immunoglobulin transcription factor-2); go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: RNA polymerase II transcription factor activity; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor 4 isoform b
TCF7L2_E411_F	1060	0.03583963	6440.626	243.1272	2.534752E-06	23	292.7819	0.1108234	10006.31	1259.61	1.452637E-12	26	894.9332	0.1406154	12334.67	2034.603	1.181809E-22	35	768.783	0.03346581	5914.514	208.2498	0.001911365	21	270.4651	0.1229681	9081.918	1287.391	2.14174E-11	22	641.6967	0.1364264	10070.17	1606.672	1.047164E-16	27	958.0831	0.1233277	12028.24	1706.165	4.969499E-16	28	655.8803	0.1363688	12183.66	1939.611	6.877728E-12	38	497.552	0.1246457	8712.643	1254.872	1.488115E-10	29	548.8653	0.143506	12595.41	2127.122	2.968443E-23	30	563.0245	TCF7L2	TCF7L2_E411_F	13540470	NM_030756.1	TCF7L2	6934	10	36.1	114700612	411	Y	GGAGGAGAAGAGCTCCGAAAACTCCTCGGCAGAGAGGGATTTAGCTGATG	TCF4, TCF-4	go_component: nucleus; go_function: DNA binding; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of Wnt receptor signaling pathway; go_process: regulation of progression through cell cycle; go_process: establishment and/or maintenance of chromatin architecture; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor 7-like 2 (T-cell specific, HMG-box)
TCF7L2_P193_R	5054	0.3906356	3299.765	2179.434	0.0002443405	34	180.2286	0.02839602	10282.88	303.449	4.464616E-11	26	451.7781	0.03102209	11346.38	366.4591	9.277929E-15	29	909.9599	0.1702332	4880.14	1021.715	0.00300212	21	228.2558	0.0336259	11489.54	403.2689	4.256875E-15	24	710.6827	0.03473263	10863.09	394.4781	1.767897E-15	26	947.2887	0.03952381	8766.777	364.8699	5.381712E-07	21	691.6063	0.02719189	13846.39	389.8289	4.410007E-12	25	699.1906	0.05754359	7561.905	467.8132	8.284084E-07	19	468.7148	0.07332081	13147.62	1048.179	1.49579E-21	27	565.1055	TCF7L2	TCF7L2_P193_R	13540470	NM_030756.1	TCF7L2	6934	10	36.1	114700008	-193	Y	CTCTCGCCCTGTCAATAATCTCCGCTCCCAGACTACTCCGTTCCTC	TCF4, TCF-4	go_component: nucleus; go_function: DNA binding; go_function: transcription factor activity; go_function: RNA polymerase II transcription factor activity; go_process: transcription; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: regulation of Wnt receptor signaling pathway; go_process: regulation of progression through cell cycle; go_process: establishment and/or maintenance of chromatin architecture; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor 7-like 2 (T-cell specific, HMG-box)
TDG_E129_F	2934	0.8577506	1823.873	11600.77	1.909457E-26	34	562.7083	0.8346512	3915.027	20267.13	3.678E-38	37	1508.954	0.8218443	5722.681	26860.42	3.678E-38	35	1105.344	0.5900518	3881.117	5730.151	1.108984E-07	26	346.156	0.8161713	4164.664	18934.46	3.678E-38	32	1371.614	0.7950779	6199.121	24439.97	3.678E-38	24	1393.91	0.8765419	3858.771	28106.93	3.678E-38	30	1547.649	0.8238592	5464.805	26028.12	3.678E-38	26	1241.887	0.8884751	1252.529	10775.07	1.35258E-15	21	426.7275	0.8576235	4456.845	27448.76	3.678E-38	17	2102.815	TDG	TDG_E129_F	56549140	NM_001008411.1	TDG	6996	12	36.1	102883876	129	Y	GGGGTTGTCTTACCGCAGTGAGTACCACGCGGTACTACAGAGACCGGCTGCCC	.	isoform 2 is encoded by transcript variant 2; go_component: nucleoplasm; go_function: protein binding; go_function: damaged DNA binding; go_function: hydrolase activity, acting on glycosyl bonds; go_function: pyrimidine-specific mismatch base pair DNA N-glycosylase activity; go_process: DNA repair; go_process: carbohydrate metabolism; go_process: base-excision repair	thymine-DNA glycosylase isoform 2
TDGF1_E53_R	1250	0.4834955	2019.447	1983.996	0.01501463	24	171.1631	0.9382607	1013.779	16926.24	8.005792E-33	30	952.4747	0.9278678	1468.82	20180.41	3.678E-38	33	949.3107	0.6848238	481.2306	1262.914	0.4917562	30	82.93634	0.9329926	1280.54	19222.28	3.678E-38	20	1012.766	0.8856253	2261.842	18288.19	3.678E-38	29	830.3932	0.8821988	2228.464	17437.57	6.137429E-34	34	868.2744	0.905266	2078.287	20815.44	4.102568E-32	30	764.1257	0.8923454	1464.354	12966.87	7.205329E-23	35	996.5293	0.9354551	1244.356	19483.89	3.678E-38	24	895.1685	TDGF1	TDGF1_E53_R	4507424	NM_003212.1	TDGF1	6997	3	36.1	46594270	53	Y	AAGGTCAAAACGTCCAAGGCCGAAAGCCCTCCAGTTTCCCCTG	CR, CRGF, CRIPTO	go_component: cell surface; go_component: extrinsic to plasma membrane; go_function: growth factor activity; go_process: heart development; go_process: cell differentiation; go_process: embryonic development; go_process: mammary gland development; go_process: activation of MAPK activity; go_process: peptidyl-serine phosphorylation; go_process: negative regulation of apoptosis; go_process: regulation of signal transduction; go_process: positive regulation of cell migration; go_process: morphogenesis of a branching structure; go_process: positive regulation of cell proliferation; go_process: determination of anterior/posterior axis, embryo; go_process: epidermal growth factor receptor signaling pathway; go_process: positive regulation of peptidyl-tyrosine phosphorylation	teratocarcinoma-derived growth factor 1
TDGF1_P428_R	5056	0.2280876	4090.598	1238.254	0.0004001364	33	161.252	0.5448649	5510.737	6716.893	7.519041E-15	30	629.3857	0.5213687	6948.751	7678.14	1.620103E-23	30	586.6296	0.526389	1450.884	1723.711	0.1688182	23	178.066	0.4268534	7277.659	5494.543	1.690477E-17	19	882.058	0.4634688	8491.737	7421.754	5.359896E-32	28	1220.406	0.3777757	8260.805	5076.159	4.396903E-15	27	1370.801	0.4040985	10595.91	7253.214	3.506766E-19	22	910.5881	0.4682287	5272.893	4730.874	1.239908E-10	27	662.7211	0.4801345	7465.888	6987.661	2.241285E-22	30	545.768	TDGF1	TDGF1_P428_R	4507424	NM_003212.1	TDGF1	6997	3	36.1	46593789	-428	N	ACACACACCTAGCTCCTCAGGCGGAGAGCACCCCTTTCTTGGCCAC	CR, CRGF, CRIPTO	go_component: cell surface; go_component: extrinsic to plasma membrane; go_function: growth factor activity; go_process: heart development; go_process: cell differentiation; go_process: embryonic development; go_process: mammary gland development; go_process: activation of MAPK activity; go_process: peptidyl-serine phosphorylation; go_process: negative regulation of apoptosis; go_process: regulation of signal transduction; go_process: positive regulation of cell migration; go_process: morphogenesis of a branching structure; go_process: positive regulation of cell proliferation; go_process: determination of anterior/posterior axis, embryo; go_process: epidermal growth factor receptor signaling pathway; go_process: positive regulation of peptidyl-tyrosine phosphorylation	teratocarcinoma-derived growth factor 1
TEK_E75_F	1256	0.3770651	3642.294	2265.226	5.460671E-05	23	347.5435	0.5534097	4468.508	5661.244	3.889961E-10	25	548.3605	0.5177007	5060.173	5538.937	5.427637E-12	40	481.7839	0.2709189	1397.363	556.4044	0.4371696	33	53.86429	0.5515347	4052.936	5107.393	7.190254E-09	23	374.5562	0.6109264	4108.995	6608.997	5.644419E-14	25	622.2167	0.5513901	4300.868	5409.142	6.709006E-08	31	374.7394	0.4962853	5535.354	5552.237	2.354678E-07	31	504.0874	0.5206259	3932.656	4379.681	2.702169E-07	29	407.8065	0.5287828	5237.977	5990.083	2.978879E-13	23	390.484	TEK	TEK_E75_F	4557868	NM_000459.1	TEK	7010	9	36.1	27099516	75	N	GTAGGACGATGCTAATGGAAAGTCACAAACCGCTGGGTTTTTGAAAGGATC	TIE2, VMCM, TIE-2, VMCM1, CD202B	go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor activity; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	TEK tyrosine kinase, endothelial
TEK_P479_R	5057	0.7989603	3585.714	14647.55	3.678E-38	30	544.4697	0.7072439	3958.277	9804.035	6.135913E-19	31	745.2189	0.7037913	4560.678	11073.76	4.662609E-27	29	594.1158	0.6198511	5797.302	9615.834	1.304792E-19	25	848.952	0.8901711	1864.817	15924.99	6.391622E-35	30	828.4495	0.7584873	3059.997	9924.19	7.292978E-21	22	867.0109	0.7308779	3791.923	10569.63	1.373322E-17	32	386.6439	0.7540518	4212.203	13220.77	2.846983E-18	26	724.5685	0.7449834	2942.667	8888.582	4.560588E-15	27	1033.28	0.8647037	2669.743	17701.93	3.678E-38	29	570.1207	TEK	TEK_P479_R	4557868	NM_000459.1	TEK	7010	9	36.1	27098962	-479	N	GCTTTTCAGGTTGTATTTTCTCATCACGGAAACCTTCTTCTCCCAATTCAA	TIE2, VMCM, TIE-2, VMCM1, CD202B	go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor activity; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	TEK tyrosine kinase, endothelial
TEK_P526_F	5058	0.1151369	9455.438	1243.337	1.903866E-16	30	264.0939	0.8042388	3185.115	13496.12	3.25171E-28	43	864.7897	0.7650613	4698.729	15626.72	3.678E-38	24	625.1772	0.3918039	5998.182	3928.488	3.584543E-08	36	413.6462	0.7522055	3848.18	11985.1	2.26051E-27	37	679.4492	0.7484746	4414.336	13433.5	3.678E-38	33	806.623	0.7401342	4550.037	13243.96	1.607811E-27	40	714.5948	0.7462373	5371.073	16088.72	4.445737E-28	26	1258.225	0.7717693	3699.807	12849.17	1.590512E-30	26	863.5036	0.76486	4536.565	15081.75	3.678E-38	35	720.7002	TEK	TEK_P526_F	4557868	NM_000459.1	TEK	7010	9	36.1	27098915	-526	N	TTGGGGCTACATTGAGCATTGACCTCACCGGTGCTCACTGAAATTAATTGCTTT	TIE2, VMCM, TIE-2, VMCM1, CD202B	go_component: integral to plasma membrane; go_function: ATP binding; go_function: kinase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: receptor activity; go_function: protein serine/threonine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell-cell signaling; go_process: signal transduction; go_process: protein amino acid phosphorylation; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	TEK tyrosine kinase, endothelial
TERT_E20_F	4180	0.03598265	6626.958	251.0887	1.09378E-06	26	221.8552	0.07178406	9813.785	766.6877	4.593393E-11	29	572.1681	0.06656661	10416.89	749.9985	2.311369E-13	24	535.6281	0.03249142	6992.634	238.1888	0.0001478064	29	420.0647	0.06576974	10567.01	750.9567	1.241409E-13	31	627.4059	0.06148927	12216.09	806.9247	5.392467E-21	37	685.6627	0.06311965	12667.71	860.188	1.556804E-15	27	1084.075	0.05988398	15191.98	974.0759	1.191109E-15	29	740.5132	0.07906544	9475.987	822.1319	2.737811E-11	46	429.1928	0.07394895	10355.23	834.8929	3.681036E-13	36	340.66	TERT	TERT_E20_F	38201701	NM_198255.1	TERT	7015	5	36.1	1348139	20	Y	GGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTC	TP2, TRT, EST2, TCS1, hEST2	isoform 2 is encoded by transcript variant 2; telomerase catalytic subunit; go_component: nucleus; go_component: chromosome, telomeric region; go_component: telomerase holoenzyme complex; go_function: DNA binding; go_function: RNA binding; go_function: transferase activity; go_function: telomeric DNA binding; go_function: RNA-directed DNA polymerase activity; go_function: telomeric template RNA reverse transcriptase activity; go_function: telomeric template RNA reverse transcriptase activity; go_process: telomere maintenance; go_process: RNA-dependent DNA replication	telomerase reverse transcriptase isoform 2
TERT_P360_R	2885	0.3892297	15566.55	9983.931	3.678E-38	21	1206.818	0.1232959	10426	1480.331	4.607965E-14	19	791.2437	0.1044983	13814.7	1623.741	2.388526E-26	16	584.7237	0.3250968	7770.597	3791.219	5.270163E-11	34	902.8606	0.11641	10003.25	1331.07	1.130805E-13	32	1129.288	0.1534224	13198.29	2410.004	1.015779E-30	29	775.8354	0.1171115	12857.01	1718.694	3.868054E-18	31	658.0031	0.1087045	15096.25	1853.37	3.024758E-17	30	615.5037	0.1708106	8203.48	1710.492	1.945632E-10	21	744.9173	0.1189051	13818.52	1878.326	1.383268E-26	27	656.4266	TERT	TERT_P360_R	38201701	NM_198255.1	TERT	7015	5	36.1	1348519	-360	Y	CGAGGGCCCCAGCGGAGAGAGGTCGAATCGGCCTAGGCTGTGGG	TP2, TRT, EST2, TCS1, hEST2	isoform 2 is encoded by transcript variant 2; telomerase catalytic subunit; go_component: nucleus; go_component: chromosome, telomeric region; go_component: telomerase holoenzyme complex; go_function: DNA binding; go_function: RNA binding; go_function: transferase activity; go_function: telomeric DNA binding; go_function: RNA-directed DNA polymerase activity; go_function: telomeric template RNA reverse transcriptase activity; go_function: telomeric template RNA reverse transcriptase activity; go_process: telomere maintenance; go_process: RNA-dependent DNA replication	telomerase reverse transcriptase isoform 2
TES_E172_F	3968	0.5866511	3017.671	4424.798	8.074672E-08	30	224.9242	0.04562579	8037.735	389.041	4.769719E-07	28	269.1466	0.06119931	8465.336	558.3642	1.27184E-08	23	284.4274	0.5854095	1371.46	2077.729	0.1273638	21	141.4383	0.05672483	8135.299	495.2382	7.0717E-08	39	231.6744	0.07282009	8676.856	689.3284	1.406671E-10	35	377.3271	0.07447571	7713.891	628.7734	7.220588E-06	25	444.1642	0.07935519	8550.27	745.6119	2.898314E-05	30	319.1812	0.1107642	7806.625	984.858	3.633881E-08	26	261.4924	0.04278841	8371.396	378.6807	5.391141E-08	27	343.7313	TES	TES_E172_F	23238186	NM_015641.2	TES	26136	7	36.1	115637989	172	Y	GAGGAGGAGGGGACCCATAGGACGCGTTAACATGGACCTGGAAAACAAA	TESS, TESS-2, TESTIN, MGC1146, DKFZP586B2022	isoform 1 is encoded by transcript variant 1; testin 3; testin 2; go_function: zinc ion binding; go_function: metal ion binding	testin isoform 1
TES_P182_F	2094	0.1573343	4249.964	812.1825	0.000920784	31	210.323	0.2640362	7962.55	2892.541	1.186003E-11	32	551.7452	0.2227077	9381.622	2716.649	8.615333E-16	37	539.1858	0.09385609	5442.421	574.0699	0.002380808	33	253.6952	0.2440308	9098.491	2969.321	1.467934E-15	28	544.7731	0.202605	9021.898	2317.725	1.026285E-15	27	1018.383	0.2333228	9053.577	2785.707	8.45451E-12	26	745.7651	0.2509594	9847.336	3332.766	2.403911E-10	21	694.1492	0.3209049	6682.752	3205.175	2.21528E-10	17	472.8696	0.2280827	10210.7	3046.56	1.087736E-18	30	572.4456	TES	TES_P182_F	23238186	NM_015641.2	TES	26136	7	36.1	115637635	-182	Y	GGCCCGTGGACGCCCAGAGAATCCCTTCGGAGACCAGGTCAGGGTCACTGAG	TESS, TESS-2, TESTIN, MGC1146, DKFZP586B2022	isoform 1 is encoded by transcript variant 1; testin 3; testin 2; go_function: zinc ion binding; go_function: metal ion binding	testin isoform 1
TESK2_P252_R	2361	0.09699184	7309.678	795.8714	2.760797E-09	28	430.7951	0.06364716	11622.31	796.8064	2.486798E-15	26	773.7284	0.07011412	15487.94	1175.343	6.029229E-31	34	819.2793	0.08710213	6264.199	607.226	0.0003579439	33	450.0913	0.0594231	10871.27	693.1354	2.992575E-14	32	1109.864	0.06190955	13516.76	898.642	5.468598E-26	29	782.2275	0.08101936	12838.77	1140.71	1.249317E-16	30	942.366	0.07784	16572.28	1407.316	1.798248E-19	22	994.8702	0.07613381	9998.947	832.2324	1.558034E-12	33	659.3492	0.05956491	16427.9	1046.838	2.813909E-33	23	995.1259	TESK2	TESK2_P252_R	6005895	NM_007170.1	TESK2	10420	1	36.1	45729672	-252	Y	CGAAGGGAACCAATAGGAAGGAAGTCGAGGTAAAAACAGAAGAAGCAGTGTGTG	.	go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: magnesium ion binding; go_function: manganese ion binding; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: apoptosis; go_process: spermatogenesis; go_process: focal adhesion formation; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation; go_process: actin cytoskeleton organization and biogenesis	testis-specific protein kinase 2
TFAP2C_E260_F	1623	0.1442181	2085.818	368.3586	0.2156828	30	108.0093	0.1632854	8986.59	1773.254	1.905436E-11	32	657.7593	0.1442266	11055.44	1880.066	3.637446E-18	21	800.8021	0.1363554	2508.682	411.8685	0.2141141	34	145.9747	0.1577747	8588.753	1627.67	4.680174E-11	36	512.5009	0.2079244	8461.48	2247.438	5.972911E-14	24	572.684	0.0880731	8772.424	856.8909	9.052737E-08	26	414.2969	0.1233452	11902.66	1688.772	5.281607E-11	29	520.4103	0.1119334	7229.662	923.843	5.100859E-07	25	677.1954	0.0810333	12166.04	1081.604	1.160611E-18	25	453.8632	TFAP2C	TFAP2C_E260_F	39812473	NM_003222.3	TFAP2C	7022	20	36.1	54638025	260	Y	CGGACGCCATGTTGTGGAAAATAACCGATAATGTCAAGTACGAAGAGGACTGC	ERF1, TFAP2G, hAP-2g, AP2-GAMMA	transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma); estrogen receptor factor 1; go_component: nucleus; go_function: transcription factor activity; go_process: transcription; go_process: cell-cell signaling; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor AP-2 gamma
TFAP2C_P765_F	6048	0.08153601	4563.098	413.9633	0.00118793	26	235.0305	0.06528596	9499.945	670.517	3.221416E-10	37	257.09	0.07870716	10542.56	909.2069	4.413765E-14	37	400.8325	0.02485276	6982.413	180.5036	0.0001753939	27	313.3917	0.102902	8733.698	1013.273	4.746537E-10	27	408.1906	0.09700862	8342.972	907.0309	2.602429E-10	29	454.9676	0.07850461	9364.17	806.2775	1.147084E-08	40	412.1346	0.07691872	10414.64	876.1664	1.280957E-07	26	437.1393	0.09516703	8124.025	864.973	1.527982E-08	36	322.078	0.05697703	11041.73	673.1786	1.831219E-14	21	337.0537	TFAP2C	TFAP2C_P765_F	39812473	NM_003222.3	TFAP2C	7022	20	36.1	54637000	-765	Y	GGCCCGCCAGAGGCAGCTGCAGAGCCGGCGTTCCGCAGGGCAGGGCAGGG	ERF1, TFAP2G, hAP-2g, AP2-GAMMA	transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma); estrogen receptor factor 1; go_component: nucleus; go_function: transcription factor activity; go_process: transcription; go_process: cell-cell signaling; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor AP-2 gamma
TFDP1_P543_R	6041	0.4704624	1261.829	1209.903	0.2111242	28	101.1384	0.8307923	941.0496	5111.447	0.0007885536	23	395.2192	0.8655328	1036.446	7315.032	2.234992E-07	22	360.4577	0.1709609	525.5973	129.008	0.756135	22	37.38095	0.8376961	921.8421	5274.016	0.0003368418	24	220.813	0.809799	1214.238	5595.498	1.347733E-05	28	408.125	0.8442848	967.2486	5786.603	0.0005783754	25	593.1904	0.8710634	1188.155	8702.452	6.548557E-06	30	364.996	0.8033124	1105.855	4924.959	0.0006085067	22	319.0134	0.8612521	997.2396	6810.915	2.162259E-06	28	310.1988	TFDP1	TFDP1_P543_R	34147667	NM_007111.3	TFDP1	7027	13	36.1	113286514	-543	Y	TAGTGCACACACCAGTCCCCGCTCCCTCACGTGCACATGCACTAGTGCA	DP1, Dp-1, DRTF1	go_component: nucleus; go_component: transcription factor complex; go_function: transcription factor activity; go_function: transcription factor activity; go_function: transcription coactivator activity; go_process: transcription; go_process: cell proliferation; go_process: regulation of transcription, DNA-dependent; go_process: regulation of progression through cell cycle; go_process: regulation of progression through cell cycle; go_process: regulation of transcription from RNA polymerase II promoter	transcription factor Dp-1
TFE3_P421_F	6060	0.1770623	3084.32	685.1347	0.02494823	30	134.2887	0.05238001	7666.329	429.2864	1.595536E-06	29	388.6667	0.04706056	8988.422	448.8283	1.911479E-09	40	283.6288	0.1291945	3446.14	526.1128	0.06917015	23	180.8304	0.6520753	4330.485	8303.549	4.150497E-17	28	616.749	0.4981912	5406.346	5466.651	2.129116E-14	31	529.9817	0.74906	3592.62	11022.53	3.055807E-18	27	900.6005	0.5531241	6889.571	8651.395	1.940416E-14	36	554.3904	0.6632158	3443.695	6978.459	1.426575E-11	25	518.5411	0.534412	6103.878	7120.944	1.353608E-18	23	600.7364	TFE3	TFE3_P421_F	21359903	NM_006521.3	TFE3	7030	X	36.1	48788355	-421	Y	CTGGCCAAGCTTTTAGCTGCGGAACCGCGCCCTCTTTCGGCCAATATTTGTAAT	RCCP2	Transcription factor for IgH enhancer; Renal cell carcinoma, papillary; go_component: nucleus; go_function: transcription factor activity; go_process: regulation of transcription, DNA-dependent; go_process: transcription from RNA polymerase II promoter	transcription factor binding to IGHM enhancer 3
TFF1_P180_R	5244	0.4235263	2687.869	2048.205	0.002374177	25	285.5536	0.9007265	1345.373	13114.14	5.640135E-21	21	1012.386	0.906188	1470.008	15165.67	7.730054E-31	25	1186.948	0.03829939	3960.006	161.6883	0.05705192	31	184.8692	0.9092397	1042.425	11444.86	1.064588E-16	20	1249.326	0.8971489	1806.974	16634.14	3.678E-38	19	1567.53	0.9149747	1321.929	15301.67	7.234171E-24	35	873.657	0.9127713	1528.112	17036.76	8.408382E-21	33	800.0276	0.8760225	1394.914	10563.03	2.087294E-15	37	604.1055	0.9282298	1248.056	17434.9	3.678E-38	23	908.9465	TFF1	TFF1_P180_R	48928023	NM_003225.2	TFF1	7031	21	36.1	42659893	-180	N	ATGGAAGGATTTGCTGATAGACAGAGACGACATGTGGTGAGGTCATCTTGG	pS2, BCEI, HPS2, HP1.A, pNR-2, D21S21	breast cancer estrogen-inducible sequence; gastrointestinal trefoil protein pS2; go_function: growth factor activity; go_process: digestion; go_process: defense response; go_process: carbohydrate metabolism	trefoil factor 1 precursor
TFF1_P399_R	5061	0.121887	1970.78	287.4357	0.2702868	31	55.75906	0.861288	1245.213	8352.674	4.219267E-09	28	485.8142	0.8792491	1621.621	12536	5.870317E-22	29	569.8232	0.05272853	2443.756	141.5946	0.2835317	17	167.1109	0.8847523	1054.984	8866.768	2.033273E-10	20	522.7811	0.8182384	1963.025	9287.144	1.856313E-15	45	419.6068	0.8757257	1468.591	11053.42	3.059879E-13	22	590.9601	0.8552735	1780.693	11114.11	6.665459E-10	29	442.5446	0.8530059	1607.944	9911.19	3.002729E-14	37	408.0122	0.8939863	1017.588	9424.327	2.023401E-11	27	393.8055	TFF1	TFF1_P399_R	48928023	NM_003225.2	TFF1	7031	21	36.1	42660112	-399	N	CAACAGTGGCTCACGGGGTGGCCACCGTGACCTTGCAGGGGGAAG	pS2, BCEI, HPS2, HP1.A, pNR-2, D21S21	breast cancer estrogen-inducible sequence; gastrointestinal trefoil protein pS2; go_function: growth factor activity; go_process: digestion; go_process: defense response; go_process: carbohydrate metabolism	trefoil factor 1 precursor
TFF2_P178_F	5260	0.7665677	2075.413	7143.831	4.415226E-12	34	432.0432	0.9024567	1376.466	13660.06	9.569754E-23	38	689.2604	0.9166756	1468.366	17254.04	3.678E-38	39	673.5543	0.8188844	747.1147	3830.091	0.03013813	28	377.4688	0.9146483	1354.655	15588.42	1.552839E-31	25	787.4206	0.9087681	1342.643	14370.28	3.731348E-31	30	764.4412	0.912307	1495.132	16594.84	1.732203E-28	24	829.395	0.9190227	1628.786	19620.23	1.648122E-27	23	769.5363	0.8999662	1325.602	12825.61	6.058309E-22	26	790.9855	0.9254351	1289.24	17242.04	1.251733E-37	31	899.3928	TFF2	TFF2_P178_F	48928025	NM_005423.3	TFF2	7032	21	36.1	42644354	-178	N	GCCAGGGTGACTCTCTCCCTGCTCGGTGATACCTCTTCCTGCCCTGGACAGA	SP, SML1	spasmolysin; spasmolytic protein 1; go_process: digestion; go_process: digestion; go_process: defense response	trefoil factor 2 precursor
TFF2_P557_R	5257	0.6439143	1520.556	2930.472	0.005096572	31	145.5541	0.9591327	676.4188	18222.12	1.404751E-36	28	1171.798	0.9732373	651.5035	27328.81	3.678E-38	33	1790.408	0.81988	809.4789	4139.816	0.01688496	27	196.6198	0.9634719	605.4188	18606.26	3.678E-38	17	1517.571	0.9625305	818.8554	23603.9	3.678E-38	27	2090.323	0.9641955	683.2081	21091.38	3.678E-38	25	1752.396	0.9710686	757.4815	28781	3.678E-38	32	1634.08	0.937861	803.0809	13630.16	7.094109E-23	27	887.1051	0.9718117	665.402	26387.74	3.678E-38	24	1409.703	TFF2	TFF2_P557_R	48928025	NM_005423.3	TFF2	7032	21	36.1	42644733	-557	N	TGGAGATGAGGCTGACAGGGTCAGCGGAGTAGCCTGTGACAGGCAGGTTT	SP, SML1	spasmolysin; spasmolytic protein 1; go_process: digestion; go_process: digestion; go_process: defense response	trefoil factor 2 precursor
TFPI2_E141_F	3970	0.07502585	6514.737	536.5298	5.045513E-07	34	314.2935	0.1103371	10349.25	1295.929	1.931924E-13	23	525.3874	0.1318808	12356.94	1892.403	2.940439E-22	27	410.5323	0.07977533	2905.912	260.5859	0.1701596	32	203.393	0.1253712	9262.273	1342.009	6.275349E-12	36	474.8356	0.1546343	11821.96	2180.765	1.893522E-24	28	564.0109	0.1415847	7535.407	1259.363	1.687778E-06	47	384.4195	0.107742	12207.32	1486.134	3.596942E-11	39	413.8281	0.1608391	7050.795	1370.568	1.73217E-07	25	428.4765	0.1122742	13861.43	1765.757	2.437718E-26	24	608.8318	TFPI2	TFPI2_E141_F	31543803	NM_006528.2	TFPI2	7980	7	36.1	93357860	141	Y	AGATACCTGTTGGCTCCTGAGCAGCATCGCCCAGTGCAGCCTCCGTCAGGAA	PP5, TFPI-2	go_component: extracellular matrix (sensu Metazoa); go_function: serine-type endopeptidase inhibitor activity; go_function: extracellular matrix structural constituent; go_process: blood coagulation	tissue factor pathway inhibitor 2
TFPI2_P152_R	2099	0.1210686	3982.409	562.3325	0.003990736	26	129.5083	0.2741799	6749.68	2587.479	1.286036E-08	17	446.4497	0.2661771	7546.06	2773.429	2.394358E-11	24	554.0323	0.0822686	4318.604	396.0988	0.02447959	18	218.7002	0.3090098	6733.97	3056.141	3.856635E-10	27	458.3423	0.2939662	7573.741	3195.06	4.107692E-14	24	728.7953	0.2754441	7304.158	2814.733	1.40465E-08	29	467.0145	0.26752	8207.583	3034.137	1.48564E-07	33	482.0416	0.2691143	6267.505	2344.534	7.826277E-08	40	427.7377	0.2547207	9719.011	3355.93	3.689302E-18	27	826.5844	TFPI2	TFPI2_P152_R	31543803	NM_006528.2	TFPI2	7980	7	36.1	93358153	-152	Y	TGTGTAAGAGGGAGAGGAATTCCCCGCCAAGTTGAAAAGTTGAACCTGCCT	PP5, TFPI-2	go_component: extracellular matrix (sensu Metazoa); go_function: serine-type endopeptidase inhibitor activity; go_function: extracellular matrix structural constituent; go_process: blood coagulation	tissue factor pathway inhibitor 2
TFPI2_P9_F	2097	0.06864577	4403.467	331.9295	0.002378661	35	182.5208	0.07461997	9271.82	755.7165	6.221718E-10	33	360.5724	0.07445571	9711.745	789.309	9.181959E-12	23	519.4992	0.04617669	4228.614	209.5577	0.0369219	25	169.2392	0.08513874	8110.284	764.0647	2.519167E-08	25	344.4476	0.1377778	8448.556	1366.007	1.203346E-11	35	396.0958	0.07367883	8848.288	711.7395	1.168104E-07	27	329.0199	0.09871282	9871.457	1092.117	3.39265E-07	38	425.4783	0.1163543	8097.339	1079.387	6.565333E-09	36	421.2912	0.07905923	10057.43	871.9766	1.541852E-12	30	409.9361	TFPI2	TFPI2_P9_F	31543803	NM_006528.2	TFPI2	7980	7	36.1	93358010	-9	Y	GAGGTGCGCGGCTTTCTGCTCCAGGCGGCCCGGGTGCCCGCTTTATGCGGGG	PP5, TFPI-2	go_component: extracellular matrix (sensu Metazoa); go_function: serine-type endopeptidase inhibitor activity; go_function: extracellular matrix structural constituent; go_process: blood coagulation	tissue factor pathway inhibitor 2
TFRC_P414_R	5251	0.06787454	2918.576	219.8035	0.08112213	22	111.6255	0.130825	6965.477	1063.469	2.020684E-06	35	395.3317	0.1336281	8113.274	1266.805	2.498942E-09	29	440.0592	0.1012705	2883.778	336.2177	0.161424	29	121.3655	0.1535538	6279.004	1157.216	6.825993E-06	18	559.5029	0.1554125	6318.45	1181.058	9.331725E-07	20	395.7315	0.1506083	6066.366	1093.378	0.000209972	25	313.9115	0.1624539	7865.368	1544.996	2.195167E-05	34	369.1221	0.1502116	5423.627	976.3757	0.0002138675	20	376.5678	0.1449974	8293.022	1423.348	7.267781E-10	29	358.6631	TFRC	TFRC_P414_R	4507456	NM_003234.1	TFRC	7037	3	36.1	197293752	-414	Y	TGCACTGCGGCAGTGCCTTGAAATGTACGTGCAGGATGGAATGTTAGGTAACT	TFR, CD71, TFR1, TRFR	go_component: endosome; go_component: membrane; go_component: extracellular region; go_component: integral to plasma membrane; go_function: receptor activity; go_function: peptidase activity; go_function: transferrin receptor activity; go_process: endocytosis; go_process: proteolysis; go_process: iron ion transport; go_process: iron ion homeostasis	transferrin receptor
TGFA_P558_F	2892	0.04183746	7588.043	335.6927	7.206795E-09	23	352.2715	0.02562569	11067.82	293.7097	8.798054E-13	30	528.4969	0.02079169	14623.25	312.6212	1.418187E-24	26	1122.51	0.0315168	6388.826	211.1622	0.000674354	35	255.055	0.02857046	11033.67	327.4496	9.700867E-14	37	926.2974	0.02512656	15327.35	397.6272	3.323319E-31	21	520.924	0.0343473	11424.14	409.9021	8.665677E-12	36	722.4573	0.03540071	13786.18	509.6216	3.48275E-12	26	1169.812	0.03923449	8015.428	331.4073	2.349265E-07	29	602.8887	0.035914	13934.99	522.8293	2.171263E-22	34	570.7566	TGFA	TGFA_P558_F	4507460	NM_003236.1	TGFA	7039	2	36.1	70634996	-558	Y	CGGGCACCCGTTACCTACACCGAGGGGCCGCTCCTGGGGCATCTCTGGG	TFGA	transforming growth factor-alpha; go_component: soluble fraction; go_component: extracellular space; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: growth factor activity; go_function: signal transducer activity; go_function: signal transducer activity; go_function: protein-tyrosine kinase activity; go_function: epidermal growth factor receptor activating ligand activity; go_process: cell-cell signaling; go_process: cell proliferation; go_process: regulation of progression through cell cycle	transforming growth factor, alpha
TGFA_P642_R	2893	0.02295594	8585.751	204.0743	5.925903E-11	36	322.871	0.06577063	9556.435	679.8221	2.370756E-10	34	300.6895	0.04977214	10677.91	564.5379	1.496889E-13	23	428.8433	0.05014907	2922.4	159.573	0.1845666	27	132.1123	0.07577267	9775.098	809.6088	6.959523E-12	19	418.9507	0.07809493	9635.386	824.6882	2.758406E-13	32	761.5013	0.06322509	9689.275	660.7007	5.612409E-09	20	647.9354	0.0766675	10689.71	895.9069	5.176441E-08	34	501.5342	0.074356	8541.576	694.1686	5.012532E-09	18	572.3055	0.06317355	10477.73	713.2938	3.662756E-13	27	546.6019	TGFA	TGFA_P642_R	4507460	NM_003236.1	TGFA	7039	2	36.1	70635080	-642	Y	GGAAAGGGACCTGTGAGTTTCGCCGGCCGCTTGCCAAGACTTGGCTC	TFGA	transforming growth factor-alpha; go_component: soluble fraction; go_component: extracellular space; go_component: plasma membrane; go_component: integral to plasma membrane; go_function: protein binding; go_function: growth factor activity; go_function: signal transducer activity; go_function: signal transducer activity; go_function: protein-tyrosine kinase activity; go_function: epidermal growth factor receptor activating ligand activity; go_process: cell-cell signaling; go_process: cell proliferation; go_process: regulation of progression through cell cycle	transforming growth factor, alpha
TGFB1_P833_R	2895	0.3688909	4100.102	2455.01	4.352087E-06	24	233.1683	0.9619707	461.5936	14205.8	1.325293E-21	24	1176.421	0.9686836	585.403	21201.01	3.678E-38	30	1046.532	0.7531156	1013.313	3396.137	0.03846846	28	110.834	0.9660041	479.883	16477.58	1.3649E-31	19	642.5292	0.9651086	492.5857	16391.13	3.058646E-36	21	1074.131	0.9608185	513.7524	15050.57	8.465746E-21	31	750.1553	0.9690527	638.7803	23133.46	9.998669E-35	39	967.6246	0.954599	516.2162	12956.54	8.673309E-20	36	803.4158	0.9709284	556.577	21928.28	3.678E-38	30	991.3952	TGFB1	TGFB1_P833_R	63025221	NM_000660.3	TGFB1	7040	19	36.1	46552489	-833	Y	CGGTCGAAGTTGCGGAGCAGCAGGCCGATCTCCAGGTGCACGGTGCCACCAGC	CED, DPD1, TGFB	diaphyseal dysplasia 1, progressive; TGF-beta 1 protein; transforming growth factor beta 1; transforming growth factor-beta 1; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: growth factor activity; go_function: transcriptional activator activity; go_function: transforming growth factor beta receptor binding; go_process: cell death; go_process: cell growth; go_process: cell proliferation; go_process: organ morphogenesis; go_process: skeletal development; go_process: inflammatory response; go_process: lymph node development; go_process: regulation of DNA binding; go_process: protein amino acid phosphorylation; go_process: negative regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: regulation of protein import into nucleus; go_process: regulation of striated muscle development; go_process: regulation of progression through cell cycle; go_process: positive regulation of transcription, DNA-dependent; go_process: transforming growth factor beta receptor signaling pathway; go_process: positive regulation of isotype switching to IgA isotypes	transforming growth factor, beta 1
TGFB2_E226_R	1265	0.06962812	1823.208	143.931	0.3623681	19	106.5034	0.1476045	4242.544	751.9734	0.008555418	30	228.9936	0.1394741	5507.448	908.8554	0.0001974122	23	332.1865	0.2416241	347.5233	142.5842	0.788669	20	24.8771	0.115263	4078.764	544.407	0.01403539	27	219.4016	0.2280755	4373.216	1321.672	0.0005244287	24	260.1411	0.1352038	4391.687	702.2384	0.01730756	26	264.9136	0.1453234	4864.302	844.0958	0.02359191	33	217.2819	0.1348318	3712.722	594.1923	0.02922111	32	228.6263	0.09931259	5459.217	612.9766	0.0005340074	20	353.2478	TGFB2	TGFB2_E226_R	4507462	NM_003238.1	TGFB2	7042	1	36.1	216586717	226	Y	TTTCTGATCCTGCATCTGGTCACGGTCGCGCTCAGCCTGTCTACCTGCAGCACACT	MGC116892, TGF-beta2	go_component: axon; go_component: cell soma; go_component: extracellular region; go_component: extracellular region; go_function: cytokine activity; go_function: growth factor activity; go_function: growth factor activity; go_function: beta-amyloid binding; go_function: protein homodimerization activity; go_function: protein heterodimerization activity; go_function: transforming growth factor beta receptor binding; go_function: transforming growth factor beta receptor binding; go_process: catagen; go_process: cell growth; go_process: hemopoiesis; go_process: wound healing; go_process: cell death; go_process: angiogenesis; go_process: neurogenesis; go_process: cell proliferation; go_process: mesoderm formation; go_process: neuron development; go_process: eye development; go_process: dopamine biosynthesis; go_process: heart development; go_process: neutrophil chemotaxis; go_process: embryonic development; go_process: neutrophil chemotaxis; go_process: cellular morphogenesis; go_process: somatic stem cell division; go_process: hair follicle morphogenesis; go_process: cardioblast differentiation; go_process: positive regulation of cell growth; go_process: positive regulation of immune response; go_process: negative regulation of immune response; go_process: positive regulation of neuron apoptosis; go_process: positive regulation of heart contraction; go_process: negative regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: negative regulation of keratinocyte differentiation; go_process: positive regulation of progression through cell cycle	transforming growth factor, beta 2
TGFB2_P632_F	5074	0.06160397	5631.912	376.2895	3.763081E-05	17	219.5003	0.07198505	9183.259	720.0917	1.092735E-09	28	516.5736	0.03883256	13318.01	542.1073	5.338997E-21	23	555.8621	0.03397161	5889.664	210.6341	0.00200295	32	177.5575	0.04066589	9546.621	408.9174	1.722449E-10	46	642.5056	0.05345853	10135.54	578.0804	5.800338E-14	31	674.4213	0.04554914	11511.84	554.1505	2.875935E-12	28	717.6053	0.04640575	13691.32	671.1415	2.670779E-12	32	521.2688	0.06178691	8028.074	535.282	9.605741E-08	36	365.6884	0.05289759	12503.63	703.9383	1.520209E-18	29	417.4816	TGFB2	TGFB2_P632_F	4507462	NM_003238.1	TGFB2	7042	1	36.1	216585859	-632	Y	CGTGGAGTAACCAAGCGGGTCAGCGCGCGCCCGCCAGGGTGTAGGCCACGG	MGC116892, TGF-beta2	go_component: axon; go_component: cell soma; go_component: extracellular region; go_component: extracellular region; go_function: cytokine activity; go_function: growth factor activity; go_function: growth factor activity; go_function: beta-amyloid binding; go_function: protein homodimerization activity; go_function: protein heterodimerization activity; go_function: transforming growth factor beta receptor binding; go_function: transforming growth factor beta receptor binding; go_process: catagen; go_process: cell growth; go_process: hemopoiesis; go_process: wound healing; go_process: cell death; go_process: angiogenesis; go_process: neurogenesis; go_process: cell proliferation; go_process: mesoderm formation; go_process: neuron development; go_process: eye development; go_process: dopamine biosynthesis; go_process: heart development; go_process: neutrophil chemotaxis; go_process: embryonic development; go_process: neutrophil chemotaxis; go_process: cellular morphogenesis; go_process: somatic stem cell division; go_process: hair follicle morphogenesis; go_process: cardioblast differentiation; go_process: positive regulation of cell growth; go_process: positive regulation of immune response; go_process: negative regulation of immune response; go_process: positive regulation of neuron apoptosis; go_process: positive regulation of heart contraction; go_process: negative regulation of cell proliferation; go_process: positive regulation of cell proliferation; go_process: negative regulation of keratinocyte differentiation; go_process: positive regulation of progression through cell cycle	transforming growth factor, beta 2
TGFB3_E58_R	1269	0.8304819	619.2795	3523.804	0.01088536	30	159.6289	0.9739622	709.6214	30284.5	3.678E-38	24	1646.49	0.9753419	673.0982	30579.61	3.678E-38	27	1200.985	0.6962551	523.0085	1428.083	0.437861	27	84.63866	0.9693788	579.6217	21514.87	3.678E-38	35	1411.851	0.9655175	651.2022	21033.85	3.678E-38	32	1638.167	0.9712541	699.947	27028.28	3.678E-38	25	1625.797	0.9727392	699.0762	28513.26	3.678E-38	24	1229.513	0.9446954	693.2895	13550.72	3.007159E-22	24	1083.917	0.9732621	689.5618	28740.15	3.678E-38	23	1064.502	TGFB3	TGFB3_E58_R	4507464	NM_003239.1	TGFB3	7043	14	36.1	75517184	58	N	CAGGAAGCGCTGGCAACCCTGAGGACGAAGAAGCGGACTGTGTGCCTT	FLJ16571, TGF-beta3	transforming growth factor-beta 3; go_function: growth factor activity; go_function: transforming growth factor beta receptor binding; go_process: cell growth; go_process: cell proliferation; go_process: cell-cell signaling; go_process: organ morphogenesis; go_process: signal transduction; go_process: regulation of progression through cell cycle	transforming growth factor, beta 3
TGFBI_P173_F	5091	0.1720521	2412.537	522.1191	0.1120451	24	95.12245	0.4924919	4919.34	4870.828	1.812959E-09	28	343.192	0.4796941	5366.995	5040.276	1.510081E-11	24	408.8969	0.04034991	4800.386	206.044	0.01537547	22	228.0879	0.4967014	4915.069	4949.332	2.690566E-10	35	258.4635	0.6409582	4435.98	8097.59	2.250375E-19	40	408.9946	0.4747224	5357.97	4932.668	7.11974E-09	31	356.606	0.4669885	5920.072	5274.379	1.712372E-07	32	412.241	0.6046792	3614.676	5681.936	3.786615E-09	28	517.7252	0.4751513	5113.234	4719.599	4.173395E-10	34	360.1683	TGFBI	TGFBI_P173_F	4507466	NM_000358.1	TGFBI	7045	5	36.1	135392424	-173	Y	ACTGAGCACGGGCACAGTGCGGGAGCGGGTGGGTGCCCAGGGCAG	CSD, CDB1, CDG2, CSD1, CSD2, CSD3, LCD1, BIGH3, CDGG1	corneal dystrophy; kerato-epithelin; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: integrin binding; go_process: cell adhesion; go_process: sensory perception; go_process: visual perception; go_process: cell proliferation; go_process: negative regulation of cell adhesion	transforming growth factor, beta-induced, 68kDa
TGFBI_P31_R	5310	0.04699498	7828.021	390.9499	1.497742E-09	41	281.1833	0.07371546	11161.86	896.2396	1.97042E-14	32	579.2581	0.05595158	12971.23	774.702	1.228474E-20	29	977.7444	0.03507465	6848.421	252.5724	0.0002046813	25	253.63	0.07598332	12016.02	996.3191	3.456401E-18	27	616.4911	0.1620685	10767.19	2101.877	1.774382E-20	32	690.4675	0.09373529	11146.73	1163.253	8.776137E-13	28	674.7087	0.08623474	14177.76	1347.434	2.07867E-14	31	801.8069	0.09177567	8765.495	895.8544	6.736446E-10	27	539.0227	0.04019165	13774.04	580.9708	4.651659E-22	23	828.1327	TGFBI	TGFBI_P31_R	4507466	NM_000358.1	TGFBI	7045	5	36.1	135392566	-31	Y	GCTTACTTAACCTGGCCCGGGCGGCGGAGGCGCTCTCACTTCCCTGGAGCC	CSD, CDB1, CDG2, CSD1, CSD2, CSD3, LCD1, BIGH3, CDGG1	corneal dystrophy; kerato-epithelin; go_component: extracellular space; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: integrin binding; go_process: cell adhesion; go_process: sensory perception; go_process: visual perception; go_process: cell proliferation; go_process: negative regulation of cell adhesion	transforming growth factor, beta-induced, 68kDa
TGFBR3_E188_R	1085	0.05246317	4282.946	242.6747	0.00419713	36	129.8373	0.03957391	11404.2	474.0251	5.385833E-14	30	924.6118	0.04046995	15293.63	649.2549	3.402698E-28	25	1054.754	0.1644916	3877.784	783.1304	0.02657691	28	194.1296	0.04143162	13963.24	607.8469	5.144803E-23	23	788.5809	0.04508166	12551.75	597.2885	2.010054E-21	30	866.3188	0.03985293	15554.31	649.7653	1.263581E-22	23	760.0419	0.03776427	16671.16	658.2074	4.754171E-18	25	832.4289	0.04900603	8778.411	457.5168	5.00832E-09	30	771.1071	0.03612471	17646.1	665.0994	1.064296E-36	23	662.5999	TGFBR3	TGFBR3_E188_R	56682965	NM_003243.2	TGFBR3	7049	1	36.1	92124055	188	Y	GGCGGTGTGTCCAGCGGAGATCCACCCGCAGCAAGTTGGAGGAAAGCGGC	.	transforming growth factor, beta receptor III (betaglycan, 300kD); go_component: integral to membrane; go_function: receptor activity; go_function: glycosaminoglycan binding; go_process: development; go_process: signal transduction; go_process: transforming growth factor beta receptor signaling pathway	transforming growth factor, beta receptor III (betaglycan, 300kDa)
TGFBR3_P429_F	5095	0.05700985	5303.666	326.6865	0.0001462864	28	164.0327	0.03237579	12108.24	408.476	1.404414E-15	26	849.7932	0.04210782	12461.33	552.1813	2.139547E-18	31	538.5754	0.2295468	371.5094	140.4803	0.7844937	18	25.33343	0.04772693	9851.52	498.7598	2.362333E-11	29	527.9418	0.03463174	10050.31	364.1336	3.635277E-13	35	772.8627	0.03498708	10786.1	394.6817	1.695351E-10	28	527.9346	0.04164821	12243.38	536.4207	9.982236E-10	36	637.5522	0.04383161	8460.993	392.4435	2.776051E-08	28	620.8228	0.05161393	13662.89	749.0165	3.053525E-22	35	563.6159	TGFBR3	TGFBR3_P429_F	56682965	NM_003243.2	TGFBR3	7049	1	36.1	92124672	-429	Y	CGGGGACTCGCTCCCTCAAACGAGGTCCTTTGAACTTTCCAGGGCTCC	.	transforming growth factor, beta receptor III (betaglycan, 300kD); go_component: integral to membrane; go_function: receptor activity; go_function: glycosaminoglycan binding; go_process: development; go_process: signal transduction; go_process: transforming growth factor beta receptor signaling pathway	transforming growth factor, beta receptor III (betaglycan, 300kDa)
THBS1_E207_R	3972	0.04703142	5609.392	281.773	5.796948E-05	29	191.7481	0.09577686	10510.85	1123.92	2.043976E-13	26	611.7459	0.07803575	12834.12	1094.754	3.220398E-21	23	854.5721	0.0990032	4063.55	457.4986	0.03274225	33	216.2094	0.06296123	11339.08	768.6111	1.148878E-15	35	649.9493	0.1065611	13835.75	1662.128	2.899E-30	33	647.7548	0.07320184	11386.93	907.2786	9.484135E-13	27	974.2565	0.08472021	13864.75	1292.606	1.011657E-13	20	610.6617	0.0937941	9372.153	980.3866	2.059101E-11	27	622.1522	0.07352761	13647.26	1091.024	2.633573E-23	36	566.1452	THBS1	THBS1_E207_R	40317625	NM_003246.2	THBS1	7057	15	36.1	37660779	207	Y	CCGGGACATCCACCTGGAGCGCTGAGGCTTCAGTCCCTCTGGTGGACC	TSP, THBS, TSP1	thrombospondin-1p180; go_component: extracellular region; go_function: heparin binding; go_function: protein binding; go_function: calcium ion binding; go_function: structural molecule activity; go_function: signal transducer activity; go_function: endopeptidase inhibitor activity; go_process: cell motility; go_process: cell adhesion; go_process: development; go_process: blood coagulation; go_process: nervous system development	thrombospondin 1 precursor
THBS1_P500_F	2110	0.1491371	4087.565	733.9857	0.001866291	39	149.7209	0.04185095	8203.49	362.6878	2.820668E-07	29	443.1837	0.04424613	11384.83	531.6841	2.671805E-15	30	605.2473	0.4959442	1365.63	1442.044	0.2363183	27	72.17018	0.04577343	10066.91	487.6977	8.156475E-12	28	845.7022	0.0482017	13213.5	674.2323	4.981288E-24	26	722.2502	0.05191129	12772.86	704.8355	2.04882E-15	28	800.0816	0.05540516	14409.38	851.0467	6.52132E-14	28	869.6485	0.06098873	8894.377	584.1843	1.616113E-09	28	397.7777	0.05326285	12168.93	690.2422	1.527573E-17	24	463.3904	THBS1	THBS1_P500_F	40317625	NM_003246.2	THBS1	7057	15	36.1	37660072	-500	Y	GTGGAGGAGAGTCAGCGAGGGCCCGAGGGGCAGGTACTTTAACGAATG	TSP, THBS, TSP1	thrombospondin-1p180; go_component: extracellular region; go_function: heparin binding; go_function: protein binding; go_function: calcium ion binding; go_function: structural molecule activity; go_function: signal transducer activity; go_function: endopeptidase inhibitor activity; go_process: cell motility; go_process: cell adhesion; go_process: development; go_process: blood coagulation; go_process: nervous system development	thrombospondin 1 precursor
THBS2_E129_F	4189	0.04926702	6448.422	339.3395	1.622209E-06	31	176.9795	0.09199944	9349.399	957.4218	1.702063E-10	16	362.2958	0.1169505	9183.378	1229.485	1.466157E-11	22	442.758	0.04552048	5063.54	246.2565	0.009156039	30	225.6039	0.106855	8013.886	970.7379	1.562014E-08	33	377.185	0.1128762	8588.12	1105.462	2.367249E-11	21	531.1866	0.1293052	8404.716	1263.019	7.85212E-08	23	346.8997	0.1079087	9442.903	1154.324	9.703468E-07	31	309.1752	0.1043195	7412.4	874.9661	2.988949E-07	27	465.3027	0.1072671	9743.941	1182.808	1.564238E-12	27	306.8315	THBS2	THBS2_E129_F	40317627	NM_003247.2	THBS2	7058	6	36.1	169395933	129	Y	CTGTGCAGGGCTGTCAATCAGACACACGAGGAAGCACGTTTAATTCATTCCTTCG	TSP2	go_component: extracellular region; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: calcium ion binding; go_function: heparin binding; go_function: structural molecule activity; go_process: cell adhesion	thrombospondin 2 precursor
THBS2_P605_R	2907	0.1263807	3535.498	525.923	0.01316011	28	164.5126	0.2167722	11568.76	3229.536	5.261954E-22	28	1064.264	0.2405991	11976.25	3826.089	1.129538E-27	26	1187.39	0.4331722	3924.163	3075.282	0.0002627818	23	203.3381	0.1670185	13636.85	2754.332	1.996426E-29	31	1029.574	0.1506556	11434.4	2045.955	1.42632E-22	21	943.8139	0.2028787	11254.52	2889.886	4.856625E-17	24	1124.983	0.1418553	12395.74	2065.604	1.796909E-12	38	601.7703	0.3666624	5889.673	3467.641	2.856462E-09	28	507.3553	0.12479	17351.27	2488.253	3.678E-38	18	1581.391	THBS2	THBS2_P605_R	40317627	NM_003247.2	THBS2	7058	6	36.1	169396667	-605	N	AACCTGACGTGCAGGCACAGAGCAAGGACTCGAGAGAACGAGAAGCAGTGGCAGCAGCT	TSP2	go_component: extracellular region; go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_function: calcium ion binding; go_function: heparin binding; go_function: structural molecule activity; go_process: cell adhesion	thrombospondin 2 precursor
THPO_E483_F	1276	0.2750157	4567.262	1770.48	1.054134E-05	29	208.295	0.869423	2264.527	15743.77	4.39438E-33	28	1292.146	0.8818018	2471.669	19185.59	3.678E-38	24	1276.239	0.6548591	1301.279	2658.74	0.07024395	27	147.2384	0.8648501	2124.089	14232.37	2.69388E-29	33	1380.481	0.8432872	2534.194	14174.86	1.861857E-35	30	1250.668	0.8809284	2506.146	19281.07	3.678E-38	32	926.7345	0.8726374	2780.17	19733.77	5.123102E-31	21	1101.923	0.8350986	2175.919	11525.78	1.675404E-20	42	818.7695	0.8640825	2802.887	18454.83	3.678E-38	23	1198.504	THPO	THPO_E483_F	40805872	NM_199228.1	THPO	7066	3	36.1	185578143	483	N	TCCCATTACCCTCTCCTTGCGCCCTGGCTTGCCTGGCCCAGCTTCC	ML, TPO, MGDF, MKCSF, MPLLG	isoform 2 precursor is encoded by transcript variant 2; megakaryocyte stimulating factor; myeloproliferative leukemia virus oncogene ligand; megakaryocyte growth and development factor; MPL ligand; megakaryocyte colony-stimulating factor; c-mpl ligand; go_component: extracellular space; go_function: hormone activity; go_function: cytokine activity; go_function: growth factor activity; go_process: development; go_process: cell proliferation	thrombopoietin isoform 2 precursor
THPO_P585_R	5322	0.590912	893.8356	1435.557	0.2496863	32	114.979	0.9601235	730.4221	19994.41	3.678E-38	33	1388.426	0.9621164	936.7706	26330.48	3.678E-38	27	1586.522	0.8412133	658.6118	4018.94	0.02591271	28	208.9181	0.9453288	1023.465	19426.02	3.678E-38	30	1363.863	0.927221	1243.276	17113.64	3.678E-38	38	1019.457	0.9478016	1043.848	20769.6	3.678E-38	32	1190.715	0.9511473	1358.993	28406.12	3.678E-38	31	923.661	0.9271559	913.6965	12902.27	7.287971E-21	40	975.2795	0.9576446	801.4909	20382.51	3.678E-38	32	1256.544	THPO	THPO_P585_R	40805872	NM_199228.1	THPO	7066	3	36.1	185579211	-585	N	TGTCAGGTGCGGGGCACATGTATGTGCGCACACGTGCACTGGGTTAAGCCTGAG	ML, TPO, MGDF, MKCSF, MPLLG	isoform 2 precursor is encoded by transcript variant 2; megakaryocyte stimulating factor; myeloproliferative leukemia virus oncogene ligand; megakaryocyte growth and development factor; MPL ligand; megakaryocyte colony-stimulating factor; c-mpl ligand; go_component: extracellular space; go_function: hormone activity; go_function: cytokine activity; go_function: growth factor activity; go_process: development; go_process: cell proliferation	thrombopoietin isoform 2 precursor
THY1_P149_R	5973	0.06461004	4634.723	327.0408	0.001242896	31	172.8535	0.137024	8576.197	1377.613	8.700605E-10	21	396.1649	0.1561944	9852.065	1842.198	1.03809E-14	37	469.5856	0.02585664	6419.431	173.045	0.0006859903	31	279.3369	0.1478696	8727.154	1531.77	3.771116E-11	34	591.2186	0.1648904	9589.679	1913.204	3.431733E-16	38	489.9486	0.1632114	9828.442	1936.493	1.197951E-11	24	716.1598	0.15894	10927.63	2083.955	4.4044E-10	22	756.0178	0.1405496	7510.693	1244.609	4.248277E-08	28	531.8177	0.1393503	9374.756	1534.085	1.723468E-12	27	462.3125	THY1	THY1_P149_R	19923361	NM_006288.2	THY1	7070	11	36.1	118799239	-149	Y	GGAAGGAAGAGAAGGCGGTCCCGCATTGGTGTGAGAGTGGCAGG	CD90	Thy-1 T-cell antigen; go_component: cytosol; go_component: growth cone; go_component: lipid raft; go_component: integral to plasma membrane; go_component: external side of plasma membrane; go_function: GPI anchor binding; go_function: protein binding; go_function: integrin binding; go_function: Rho GTPase activator activity; go_process: angiogenesis; go_process: cell-cell adhesion; go_process: mast cell activation; go_process: focal adhesion formation; go_process: retinal cone cell development; go_process: negative regulation of apoptosis; go_process: T cell receptor signaling pathway; go_process: negative regulation of axonogenesis; go_process: negative regulation of cell migration; go_process: positive regulation of GTPase activity; go_process: cytoskeleton organization and biogenesis; go_process: positive regulation of T cell activation; go_process: negative regulation of protein kinase activity; go_process: negative regulation of fibroblast proliferation; go_process: negative regulation of T cell receptor signaling pathway; go_process: positive regulation of peptidyl-tyrosine phosphorylation; go_process: positive regulation of release of sequestered calcium ion into cytosol	Thy-1 cell surface antigen
THY1_P20_R	5968	0.09155593	8664.975	883.3625	5.474239E-13	29	348.7606	0.1231448	9698.147	1376.044	3.913377E-12	30	511.1086	0.1200597	11823.83	1626.896	1.02172E-19	22	689.3292	0.1493092	6416.862	1143.808	6.267389E-05	35	373.1381	0.1333971	10178.93	1582.246	9.371408E-15	28	415.3648	0.1601734	10229.51	1970.063	2.617108E-18	33	570.7622	0.1474925	11230.7	1960.326	9.613503E-15	31	461.4794	0.1722006	11506.31	2414.369	1.510949E-11	28	705.4025	0.1631895	8379.065	1653.534	1.071816E-10	19	649.5486	0.120813	10958.01	1519.532	1.765948E-16	19	599.0744	THY1	THY1_P20_R	19923361	NM_006288.2	THY1	7070	11	36.1	118799110	-20	Y	CCGGTTGCTGCACCCAGCTCGGAGCCCGCAGTTTTCACCGGGGATGGAG	CD90	Thy-1 T-cell antigen; go_component: cytosol; go_component: growth cone; go_component: lipid raft; go_component: integral to plasma membrane; go_component: external side of plasma membrane; go_function: GPI anchor binding; go_function: protein binding; go_function: integrin binding; go_function: Rho GTPase activator activity; go_process: angiogenesis; go_process: cell-cell adhesion; go_process: mast cell activation; go_process: focal adhesion formation; go_process: retinal cone cell development; go_process: negative regulation of apoptosis; go_process: T cell receptor signaling pathway; go_process: negative regulation of axonogenesis; go_process: negative regulation of cell migration; go_process: positive regulation of GTPase activity; go_process: cytoskeleton organization and biogenesis; go_process: positive regulation of T cell activation; go_process: negative regulation of protein kinase activity; go_process: negative regulation of fibroblast proliferation; go_process: negative regulation of T cell receptor signaling pathway; go_process: positive regulation of peptidyl-tyrosine phosphorylation; go_process: positive regulation of release of sequestered calcium ion into cytosol	Thy-1 cell surface antigen
TIAM1_P117_F	5333	0.2720203	3862.282	1480.565	0.0003824529	34	191.4065	0.04413708	11455.22	533.5635	2.908845E-14	24	531.1356	0.07035918	7110.656	545.7332	3.279985E-06	31	307.5378	0.1095668	6267.244	783.4822	0.0002317515	32	177.1861	0.04434949	11365.13	532.0695	4.1456E-15	35	465.3843	0.07916269	8900.676	773.7716	2.632279E-11	26	383.3787	0.06720851	8585.675	625.811	4.073902E-07	34	348.9402	0.1039437	10095.75	1182.72	1.329701E-07	21	441.9179	0.0545686	9480.044	552.9429	1.069714E-10	32	533.314	0.08666624	6189.633	596.8232	6.770335E-05	33	198.5207	TIAM1	TIAM1_P117_F	4507500	NM_003253.1	TIAM1	7074	21	36.1	31853278	-117	Y	AACCCGCTCGTGGTCTGCCAATCGGAGCTGTCAGGGCCCCTCCGCC	.	human T-lymphoma invasion and metastasis inducing TIAM1 protein; go_function: protein binding; go_function: receptor signaling protein activity; go_function: Rho guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	T-cell lymphoma invasion and metastasis 1
TIAM1_P188_R	5330	0.141654	3724.321	631.1327	0.00649761	28	185.141	0.09657104	9182.857	992.2807	3.152217E-10	32	407.8439	0.1387426	10373.91	1687.275	1.087052E-15	28	569.7407	0.03983969	3240.935	138.6246	0.1371367	32	151.541	0.1129476	9745.474	1253.616	7.427854E-13	26	537.6129	0.1019376	9620.744	1103.385	5.43233E-14	21	584.4783	0.02819002	10322.27	302.3265	1.82776E-09	25	456.0541	0.1581389	10559.7	2002.365	2.120113E-09	22	691.6422	0.1879884	6504.665	1529.042	8.156784E-07	30	405.9791	0.07207209	10436.02	818.332	2.571185E-13	24	408.3713	TIAM1	TIAM1_P188_R	4507500	NM_003253.1	TIAM1	7074	21	36.1	31853349	-188	Y	GGAGCCCGTGGGAAACCGAGCTCCGATTGGGCCGCCTGACAATCGC	.	human T-lymphoma invasion and metastasis inducing TIAM1 protein; go_function: protein binding; go_function: receptor signaling protein activity; go_function: Rho guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	T-cell lymphoma invasion and metastasis 1
TIE1_E66_R	2941	0.0544049	3455.881	204.5879	0.03119093	28	268.397	0.6211143	4535.769	7599.499	1.273282E-14	20	586.9418	0.5726307	5827.822	7942.669	1.027596E-20	27	727.8849	0.03798022	3729.941	151.2048	0.07747736	24	319.2337	0.5243368	5656.892	6345.982	2.183597E-15	31	536.8136	0.6219211	4522.535	7603.842	4.435779E-18	27	752.9861	0.5539891	5834	7370.606	8.942161E-15	39	547.3821	0.5768567	6280.084	8697.747	2.156162E-13	22	736.3745	0.589815	4462.076	6559.918	5.35976E-13	24	482.0188	0.6387665	4608.894	8326.703	9.263183E-18	30	544.1791	TIE1	TIE1_E66_R	31543809	NM_005424.2	TIE1	7075	1	36.1	43539317	66	N	CCAGCTCGTCCTGGCTGGCCTGGGTCGGCCTCTGGAGTATGGTCTGGCGGGTGCCCC	TIE, JTK14	Tyrosine kinase with immunoglobulin and epidermal growth factor; tyrosine kinase with immunoglobulin and epidermal growth factor homology domains; tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1; receptor tyrosine kinase; go_component: integral to plasma membrane; go_function: ATP binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: signal transduction; go_process: mesoderm development; go_process: protein amino acid phosphorylation	tyrosine kinase with immunoglobulin-like and EGF-like domains 1
TIMP1_E254_R	1312	0.1401539	4433.156	738.8987	0.000657339	32	231.9239	0.137356	8773.142	1412.841	2.997261E-10	26	294.9686	0.1826352	9183.85	2074.42	1.366137E-13	25	390.3358	0.09567824	5314.153	572.8234	0.003092662	20	200.11	0.6090074	4395.372	7001.958	7.881306E-14	26	653.0875	0.5865688	5151.759	7451.102	1.340006E-19	33	548.6915	0.6801382	4331.497	9422.912	4.444378E-16	33	510.9823	0.6569934	4571.928	8948.595	6.884462E-11	11	678.9879	0.6592757	3543.923	7050.714	5.67562E-12	37	379.999	0.5944844	5537.185	8264.092	2.538309E-20	21	695.5477	TIMP1	TIMP1_E254_R	73858576	NM_003254.2	TIMP1	7076	X	36.1	47326888	254	N	CTTGGGTGCTGGCCACCAGGCCCGTGCACTCCCGTGCCAGATGCCTGTCT	EPA, EPO, HCI, CLGI, TIMP, FLJ90373	erythroid potentiating activity; tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor); fibroblast collagenase inhibitor; go_component: extracellular matrix (sensu Metazoa); go_function: enzyme inhibitor activity; go_function: metalloendopeptidase inhibitor activity; go_function: metalloendopeptidase inhibitor activity; go_process: development; go_process: erythrocyte maturation; go_process: positive regulation of cell proliferation; go_process: negative regulation of membrane protein ectodomain proteolysis	tissue inhibitor of metalloproteinase 1 precursor
TIMP1_P615_R	5342	0.393521	1086.015	769.5598	0.4003057	22	77.14644	0.8826097	812.3799	6859.815	6.878966E-06	22	370.1844	0.8786372	1112.817	8780.503	2.103583E-10	21	490.2844	0.2139865	364.1567	126.3633	0.7885908	30	15.81248	0.9225397	828.1125	11053.66	4.549644E-15	40	492.4819	0.9251506	806.9628	11210.2	9.682296E-18	34	609.3306	0.9421273	722.4374	13388.71	5.881944E-17	29	689.8604	0.9176427	1200.182	14486.92	1.021843E-14	27	523.7827	0.9050426	699.4777	7619.854	2.626712E-07	35	602.9891	0.9230722	939.0537	12467.82	3.935953E-19	39	463.1545	TIMP1	TIMP1_P615_R	73858576	NM_003254.2	TIMP1	7076	X	36.1	47326019	-615	N	CCATATTTCCTCATCCGTAAAACGGGAATAAGAACCGGTACCCATCTCAG	EPA, EPO, HCI, CLGI, TIMP, FLJ90373	erythroid potentiating activity; tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor); fibroblast collagenase inhibitor; go_component: extracellular matrix (sensu Metazoa); go_function: enzyme inhibitor activity; go_function: metalloendopeptidase inhibitor activity; go_function: metalloendopeptidase inhibitor activity; go_process: development; go_process: erythrocyte maturation; go_process: positive regulation of cell proliferation; go_process: negative regulation of membrane protein ectodomain proteolysis	tissue inhibitor of metalloproteinase 1 precursor
TIMP2_E394_R	1317	0.07069442	3105.566	243.8548	0.05637702	31	112.0135	0.02858803	10610.91	315.2151	8.301865E-12	21	838.0657	0.05316816	13373.69	756.5982	7.20633E-22	29	579.3198	0.03298356	5266.855	183.0559	0.007120182	27	308.5636	0.05401874	10929.11	629.7994	3.090368E-14	24	675.5841	0.07091508	10929.02	841.8218	5.46746E-17	41	500.2107	0.03115132	12496.76	405.0226	4.40158E-14	30	673.8608	0.04612216	16272.5	791.6475	1.739507E-17	26	989.7633	0.05966993	9441.5	605.4689	9.965687E-11	34	490.9489	0.07953289	10311.53	899.6074	3.274186E-13	19	415.7178	TIMP2	TIMP2_E394_R	89043088	XM_941104.1	TIMP2	7077	17	36.1	74432673	394	Y	TGCAAAACGCCTGTTGCGGGTGCACCGGGGAGCAGCTGCAGGCGTCG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Metalloproteinase inhibitor 2 precursor (TIMP-2) (Tissue inhibitor of metalloproteinases-2) (CSC-21K)
TIMP2_P267_F	5345	0.009710317	23169.56	228.1704	3.678E-38	25	1343.755	0.0992291	7046.666	787.2781	3.979625E-06	24	373.2514	0.05003581	9204.777	490.0944	5.578747E-10	26	408.2464	0.01044249	17357.97	184.2285	1.529271E-25	35	1252.975	0.07036203	7107.549	545.5219	3.160715E-06	26	325.1193	0.1533653	6963.605	1279.551	3.694526E-08	36	227.8828	0.08767557	6896.346	672.358	7.027393E-05	30	375.8199	0.07718537	9090.047	768.667	7.111963E-06	37	362.8058	0.1621422	6154.652	1210.4	9.608236E-06	31	277.8268	0.03346471	7813.666	273.9978	7.615784E-07	24	315.9962	TIMP2	TIMP2_P267_F	89043088	XM_941104.1	TIMP2	7077	17	36.1	74433334	-267	Y	GGTCCCCGCTGCGTGGCCTTCTGCGCCCGGGGTCCCTGACTCAGCGCG	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Metalloproteinase inhibitor 2 precursor (TIMP-2) (Tissue inhibitor of metalloproteinases-2) (CSC-21K)
TIMP3_P1114_R	2913	0.8681324	662.2036	5017.863	0.0001231106	19	220.9728	0.9664108	611.9213	20483	3.678E-38	33	1239.055	0.977204	572.8281	28842.35	3.678E-38	26	1118.033	0.8811779	720.8598	6087.449	0.0004158421	43	279.1932	0.9701915	469.6344	18540.16	3.678E-38	29	1778.866	0.9709728	601.5118	23465.88	3.678E-38	25	2118.28	0.97023	601.4549	22861.01	3.678E-38	35	1431.553	0.9760946	628.8752	29761.11	3.678E-38	26	1020.155	0.9267312	729.0851	10486.58	1.774776E-13	24	564.6276	0.9684237	583.7682	20970.67	3.678E-38	25	1831.836	TIMP3	TIMP3_P1114_R	75905820	NM_000362.4	TIMP3	7078	22	36.1	31525688	-1114	N	GAATCTCTCAAATTCCACCACGTATGCCCTCATTCAACCTGGATCCT	SFD, K222, K222TA2, HSMRK222	tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory); MIG-5 protein; go_component: extracellular matrix (sensu Metazoa); go_component: extracellular matrix (sensu Metazoa); go_function: enzyme inhibitor activity; go_function: metalloendopeptidase inhibitor activity; go_process: visual perception; go_process: sensory perception; go_process: induction of apoptosis by extracellular signals; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	tissue inhibitor of metalloproteinase 3 precursor
TIMP3_P690_R	2910	0.7361407	1002.837	3076.804	0.01261974	30	153.2306	0.9645548	715.2	22183.7	3.678E-38	44	1322.486	0.9666172	713.6432	23559.48	3.678E-38	31	1538.061	0.7087175	580.5409	1655.819	0.3656144	17	135.5854	0.9711435	600.9393	23589.62	3.678E-38	30	1468.087	0.9654513	865.9184	26992.25	3.678E-38	28	1406.947	0.9634048	753.554	22470.65	3.678E-38	29	1615.475	0.9730457	772.7962	31507.84	3.678E-38	27	1065.406	0.9494918	748.8585	15957.5	3.853055E-31	28	1313.366	0.9752522	600.9352	27622.22	3.678E-38	33	1394.902	TIMP3	TIMP3_P690_R	75905820	NM_000362.4	TIMP3	7078	22	36.1	31526112	-690	N	AATACCATCTCTCACGAATTCTTCGGCCTCTGCTGTCCCAATGTCACTTGTCTGA	SFD, K222, K222TA2, HSMRK222	tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory); MIG-5 protein; go_component: extracellular matrix (sensu Metazoa); go_component: extracellular matrix (sensu Metazoa); go_function: enzyme inhibitor activity; go_function: metalloendopeptidase inhibitor activity; go_process: visual perception; go_process: sensory perception; go_process: induction of apoptosis by extracellular signals; go_process: transmembrane receptor protein tyrosine kinase signaling pathway	tissue inhibitor of metalloproteinase 3 precursor
TIMP3_seq_7_S38_F	6126	0.07713008	3410.19	293.3688	0.02858339	29	239.6927	0.08212728	7729.16	700.5194	4.718306E-07	31	411.5651	0.05541383	11079.67	655.8518	8.086618E-15	21	530.9781	0.1168065	3047.001	416.2055	0.1254564	35	139.3818	0.07845937	8375.844	721.6279	9.509542E-09	28	749.0031	0.1608321	8335.596	1616.738	5.502784E-12	28	515.6943	0.08213884	8793.197	795.8468	1.050114E-07	39	386.9008	0.07089788	11335.2	872.5967	6.995547E-09	33	453.9464	0.08069407	7689.448	683.7357	2.110114E-07	24	495.4105	0.07195368	8952.675	701.8758	9.725767E-10	38	428.031	TIMP3	TIMP3_seq_7_S38_F	.	.	.	.	22	36.1	31527437	.	Y	GAGGGCTCCGCTCCGAGGACCCAGCGGCAAGCACCGGTCCCGGGC	.	.	.
TJP1_P326_R	5275	0.09443732	11046.62	1162.434	1.132013E-21	30	456.9733	0.05096512	11160.51	604.7125	1.004149E-13	37	689.0798	0.07656335	12674.1	1059.118	1.347276E-20	25	660.7867	0.05084566	8186.486	443.9024	2.854384E-06	24	356.5611	0.09277776	10626.12	1096.915	1.175738E-14	28	644.8972	0.0828157	11941.47	1087.266	5.157288E-21	20	579.3018	0.08890284	12322.03	1212.114	1.504404E-15	33	764.7707	0.07722779	15011.01	1264.657	7.209033E-16	36	598.8101	0.09312283	9188.12	953.7522	6.143134E-11	43	538.0454	0.06189062	13914.11	924.5639	1.224153E-23	25	696.4551	TJP1	TJP1_P326_R	28416401	NM_175610.1	TJP1	7082	15	36.1	27902324	-326	Y	CATGCATGAGTGCGGCTGGAAAGGCCGGCAGAGCCGATACCCGACAGTTGTTT	ZO-1, DKFZp686M05161	isoform b is encoded by transcript variant 2; zona occludens 1; zonula occludens 1 protein; tight junction protein ZO-1; go_component: membrane; go_component: septate junction; go_component: membrane fraction; go_component: tight junction; go_function: protein binding; go_function: protein binding; go_process: intercellular junction assembly	tight junction protein 1 isoform b
TJP1_P390_F	5268	0.0422679	4641.036	209.2377	0.001719205	20	285.4293	0.08068622	9883.45	876.2262	1.907016E-11	31	652.6602	0.05234207	11644.87	648.7052	2.498032E-16	31	561.5546	0.05543774	3431.323	207.2585	0.1032663	22	83.57014	0.06852452	8186.336	609.5891	3.524078E-08	33	444.6515	0.07286565	9183.981	729.6497	6.86432E-12	39	407.7415	0.08660201	9590.866	918.8201	2.934998E-09	23	556.5311	0.06012281	12147.01	783.4263	5.876598E-10	29	751.1321	0.0993688	7512.042	839.8548	2.301381E-07	37	497.188	0.0581499	9840.252	613.712	1.901762E-11	15	1037.17	TJP1	TJP1_P390_F	28416401	NM_175610.1	TJP1	7082	15	36.1	27902388	-390	Y	AAACAGCATGGTCACGGCTGTCACCGCGTGCCTCGGCGTTGTTCCCACGGA	ZO-1, DKFZp686M05161	isoform b is encoded by transcript variant 2; zona occludens 1; zonula occludens 1 protein; tight junction protein ZO-1; go_component: membrane; go_component: septate junction; go_component: membrane fraction; go_component: tight junction; go_function: protein binding; go_function: protein binding; go_process: intercellular junction assembly	tight junction protein 1 isoform b
TJP2_P330_R	2117	0.02363129	10428.58	254.8258	2.132104E-16	30	437.6447	0.022586	14167.19	329.6851	4.354733E-21	37	982.7637	0.02199791	17210.77	389.3659	9.99277E-35	23	807.6427	0.03915668	4074.473	170.1199	0.04839503	33	148.8794	0.02640673	14329.22	391.3631	1.64535E-23	19	970.6623	0.02667475	15685.11	432.6034	7.226805E-33	25	1011.791	0.03305012	12942.71	445.7967	3.327684E-15	28	844.4444	0.02402056	20097.1	497.0861	8.820693E-26	23	642.0654	0.03021764	9336.275	294.0268	7.826856E-10	22	746.4118	0.01841546	18898.12	356.4227	3.678E-38	26	906.697	TJP2	TJP2_P330_R	42518069	NM_004817.2	TJP2	9414	9	36.1	70978579	-330	Y	GCGGACAGTCGGGCCAGCAGCGCCCGGAGCTCACTCCAGGTCTCC	ZO2, X104, ZO-2, MGC26306	isoform 1 is encoded by transcript variant 1; Friedreich ataxia region gene X104 (tight junction protein ZO-2); go_component: nucleus; go_component: membrane; go_component: tight junction; go_component: integral to plasma membrane; go_function: protein binding; go_function: guanylate kinase activity	tight junction protein 2 (zona occludens 2) isoform 1
TJP2_P518_F	2114	0.05864536	2329.167	151.3344	0.2088684	19	173.7526	0.1761449	5650.764	1229.546	8.258146E-05	19	778.3129	0.1683774	8788.777	1799.697	5.747691E-12	24	514.5436	0.05540445	2143.077	131.5658	0.3562131	25	126.7845	0.1301301	7183.91	1089.652	3.015898E-07	28	505.3192	0.1843852	7410.963	1697.996	5.426151E-10	37	457.9396	0.1601123	7728.295	1492.35	3.94511E-07	29	534.1545	0.1973617	8981.284	2233.009	1.613402E-07	23	204.662	0.1382833	5335.903	872.3222	0.0003717496	29	357.7525	0.3641996	8321.94	4824.261	2.294079E-18	28	587.0879	TJP2	TJP2_P518_F	42518069	NM_004817.2	TJP2	9414	9	36.1	70978391	-518	Y	GCTGAGAAATGTGGGGTACAAGGCCGTGTATGTGTTGGTTAGCCGGG	ZO2, X104, ZO-2, MGC26306	isoform 1 is encoded by transcript variant 1; Friedreich ataxia region gene X104 (tight junction protein ZO-2); go_component: nucleus; go_component: membrane; go_component: tight junction; go_component: integral to plasma membrane; go_function: protein binding; go_function: guanylate kinase activity	tight junction protein 2 (zona occludens 2) isoform 1
TK1_E47_F	1097	0.3949	1170.224	828.9729	0.3516943	27	71.78119	0.2538066	2977.799	1046.868	0.04715124	38	177.5641	0.1980248	3865.375	979.1354	0.01012789	30	140.5578	0.1796155	1395.944	327.523	0.4971659	30	69.69289	0.1978476	3289.141	835.9176	0.03476093	22	128.0743	0.2076892	3575.792	963.5388	0.01009797	26	97.90317	0.2529612	3268.962	1140.793	0.05004811	32	145.0094	0.1977098	3665.683	927.9838	0.08820749	22	173.9403	0.2460665	2617.2	886.8314	0.1025595	28	227.3144	0.1806642	4074.253	920.4259	0.007131136	28	158.7536	TK1	TK1_E47_F	4507518	NM_003258.1	TK1	7083	17	36.1	73694679	47	Y	AGGTTAATGCAGCTCATTGCGCCTCCGGGAAGTTCACGAACCCGAGTACTCTC	TK2	Thymidine kinase-1; go_component: cytoplasm; go_function: ATP binding; go_function: kinase activity; go_function: nucleotide binding; go_function: transferase activity; go_function: thymidine kinase activity; go_process: DNA replication; go_process: nucleobase, nucleoside, nucleotide and nucleic acid metabolism	thymidine kinase 1, soluble
TK1_P62_R	5348	0.04669532	3777.54	189.9319	0.01627472	30	109.1012	0.03954967	10350.88	430.3489	1.713762E-11	32	556.2758	0.02380246	13265.31	325.8841	3.753221E-20	39	584.8782	0.04363422	2950.768	139.1914	0.1831737	34	115.7213	0.02868223	10134.23	302.2086	1.51305E-11	20	620.0422	0.03736409	10268.22	402.4357	7.577632E-14	30	766.3209	0.029833	10360.12	321.6525	1.440775E-09	29	654.4102	0.02694852	12807.44	357.4695	2.539737E-10	21	580.9965	0.04828122	8196.09	420.8653	7.665435E-08	27	539.47	0.02334405	12158.11	292.9937	2.085811E-16	34	490.9478	TK1	TK1_P62_R	4507518	NM_003258.1	TK1	7083	17	36.1	73694788	-62	Y	CGTGCTGGCCAATCACGAGCCGGCCCCGCCGCCATGGGGCCAATCAGCGCCC	TK2	Thymidine kinase-1; go_component: cytoplasm; go_function: ATP binding; go_function: kinase activity; go_function: nucleotide binding; go_function: transferase activity; go_function: thymidine kinase activity; go_process: DNA replication; go_process: nucleobase, nucleoside, nucleotide and nucleic acid metabolism	thymidine kinase 1, soluble
TM7SF3_P1068_R	2122	0.3062552	1701.818	795.4164	0.2046037	24	115.6483	0.928013	1089.773	15337.84	2.490328E-27	24	1066.448	0.8758171	1974.019	14627.31	1.052477E-30	26	925.1816	0.08343586	1315.702	128.8729	0.569779	23	81.08428	0.9064463	1171.703	12321.6	1.301112E-19	37	1027.484	0.9346049	1011.321	15882.63	2.749765E-36	19	1580.606	0.9155005	1192.831	14007.04	8.53273E-20	33	817.5267	0.9026024	1509.099	14911.82	3.684314E-16	27	739.6623	0.9125425	701.9616	8367.767	1.065272E-08	24	427	0.9182203	1287.09	15574.21	7.040778E-31	23	844.2972	TM7SF3	TM7SF3_P1068_R	7706574	NM_016551.1	TM7SF3	51768	12	36.1	27059473	-1068	N	GGAAGAGGGACTGGGCTCAACTCCGAATACAGCGTGGGCAAGAGGGA	.	seven transmembrane protein TM7SF3; go_component: integral to membrane	transmembrane 7 superfamily member 3
TMEFF1_E180_R	3979	0.3765342	3816.919	2365.573	1.939648E-05	34	174.3396	0.04662281	9563.71	472.5825	5.977673E-10	30	378.027	0.03938813	11583.9	479.077	1.074937E-15	27	463.2321	0.3426092	1804.633	992.6282	0.2384286	23	95.53735	0.05373676	7549.784	434.4189	9.268329E-07	32	770.1985	0.05853527	9320.947	585.7444	7.141138E-12	30	488.7161	0.04661646	9605.139	474.5407	1.637292E-08	32	437.7384	0.04537039	11592.62	555.7114	8.514855E-09	34	403.0027	0.05628717	8593.268	518.5046	8.814808E-09	39	316.0027	0.08522257	9753.381	917.9615	6.126671E-12	25	428.0043	TMEFF1	TMEFF1_E180_R	29568104	NM_003692.2	TMEFF1	8577	9	36.1	102275718	180	Y	CTCCGCTCGCCTTCTGCTGCTACACGTCGGTGCTTCTGCTCTTCGCCTTCTCTCT	orf, H7365, C9orf2	synonyms: orf, H7365, C9orf2	transmembrane protein with EGF-like and two follistatin-like domains 1
TMEFF1_P234_F	2129	0.3144628	4253.708	1997.09	1.486581E-05	31	247.7078	0.1225326	10538.7	1485.625	2.383003E-14	29	730.1234	0.1255777	11746.29	1701.271	1.044902E-19	21	812.0818	0.1006021	3910.796	448.6273	0.04128796	29	163.5295	0.13806	10202.75	1650.229	5.410524E-15	35	575.202	0.1535234	9139.291	1675.707	3.072201E-14	34	674.2015	0.1191544	9550.926	1305.508	6.901421E-10	21	1001.887	0.08835763	13700.79	1337.592	1.67231E-13	32	840.663	0.1652315	8624.254	1726.852	2.074664E-11	22	508.3028	0.137734	9875.216	1593.391	7.636722E-14	26	524.7911	TMEFF1	TMEFF1_P234_F	29568104	NM_003692.2	TMEFF1	8577	9	36.1	102275304	-234	Y	GGACACAAAGGGAAGGCGAGGAGGCGAGCAAGAGGCTGGGCCTGCCT	orf, H7365, C9orf2	synonyms: orf, H7365, C9orf2	transmembrane protein with EGF-like and two follistatin-like domains 1
TMEFF1_P626_R	2136	0.2392638	1989.116	657.0608	0.1689727	21	97.88685	0.5813692	4494.052	6379.943	1.078877E-11	28	755.7904	0.5285747	6587.139	7497.799	1.011651E-21	25	778.0313	0.2293203	3859.989	1178.318	0.01458478	36	174.5395	0.5498873	5277.404	6569.391	5.615413E-15	24	956.7581	0.5782473	5423.251	7572.697	6.656353E-21	34	876.9217	0.4741309	6663.879	6098.406	9.042132E-14	24	657.7366	0.4657404	7669.72	6773.246	1.934702E-12	25	828.0362	0.480648	4536.625	4291.088	3.105286E-08	25	531.5225	0.5414643	7347.417	8794.32	3.472848E-28	29	905.5051	TMEFF1	TMEFF1_P626_R	29568104	NM_003692.2	TMEFF1	8577	9	36.1	102274912	-626	Y	ACAAGTCACCTTTACCTCTTCCGTGACTCAGTTTCTTCCACCTAAAAAC	orf, H7365, C9orf2	synonyms: orf, H7365, C9orf2	transmembrane protein with EGF-like and two follistatin-like domains 1
TMEFF2_E94_R	3980	0.1519583	5892.11	1073.71	7.411624E-07	25	232.6389	0.1695919	11799.24	2430.147	2.728455E-20	9	675.9654	0.1277028	13895.1	2048.86	3.371478E-28	26	698.9623	0.0505548	5538.897	300.2525	0.0034006	25	204.2669	0.1399356	13177.87	2160.359	1.29127E-25	31	746.1028	0.1330816	13391.47	2071.089	4.047809E-30	26	1134.099	0.1553273	11482.28	2129.873	9.793043E-16	26	723.4337	0.1329873	16196.92	2499.713	4.156533E-21	21	947.3577	0.1662465	10505.44	2114.675	3.003812E-17	28	849.334	0.1128413	16230.48	2077.139	1.101799E-36	24	667.0109	TMEFF2	TMEFF2_E94_R	12383050	NM_016192.2	TMEFF2	23671	2	36.1	192767795	94	Y	GGAAGCCGGAGGACAGGAGGAGACGGGAGTCCAGGGGCAGACGA	TR, HPP1, TPEF, TENB2	transmembrane protein TENB2; tomoregulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: molecular function unknown	transmembrane protein with EGF-like and two follistatin-like domains 2
TMEFF2_P152_R	2137	0.2836285	5946.813	2394.077	7.675441E-10	29	418.1539	0.2363966	10888.16	3401.718	1.807744E-20	38	902.1039	0.1964901	14250.76	3509.332	2.144318E-35	23	784.0327	0.1093853	7995.911	994.3395	9.081002E-07	27	476.754	0.1808049	12425.44	2764.495	4.219333E-25	23	698.0961	0.212675	12945.08	3523.782	2.15754E-34	31	571.4377	0.2218483	13218.42	3797.034	4.645992E-25	26	625.9968	0.2399631	14845.13	4718.56	3.509618E-23	35	626.5284	0.2192071	9587.91	2719.874	2.294205E-16	21	1091.923	0.1981584	13682.55	3406.07	9.329463E-32	25	756.3868	TMEFF2	TMEFF2_P152_R	12383050	NM_016192.2	TMEFF2	23671	2	36.1	192768041	-152	Y	GAGGTGCAAGGATGCAAGGAGGAGGCGGCCGCGGAAGCCACAGATGGG	TR, HPP1, TPEF, TENB2	transmembrane protein TENB2; tomoregulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: molecular function unknown	transmembrane protein with EGF-like and two follistatin-like domains 2
TMEFF2_P210_R	2139	0.07760993	5453.487	467.2706	5.202059E-05	30	240.4548	0.09277451	5275.022	549.6595	0.001380974	29	233.7991	0.1075897	5470.017	671.5259	0.0004343484	31	186.5199	0.05964835	4022.899	261.5236	0.04582652	23	180.9108	0.1353566	5012.579	800.3546	0.0009450437	25	257.371	0.09063172	6183.102	626.2021	1.349856E-05	34	230.7783	0.08707923	5936.514	575.7947	0.001021312	28	236.7392	0.1077545	6193.258	760.023	0.00355882	37	179.5675	0.1332505	6075.154	949.3431	3.053561E-05	26	302.6779	0.09341881	5528.392	579.9785	0.0004842096	32	229.5018	TMEFF2	TMEFF2_P210_R	12383050	NM_016192.2	TMEFF2	23671	2	36.1	192768099	-210	Y	CGCTGGCCCGAGTGGGGCTAGGCGGGGATGGCTCAAATGAGAA	TR, HPP1, TPEF, TENB2	transmembrane protein TENB2; tomoregulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: molecular function unknown	transmembrane protein with EGF-like and two follistatin-like domains 2
TMEM63A_E63_F	2943	0.1700346	2048.356	440.1327	0.2068263	24	106.202	0.1996768	7423.289	1877.025	1.501102E-08	22	674.0275	0.2040409	7791.557	2022.969	3.107065E-10	20	687.4795	0.1352831	1283.308	216.4156	0.5555282	27	72.02172	0.205822	6724.119	1768.563	1.248803E-07	23	405.2583	0.2782291	6951.022	2718.036	2.712023E-11	22	518.0051	0.2552344	7719.631	2679.821	4.596978E-09	29	547.894	0.2913472	8089.955	3367.123	7.709936E-08	30	359.9408	0.183308	5972.09	1362.891	1.066987E-05	38	440.5949	0.2167214	7987.005	2237.552	6.104453E-11	29	272.9092	TMEM63A	TMEM63A_E63_F	7662307	NM_014698.1	TMEM63A	9725	1	36.1	224136608	63	Y	AGGGTGCATTGCCCCTCCTCACGCCCCCTGTCCCCTGTACCTGCGGC	KIAA0489, KIAA0792, RP4-559A3.1	go_component: membrane; go_function: nucleotide binding	transmembrane protein 63A
TMPRSS4_E83_F	2951	0.5736889	2708.596	3779.541	5.737777E-06	29	255.9706	0.9620878	686.5123	19959.13	3.678E-38	19	1447.937	0.9678348	694.4223	23903.77	3.678E-38	34	1298.833	0.741791	1279.035	3961.734	0.01033456	31	203.7895	0.9694254	542.0397	20357.06	3.678E-38	27	1354.44	0.9602556	668.1139	18558.2	3.678E-38	20	1594.031	0.9627394	713.2268	21012.16	3.678E-38	34	1514.763	0.9636658	802.004	23923.2	1.106777E-37	41	888.4036	0.9363914	712.0089	11953.68	2.221796E-17	42	713.0604	0.9704264	634.7031	24108.51	3.678E-38	37	1251.344	TMPRSS4	TMPRSS4_E83_F	34304348	NM_019894.2	TMPRSS4	56649	11	36.1	117453059	83	N	TTGCTCAGCGGACAAGGATGCTGGGCGTGAGGGACCAAGGCCTGCCC	MT-SP2, TMPRSS3	isoform 1 is encoded by transcript variant 1; transmembrane serine protease 3; membrane-type serine protease 2; go_component: membrane; go_component: integral to membrane; go_function: trypsin activity; go_function: peptidase activity; go_function: chymotrypsin activity; go_function: scavenger receptor activity; go_process: proteolysis	transmembrane protease, serine 4 isoform 1
TMPRSS4_P552_F	2383	0.8025797	704.0695	3268.812	0.01607962	24	179.5758	0.8996958	1422.789	13658.92	6.902609E-23	30	876.1345	0.8876835	1716.701	14358.13	1.091375E-28	30	843.9471	0.2481	572.9448	222.0476	0.7263626	24	42.78845	0.8777018	1756.604	13324.36	9.990771E-25	32	475.2399	0.7389426	3237.617	9447.379	7.217761E-20	32	761.1666	0.8005881	2676.632	11147.47	3.0077E-16	28	1129.24	0.8895866	1846.2	15680.28	1.786903E-18	32	644.03	0.849277	1769.123	10531.92	2.395574E-16	25	481.6904	0.8363837	2702.686	14326.94	1.580954E-31	28	1026.137	TMPRSS4	TMPRSS4_P552_F	34304348	NM_019894.2	TMPRSS4	56649	11	36.1	117452424	-552	N	GAAAGAAGGAAATGACTCCGTGGACGAGGAGACGTGGGCTCTAGCCAG	MT-SP2, TMPRSS3	isoform 1 is encoded by transcript variant 1; transmembrane serine protease 3; membrane-type serine protease 2; go_component: membrane; go_component: integral to membrane; go_function: trypsin activity; go_function: peptidase activity; go_function: chymotrypsin activity; go_function: scavenger receptor activity; go_process: proteolysis	transmembrane protease, serine 4 isoform 1
TNC_P198_F	5290	0.1174084	1134.636	164.2398	0.5965175	23	47.20237	0.237473	1830.994	601.3673	0.3066075	35	81.49248	0.3395845	1952.42	1055.351	0.18577	28	102.7983	0.03412824	4582.069	165.4368	0.02327006	24	288.4249	0.3273168	1761.159	905.6097	0.2423512	28	105.7317	0.4070648	2186.792	1569.939	0.04683945	32	136.1138	0.3771862	2265.939	1432.851	0.1235145	33	101.4282	0.2982843	2714.383	1196.334	0.1674716	30	101.7621	0.2680011	2424.1	924.1294	0.1259458	23	115.2622	0.2391197	2036.541	671.4448	0.23966	25	97.13671	TNC	TNC_P198_F	4504548	NM_002160.1	TNC	3371	9	36.1	116920458	-198	Y	GGAACCCATTTGCATACAATTTATGGCGAAAGTAGGAATTCCCGCCTGCCCG	TN, HXB	Hexabrachion (tenascin); hexabrachion (tenascin C, cytotactin); go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_process: cell adhesion	tenascin C (hexabrachion)
TNC_P57_F	5285	0.05973183	5684.183	367.4482	3.197138E-05	28	296.94	0.0704016	9196.099	704.0247	1.108726E-09	33	675.3967	0.05054208	11236.95	603.4949	4.265573E-15	35	585.5181	0.0719948	5498.615	434.3415	0.002820528	31	173.9148	0.06361878	10604.36	727.2663	1.148317E-13	23	480.7981	0.07587486	11089.42	918.7022	1.032483E-17	24	892.1566	0.09173083	9979.248	1017.956	3.774871E-10	28	592.1328	0.1037012	9928.238	1160.26	2.348354E-07	25	709.0288	0.09812579	7202.826	794.5626	9.388749E-07	24	483.0014	0.03600566	12095.47	455.5066	1.109854E-16	36	466.926	TNC	TNC_P57_F	4504548	NM_002160.1	TNC	3371	9	36.1	116920317	-57	Y	TCCTTCCTCTGTAATGGGACGCCTCGCCTCCAGACATCCTTTCCCAC	TN, HXB	Hexabrachion (tenascin); hexabrachion (tenascin C, cytotactin); go_component: extracellular matrix (sensu Metazoa); go_function: protein binding; go_process: cell adhesion	tenascin C (hexabrachion)
TNF_P1084_F	2916	0.7124641	1676.287	4401.33	2.89809E-05	27	223.7922	0.9614568	752.5264	21266.22	3.678E-38	32	1465.422	0.962531	790.7175	22881.37	3.678E-38	37	1189.64	0.8182521	580.0162	3061.521	0.1029186	32	91.39851	0.9525956	851.8484	19127.48	3.678E-38	29	1356.664	0.9436674	1148.245	20910.22	3.678E-38	23	1068.498	0.9615476	911.2715	25288.04	3.678E-38	26	1161.997	0.9657556	963.9985	30006.69	3.678E-38	18	1332.244	0.9241	838.2983	11424	3.069773E-16	24	698.9453	0.9690397	737.1351	26201.88	3.678E-38	25	963.2347	TNF	TNF_P1084_F	25952110	NM_000594.2	TNF	7124	6	36.1	31650245	-1084	N	ATGTGATGGACTCACCAGGTGAGGCCGCCAGACTGCTGCAGGGGAAGCAA	DIF, TNFA, TNFSF2, TNF-alpha	cachectin; TNF superfamily, member 2; TNF, monocyte-derived; TNF, macrophage-derived; APC1 protein; go_component: membrane; go_component: extracellular space; go_component: integral to membrane; go_component: soluble fraction; go_function: protein binding; go_function: tumor necrosis factor receptor binding; go_process: apoptosis; go_process: immune response; go_process: anti-apoptosis; go_process: cell-cell signaling; go_process: response to wounding; go_process: response to virus; go_process: leukocyte adhesion; go_process: signal transduction; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: activation of NF-kappaB transcription factor	tumor necrosis factor alpha
TNF_P158_F	2915	0.09204534	1320.678	144.0235	0.5383709	26	54.11686	0.0741568	6872.734	558.4916	1.516217E-05	28	205.6499	0.05117333	6786.301	371.4008	1.895602E-05	33	288.571	0.2081357	345.0164	116.9693	0.7939649	20	23.36421	0.06214588	6228.743	419.3672	8.976179E-05	27	219.2499	0.09205903	5787.177	596.9196	5.996369E-05	30	272.3815	0.09550655	6412.935	687.7086	0.0002444545	26	196.6854	0.09159368	6751.548	690.8346	0.001494266	29	236.6785	0.09122651	6311.188	643.582	3.837331E-05	26	299.7652	0.06843033	6695.183	499.1538	1.835213E-05	30	299.0968	TNF	TNF_P158_F	25952110	NM_000594.2	TNF	7124	6	36.1	31651171	-158	N	CGCCCCCGCGATGGAGAAGAAACCGAGACAGAAGGTGCAGGGCCCACTACC	DIF, TNFA, TNFSF2, TNF-alpha	cachectin; TNF superfamily, member 2; TNF, monocyte-derived; TNF, macrophage-derived; APC1 protein; go_component: membrane; go_component: extracellular space; go_component: integral to membrane; go_component: soluble fraction; go_function: protein binding; go_function: tumor necrosis factor receptor binding; go_process: apoptosis; go_process: immune response; go_process: anti-apoptosis; go_process: cell-cell signaling; go_process: response to wounding; go_process: response to virus; go_process: leukocyte adhesion; go_process: signal transduction; go_process: signal transduction; go_process: regulation of transcription, DNA-dependent; go_process: activation of NF-kappaB transcription factor	tumor necrosis factor alpha
TNFRSF10A_P171_F	5148	0.08934794	2731.276	277.7885	0.09989699	33	119.0687	0.09093596	8721.686	882.4554	4.106175E-09	32	395.737	0.09773731	9829.075	1075.564	1.01698E-12	22	712.5474	0.05420393	3262.188	192.6883	0.1265875	31	177.1319	0.09917247	8187.942	912.4229	9.388401E-09	38	386.0634	0.08110071	9283.389	828.1642	2.192853E-12	42	217.1927	0.0982215	9168.02	1009.47	1.115674E-08	20	363.014	0.1198441	9666.06	1329.77	3.086648E-07	31	358.247	0.1233597	8077.85	1150.776	5.178947E-09	37	328.9252	0.08689566	10435.06	1002.57	9.116883E-14	36	330.0962	TNFRSF10A	TNFRSF10A_P171_F	89028575	XM_944097.1	LOC389641	389641	8	36.1	23138755	70	Y	TCGTTTTGCCACTTGGTCCCAGCGCCAGGCTTCTCGGTCGGGAGTTGACCT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_949190
TNFRSF10A_P91_F	5145	0.3511532	7248.176	3976.802	3.526482E-18	34	605.4023	0.04655528	6621.094	328.181	6.736349E-05	20	444.5847	0.04758893	8395.287	424.4823	3.120572E-08	20	484.2679	0.2727932	3465.223	1337.403	0.02135099	25	259.2833	0.05178892	7161.351	396.5968	4.445063E-06	20	418.3898	0.05529819	7192.323	426.8566	5.688154E-07	33	406.1863	0.05700239	7438.034	455.6596	2.792538E-05	28	346.0104	0.05460262	9075.228	529.9268	1.35554E-05	32	276.6065	0.08279421	5784.883	531.2158	0.0002730958	35	395.5726	0.04606157	9325.524	455.1179	5.356277E-10	42	360.5627	TNFRSF10A	TNFRSF10A_P91_F	89028575	XM_944097.1	LOC389641	389641	8	36.1	23138675	-10	Y	TTCCTCTGTGACCGCCCTTGCCGCTCTCAGCTTCTGTTCCTCAACCAC	.	Derived by automated computational analysis using gene prediction method: GNOMON.	hypothetical protein XP_949190
TNFRSF10B_E198_R	1326	0.03786158	7139.787	284.8964	8.798656E-08	20	391.1411	0.04717311	13283.24	662.5853	1.83103E-19	21	942.0353	0.04228995	13927.81	619.4312	3.007462E-23	25	574.9011	0.06363995	2257.85	160.2519	0.3217935	27	131.9829	0.05952145	13376.03	852.8775	6.65912E-22	28	678.3784	0.06476529	10669.06	745.7605	6.210296E-16	39	634.6073	0.05077725	14021.42	755.4044	1.154264E-18	29	576.6506	0.05678309	16569.47	1003.528	1.415874E-18	28	629.5562	0.08629635	8423.507	805.0176	5.181357E-09	21	886.2288	0.06738696	16693.72	1213.448	5.035194E-35	28	547.6278	TNFRSF10B	TNFRSF10B_E198_R	22547118	NM_147187.1	TNFRSF10B	8795	8	36.1	22982439	198	Y	GGCATCGTCGGTGTATTTTGTGGGCGCAGAGATTGCGGGGTTCTCC	DR5, CD262, KILLER, TRICK2, TRICKB, ZTNFR9, TRAILR2, TRICK2A, TRICK2B, TRAIL-R2, KILLER/DR5	isoform 2 precursor is encoded by transcript variant 2; death receptor 5; TNF-related apoptosis-inducing ligand receptor 2; TRAIL receptor 2; Fas-like protein precursor; apoptosis inducing receptor TRAIL-R2; apoptosis inducing protein TRICK2A/2B; tumor necrosis factor receptor-like protein ZTNFR9; death domain containing receptor for TRAIL/Apo-2L; cytotoxic TRAIL receptor-2; p53-regulated DNA damage-inducible cell death receptor(killer); go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: TRAIL binding; go_function: receptor activity; go_function: caspase activator activity; go_process: caspase activation; go_process: signal transduction; go_process: regulation of apoptosis; go_process: activation of NF-kappaB-inducing kinase; go_process: activation of NF-kappaB-inducing kinase; go_process: cell surface receptor linked signal transduction; go_process: induction of apoptosis via death domain receptors; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	tumor necrosis factor receptor superfamily, member 10b isoform 2 precursor
TNFRSF10B_P108_R	5361	0.3481958	4646.093	2535.378	2.777986E-07	36	266.8016	0.2245354	9914.828	2899.789	2.379543E-16	37	594.447	0.2431094	11117.83	3603.109	7.765876E-24	26	736.7678	0.1534195	4782.283	884.7802	0.004749367	29	272.6802	0.254559	9876.682	3406.916	5.526833E-19	28	517.7225	0.2342155	10071.94	3111.092	1.537373E-21	28	749.1552	0.2471006	10695.11	3542.941	2.824376E-17	24	483.0117	0.24295	13315.72	4305.33	1.112505E-18	29	773.3001	0.2223923	9013.739	2606.489	1.641232E-14	26	591.6565	0.2300627	10924.3	3294.138	1.268019E-21	31	514.2749	TNFRSF10B	TNFRSF10B_P108_R	22547118	NM_147187.1	TNFRSF10B	8795	8	36.1	22982745	-108	Y	GGTCCTGTCCGCGCCAGGACAGGCACCGAAACTTGGGGGAAATGAG	DR5, CD262, KILLER, TRICK2, TRICKB, ZTNFR9, TRAILR2, TRICK2A, TRICK2B, TRAIL-R2, KILLER/DR5	isoform 2 precursor is encoded by transcript variant 2; death receptor 5; TNF-related apoptosis-inducing ligand receptor 2; TRAIL receptor 2; Fas-like protein precursor; apoptosis inducing receptor TRAIL-R2; apoptosis inducing protein TRICK2A/2B; tumor necrosis factor receptor-like protein ZTNFR9; death domain containing receptor for TRAIL/Apo-2L; cytotoxic TRAIL receptor-2; p53-regulated DNA damage-inducible cell death receptor(killer); go_component: membrane; go_component: integral to membrane; go_function: protein binding; go_function: TRAIL binding; go_function: receptor activity; go_function: caspase activator activity; go_process: caspase activation; go_process: signal transduction; go_process: regulation of apoptosis; go_process: activation of NF-kappaB-inducing kinase; go_process: activation of NF-kappaB-inducing kinase; go_process: cell surface receptor linked signal transduction; go_process: induction of apoptosis via death domain receptors; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	tumor necrosis factor receptor superfamily, member 10b isoform 2 precursor
TNFRSF10C_E109_F	3981	0.09333156	4532.113	476.8252	0.001080477	25	271.2766	0.18082	8968.098	2001.628	6.660627E-12	39	349.0304	0.1793569	9891.646	2183.739	9.945702E-16	29	762.7307	0.0295513	8431.057	259.7806	2.363687E-06	31	249.6001	0.1950141	7881.195	1933.507	3.424536E-10	32	510.9638	0.2469117	8692.442	2882.739	2.100609E-16	28	442.8084	0.1780459	9467.526	2072.45	3.385878E-11	19	667.5524	0.211097	9190.656	2486.022	3.89133E-08	42	503.232	0.180224	7790.782	1734.752	1.293087E-09	39	395.4874	0.1490528	10354.9	1831.291	1.081799E-15	24	666.3379	TNFRSF10C	TNFRSF10C_E109_F	22547120	NM_003841.2	TNFRSF10C	8794	8	36.1	23016488	109	Y	AGGGGTGAAGGAGCGCTTCCTACCGTTAGGGAACTCTGGGGACAG	LIT, DCR1, TRID, CD263, TRAILR3	decoy receptor 1; TRAIL receptor 3; TNF related TRAIL receptor; lymphocyte inhibitor of TRAIL; decoy without an intracellular domain; antagonist decoy receptor for TRAIL/Apo-2L; TNF related apoptosis-inducing ligand receptor 3; go_component: membrane; go_component: integral to plasma membrane; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: signal transduction	tumor necrosis factor receptor superfamily, member 10c precursor
TNFRSF10C_P612_R	2144	0.4943653	794.5931	874.6549	0.4656362	28	58.6487	0.9060135	1104.991	11615.91	4.18074E-16	28	588.6437	0.9364241	951.6371	15489.8	4.385304E-30	31	726.3776	0.2397344	462.3734	177.333	0.7591887	29	35.13445	0.9246828	877.4158	11999.91	8.47211E-18	37	560.7163	0.9061698	1208.161	12633.63	7.312244E-24	23	826.977	0.9288358	891.5074	12941.16	2.866275E-16	29	952.9246	0.9258857	1152.384	15645.63	6.251059E-17	29	676.1979	0.9048544	887.2288	9388.751	3.072692E-11	28	518.9058	0.9340113	911.7926	14321.02	5.718142E-25	20	684.3948	TNFRSF10C	TNFRSF10C_P612_R	22547120	NM_003841.2	TNFRSF10C	8794	8	36.1	23015767	-612	N	CTCCTCAGCCTCTGCATGTGCCCGTCATGGCCCCTGTGTCCTTCATTCTGTC	LIT, DCR1, TRID, CD263, TRAILR3	decoy receptor 1; TRAIL receptor 3; TNF related TRAIL receptor; lymphocyte inhibitor of TRAIL; decoy without an intracellular domain; antagonist decoy receptor for TRAIL/Apo-2L; TNF related apoptosis-inducing ligand receptor 3; go_component: membrane; go_component: integral to plasma membrane; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: signal transduction	tumor necrosis factor receptor superfamily, member 10c precursor
TNFRSF10C_P7_F	2143	0.06248289	7789.944	525.8427	8.816459E-10	23	371.6621	0.1751374	11022.13	2361.485	7.032455E-18	25	690.81	0.1729849	13960.58	2941.021	6.922118E-32	36	1048.005	0.03241623	7177.252	243.8043	9.060453E-05	22	327.1613	0.1668201	11155.12	2253.511	2.340343E-19	22	837.5229	0.2046178	10759.14	2793.592	7.923369E-23	30	965.4235	0.1839572	10715.4	2438.071	1.173856E-14	25	787.8907	0.1625497	13142.41	2570.362	9.123176E-15	39	618.5923	0.1593284	9273.089	1776.435	4.58676E-13	24	970.6774	0.1584869	14175.44	2688.573	6.874136E-31	27	1168.28	TNFRSF10C	TNFRSF10C_P7_F	22547120	NM_003841.2	TNFRSF10C	8794	8	36.1	23016372	-7	Y	GGGTATAAATTCAGAGGCGCTGCGCTCCGATTCTGGCAGTGCAGCTGTGGG	LIT, DCR1, TRID, CD263, TRAILR3	decoy receptor 1; TRAIL receptor 3; TNF related TRAIL receptor; lymphocyte inhibitor of TRAIL; decoy without an intracellular domain; antagonist decoy receptor for TRAIL/Apo-2L; TNF related apoptosis-inducing ligand receptor 3; go_component: membrane; go_component: integral to plasma membrane; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: signal transduction	tumor necrosis factor receptor superfamily, member 10c precursor
TNFRSF10D_E27_F	3985	0.2040726	5003.958	1308.635	1.165033E-05	25	489.7723	0.06718381	7748.092	565.2397	7.259706E-07	21	354.9915	0.05765605	8307.576	514.4063	3.090728E-08	32	338.2468	0.1625713	865.7748	187.4874	0.667296	26	40.56601	0.06182694	6369.863	426.3732	5.679027E-05	18	462.9385	0.07272401	6644.597	528.9624	3.426199E-06	22	477.2359	0.06775299	7465.604	549.8461	1.952403E-05	29	331.2542	0.06008345	8128.399	525.9941	0.0001276662	32	331.527	0.06481691	6384.013	449.4026	5.672968E-05	31	518.798	0.04473904	8584.948	406.754	1.929704E-08	22	362.017	TNFRSF10D	TNFRSF10D_E27_F	42544227	NM_003840.3	TNFRSF10D	8793	8	36.1	23077458	27	Y	CAGAAATCGTCCCCGTAGTTTGTGCGCGTGCAAAGGTTCTCGCAGCTACACTGCCA	DCR2, CD264, TRUNDD, TRAILR4	decoy receptor 2; TNF receptor-related receptor for TRAIL; decoy with truncated death domain; TRAIL receptor 4; TRAIL receptor with a truncated death domain; go_component: membrane; go_component: integral to membrane; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: anti-apoptosis; go_process: signal transduction	tumor necrosis factor receptor superfamily, member 10d precursor
TNFRSF10D_P70_F	2149	0.04868668	7082.893	367.6089	7.766885E-08	33	291.0373	0.1669691	8439.028	1711.526	3.533007E-10	23	511.3394	0.1618645	9601.885	1873.671	3.835492E-14	23	475.7684	0.03161833	6432.78	213.2998	0.0006068597	28	246.4862	0.1586555	6687.854	1280.011	9.86092E-07	26	717.7328	0.1650811	9058.753	1810.879	2.175028E-14	19	422.8057	0.1430269	9498.579	1601.982	2.409914E-10	24	582.8521	0.1590255	10009.21	1911.619	1.787571E-08	24	644.467	0.1430112	6555.256	1110.605	3.271705E-06	31	552.7822	0.1492377	9835.433	1742.838	4.061109E-14	31	419.3618	TNFRSF10D	TNFRSF10D_P70_F	42544227	NM_003840.3	TNFRSF10D	8793	8	36.1	23077555	-70	Y	CGTGGTCAGTTGTACTCCCTTCCCGCAGTCACTTCCAGGCACTCAGGCTGG	DCR2, CD264, TRUNDD, TRAILR4	decoy receptor 2; TNF receptor-related receptor for TRAIL; decoy with truncated death domain; TRAIL receptor 4; TRAIL receptor with a truncated death domain; go_component: membrane; go_component: integral to membrane; go_function: transmembrane receptor activity; go_process: apoptosis; go_process: anti-apoptosis; go_process: signal transduction	tumor necrosis factor receptor superfamily, member 10d precursor
TNFRSF1A_P678_F	5365	0.3040277	12768.49	5621.455	3.678E-38	32	1302.998	0.9406372	1118.358	19305.57	3.678E-38	30	1572.222	0.9410441	1349.854	23142.33	3.678E-38	38	1251.75	0.4313562	5962.893	4599.129	3.247861E-09	24	554.783	0.9176849	1401.156	16735.54	2.324299E-36	30	1107.851	0.9299758	1190.094	17133.45	3.678E-38	26	1642.814	0.9176363	1602.921	18972.71	2.592424E-37	27	1592.242	0.9327046	1698.491	24926.83	3.678E-38	29	1075.917	0.9209623	985.0779	12643.53	2.841612E-20	33	543.5294	0.9369158	1365.739	21768.88	3.678E-38	31	1358.147	TNFRSF1A	TNFRSF1A_P678_F	23312372	NM_001065.2	TNFRSF1A	7132	12	36.1	6322200	-678	N	TCCTGGCTCTGCCACCAATCATGCGACATCAGGCAACTCCTCTCCTAAGC	FPF, p55, p60, TBP1, TNF-R, TNFAR, TNFR1, p55-R, CD120a, TNFR55, TNFR60, TNF-R-I, TNF-R55, MGC19588	tumor necrosis factor-alpha receptor; tumor necrosis factor binding protein 1; tumor necrosis factor receptor type 1; go_component: membrane; go_component: extracellular region; go_component: integral to plasma membrane; go_function: receptor activity; go_function: protein binding; go_function: protein binding; go_function: tumor necrosis factor receptor activity; go_process: apoptosis; go_process: signal transduction; go_process: inflammatory response; go_process: prostaglandin metabolism; go_process: positive regulation of inflammatory response; go_process: cytokine and chemokine mediated signaling pathway; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade; go_process: positive regulation of transcription from RNA polymerase II promoter	tumor necrosis factor receptor 1 precursor
TNFRSF1B_E5_F	1331	0.1112387	3882.756	498.4877	0.006089411	36	135.896	0.1134783	7310.682	948.5971	8.847501E-07	37	403.7796	0.1059227	10734.61	1283.593	1.421843E-15	33	500.0128	0.1337032	4051.665	640.7629	0.02533063	30	250.3457	0.1292101	8435.066	1266.456	5.900316E-10	18	586.4944	0.1260258	8214.386	1198.923	1.093222E-10	27	476.1178	0.1426526	8449.834	1422.593	3.638E-08	29	361.7531	0.1306551	10676.75	1619.653	5.208932E-09	24	545.0891	0.1506848	6338.889	1142.383	6.376571E-06	39	444.3843	0.1315925	8440.297	1294.138	6.671949E-10	23	342.8535	TNFRSF1B	TNFRSF1B_E5_F	23312365	NM_001066.2	TNFRSF1B	7133	1	36.1	12149652	5	Y	TCGCTTTCAGTCGAGGGCTAGCGAGCGCAGCGGAGCCTGGAGAGAAGG	p75, TBPII, TNFBR, TNFR2, CD120b, TNFR80, TNF-R75, p75TNFR, TNF-R-II	tumor necrosis factor beta receptor; tumor necrosis factor binding protein 2; p75 TNF receptor; go_component: integral to membrane; go_function: receptor activity; go_function: protein binding; go_function: tumor necrosis factor receptor activity; go_function: tumor necrosis factor receptor activity; go_process: apoptosis; go_process: cytokine and chemokine mediated signaling pathway	tumor necrosis factor receptor 2 precursor
TNFRSF1B_P167_F	5170	0.07310125	7780.179	621.4821	5.476628E-10	28	355.0403	0.03055686	10887.67	346.3316	1.715471E-12	31	616.3562	0.03246736	15340.77	518.144	6.978389E-28	26	948.2237	0.04264567	5373.761	243.8306	0.005216822	24	401.1927	0.03739582	11065.84	433.777	4.364885E-14	34	789.9995	0.03208864	15583.47	519.9456	8.32264E-33	30	814.8869	0.03196668	11760.2	391.651	1.899959E-12	32	1109.03	0.03266177	15904.35	540.3802	3.298285E-16	17	653.1573	0.0608124	8281.398	542.6956	3.154545E-08	25	562.1723	0.03281741	14489.91	495.0492	3.967598E-24	27	541.1431	TNFRSF1B	TNFRSF1B_P167_F	23312365	NM_001066.2	TNFRSF1B	7133	1	36.1	12149480	-167	Y	GGTCACCCGAGTGCTGGGAGTGACGCTGGAGGTATCGGCCCAGCGAT	p75, TBPII, TNFBR, TNFR2, CD120b, TNFR80, TNF-R75, p75TNFR, TNF-R-II	tumor necrosis factor beta receptor; tumor necrosis factor binding protein 2; p75 TNF receptor; go_component: integral to membrane; go_function: receptor activity; go_function: protein binding; go_function: tumor necrosis factor receptor activity; go_function: tumor necrosis factor receptor activity; go_process: apoptosis; go_process: cytokine and chemokine mediated signaling pathway	tumor necrosis factor receptor 2 precursor
TNFSF10_E53_F	1109	0.08670402	5253.91	508.2751	9.221255E-05	32	211.6721	0.1872727	8675.018	2021.984	2.598445E-11	25	349.1902	0.1711981	9421.618	1966.795	6.4052E-14	30	307.5775	0.1891994	865.6746	225.3391	0.6582527	27	35.42051	0.2119218	7525.474	2050.563	1.069351E-09	27	407.7119	0.173859	8284.297	1764.451	3.158664E-12	19	406.7425	0.1783819	8437.341	1853.546	7.11268E-09	37	303.2067	0.1723325	9339.927	1965.531	1.225351E-07	24	576.0136	0.1733841	6692.694	1424.779	5.879602E-07	22	438.8377	0.1748969	9955.448	2131.45	1.98414E-15	29	515.5152	TNFSF10	TNFSF10_E53_F	23510439	NM_003810.2	TNFSF10	8743	3	36.1	173723910	53	N	GACTGCTGTAAGTCAGCCAGGCAGCCGGTCACTGAAGCCCTTCCTTCTCTATT	TL2, APO2L, CD253, TRAIL, Apo-2L	Apo-2 ligand; TNF-related apoptosis inducing ligand TRAIL; go_component: membrane; go_component: extracellular space; go_component: soluble fraction; go_component: integral to plasma membrane; go_function: zinc ion binding; go_function: metal ion binding; go_function: tumor necrosis factor receptor binding; go_process: apoptosis; go_process: immune response; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: induction of apoptosis; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	tumor necrosis factor (ligand) superfamily, member 10
TNFSF10_P2_R	5375	0.08064121	1659.171	154.305	0.4148919	33	35.27703	0.2872981	5123.763	2105.758	2.871495E-05	35	273.8701	0.2131556	5256.92	1451.186	8.150686E-05	34	205.138	0.3144762	2639.362	1256.651	0.07607235	35	142.4596	0.2953706	4212.66	1807.806	0.0005457253	32	198.2997	0.2805149	4359.289	1738.6	0.0001531515	34	227.2092	0.2566976	5091.363	1792.824	0.0004210566	23	256.2951	0.2622223	4511.427	1639.002	0.01269024	20	161.3801	0.2484081	4381.688	1481.24	0.0009542152	23	312.6696	0.2541803	5718.342	1982.93	3.185599E-06	30	281.2707	TNFSF10	TNFSF10_P2_R	23510439	NM_003810.2	TNFSF10	8743	3	36.1	173723965	-2	N	TCTTTTATAGTCAGTGAGGAAATGAAAGCGAATGAGTTGTTTTTCTGGGT	TL2, APO2L, CD253, TRAIL, Apo-2L	Apo-2 ligand; TNF-related apoptosis inducing ligand TRAIL; go_component: membrane; go_component: extracellular space; go_component: soluble fraction; go_component: integral to plasma membrane; go_function: zinc ion binding; go_function: metal ion binding; go_function: tumor necrosis factor receptor binding; go_process: apoptosis; go_process: immune response; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: induction of apoptosis; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade	tumor necrosis factor (ligand) superfamily, member 10
TNFSF8_E258_R	1341	0.2418899	5110.073	1662.376	1.733277E-06	35	236.3472	0.05388849	11310.38	649.9108	3.411391E-14	33	651.9532	0.08591841	11165.02	1058.847	3.896237E-16	17	859.7188	0.2348183	3539.553	1116.903	0.02675726	29	171.3487	0.05934318	11626.54	739.7916	2.292387E-16	30	719.4717	0.2238345	11673.73	3395.368	1.574156E-28	26	1076.635	0.1177728	11074.97	1491.802	2.443111E-13	28	1038.965	0.05315914	13317.6	753.3137	8.439517E-12	27	695.2336	0.0550248	8859.789	521.718	2.551372E-09	38	600.9023	0.04610923	13731.72	668.5986	3.327327E-22	27	522.0128	TNFSF8	TNFSF8_E258_R	24119162	NM_001244.2	TNFSF8	944	9	36.1	116732333	258	N	CCCCAGGTGGCTGGCCACGGAGCCCGCCGGCACATGCATGGCTGTGTCTC	CD153, CD30L, CD30LG	CD30 antigen ligand; CD153 antigen; CD30 ligand; go_component: membrane; go_component: extracellular space; go_component: integral to plasma membrane; go_function: tumor necrosis factor receptor binding; go_process: immune response; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: induction of apoptosis	tumor necrosis factor (ligand) superfamily, member 8
TNFSF8_P184_F	5184	0.09440343	5000.401	531.6886	0.0002045901	38	150.364	0.06755837	14131.23	1031.098	3.843238E-23	31	1047.13	0.0669139	17521.31	1263.667	3.678E-38	21	694.0363	0.1011212	6336.371	724.0726	0.0002262709	33	255.6438	0.0643393	14834.55	1026.952	1.787338E-27	23	936.3826	0.09645675	15262.89	1640.048	2.504059E-36	28	922.7811	0.07813577	15784.59	1346.353	2.040628E-25	33	1165.054	0.06067058	17918.31	1163.789	5.125906E-22	22	1064.854	0.08417924	12205.6	1131.09	2.270498E-19	24	1051.396	0.08184808	18473.7	1655.74	3.678E-38	30	1160.898	TNFSF8	TNFSF8_P184_F	24119162	NM_001244.2	TNFSF8	944	9	36.1	116732775	-184	Y	CACACACAAAGCAACTTCTGTTTCGTTTAGACTCTGCCACAAAACGCCTTC	CD153, CD30L, CD30LG	CD30 antigen ligand; CD153 antigen; CD30 ligand; go_component: membrane; go_component: extracellular space; go_component: integral to plasma membrane; go_function: tumor necrosis factor receptor binding; go_process: immune response; go_process: cell proliferation; go_process: cell-cell signaling; go_process: signal transduction; go_process: induction of apoptosis	tumor necrosis factor (ligand) superfamily, member 8
TNK1_P221_F	5293	0.4818297	1770.062	1738.91	0.04196294	22	186.3461	0.6505863	4275.163	8146.277	2.453384E-15	32	600.348	0.6163843	5967.853	9749.676	2.31654E-27	25	758.5376	0.1681521	5317.336	1095.076	0.001026722	28	284.2126	0.6767581	4204.153	9011.425	8.787183E-19	34	491.0601	0.7465628	3393.163	10289.99	2.72295E-23	34	624.7045	0.627109	5181.574	8882.28	7.716643E-17	27	692.8262	0.6090903	6091.093	9646.562	8.172361E-15	25	712.3188	0.6529881	3294.125	6386.879	6.124274E-10	32	426.3289	0.6378153	6063.163	10853.47	4.316856E-31	34	725.6691	TNK1	TNK1_P221_F	4507610	NM_003985.1	TNK1	8711	17	36.1	7224913	-221	Y	GGCTGGAAAGACGTGAAGGAAGACGAGCAGAGGAGAAGGGAAGG	MGC46193	tyrosine kinase non-receptor 1; tyrosine kinase non-receceptor 1; go_component: membrane; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: signal transducer activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: protein amino acid autophosphorylation	tyrosine kinase, non-receptor, 1
TNK1_P41_R	5291	0.1331654	2089.15	336.3031	0.2232632	27	89.05902	0.333572	5832.169	2969.271	1.136006E-07	20	513.4818	0.4084162	6864.154	4807.896	1.186988E-14	23	458.8903	0.03625989	5221.803	200.2283	0.007490112	27	205.7551	0.4391313	5663.187	4512.278	5.757387E-11	29	563.0842	0.5254497	4534.954	5132.091	2.742414E-11	39	378.0706	0.3734519	7002.352	4233.334	1.330428E-10	24	528.825	0.3136056	7889.237	3650.19	5.976693E-08	29	505.415	0.5471631	4057.47	5023.474	1.012895E-08	33	345.5436	0.2552564	5890.823	2053.318	1.308555E-06	19	302.5358	TNK1	TNK1_P41_R	4507610	NM_003985.1	TNK1	8711	17	36.1	7225093	-41	Y	CCGCGGGATTTACTCCTGTCCCGCCTCCTCGGATTTAGCCCAGGCAG	MGC46193	tyrosine kinase non-receptor 1; tyrosine kinase non-receceptor 1; go_component: membrane; go_component: cytoplasm; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: signal transducer activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: protein amino acid autophosphorylation	tyrosine kinase, non-receptor, 1
TP73_E155_F	4200	0.08969106	5167.997	519.046	0.000120149	24	167.6955	0.05648324	10860.39	656.1392	3.862757E-13	29	626.5427	0.04063971	13741.12	586.3271	1.625709E-22	31	1039.456	0.5622129	2642.068	3521.407	0.001755042	24	373.8263	0.04329589	11406.15	520.7139	3.464949E-15	33	737.5258	0.05627856	12502.12	751.524	8.787978E-22	29	733.8926	0.04369714	12621.9	581.3123	9.00887E-15	23	938.4604	0.03249376	16533.29	558.6302	1.520128E-17	29	875.4994	0.06622992	9388.478	672.9934	9.258691E-11	22	671.1721	0.05456514	13797.25	802.0707	7.532105E-23	28	763.5334	TP73	TP73_E155_F	4885644	NM_005427.1	TP73	7161	1	36.1	3559144	155	Y	CAGCGCTGGGCAGGCACCTGGGCTCGCAGCTCCGAAGCTGGGAGGT	P73	p53-related protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: transcription factor activity; go_process: apoptosis; go_process: cell cycle; go_process: transcription; go_process: mismatch repair; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle; go_process: DNA damage response, signal transduction resulting in induction of apoptosis	tumor protein p73
TP73_P496_F	2930	0.06150339	6952.724	462.1929	9.222478E-08	34	187.2046	0.04632862	10760.71	527.6048	1.292241E-12	30	517.5068	0.03695862	12136.31	469.5926	3.290328E-17	22	639.7742	0.07575114	7954.756	660.1653	2.9948E-06	16	318.2939	0.04069986	11881.87	508.3502	1.97143E-16	26	443.6906	0.05281289	12551.57	705.4215	8.557385E-22	33	761.7631	0.03920908	12847.4	528.3725	3.565296E-15	35	600.1112	0.04055682	16361.97	695.8674	1.793491E-17	33	834.6193	0.04852285	10056.96	517.9781	6.311424E-12	44	442.1342	0.04935996	11432.78	598.8149	2.774909E-15	35	470.4495	TP73	TP73_P496_F	4885644	NM_005427.1	TP73	7161	1	36.1	3558493	-496	Y	GCCGAGGAGCCCAGCGCTAGTGGCGGCGGCCAGGAGAGACCCGGGTG	P73	p53-related protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: transcription factor activity; go_process: apoptosis; go_process: cell cycle; go_process: transcription; go_process: mismatch repair; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle; go_process: DNA damage response, signal transduction resulting in induction of apoptosis	tumor protein p73
TP73_P945_F	2932	0.07090353	11780.82	906.6788	1.720617E-23	29	824.4427	0.1175745	12053.02	1619.27	1.103271E-18	35	695.4648	0.105456	13962.99	1657.857	5.225737E-27	35	1286.948	0.03028137	9710.14	306.3409	2.579104E-08	24	408.1451	0.1086689	13242.38	1626.671	5.235701E-24	30	1123.594	0.1592303	15232.39	2903.745	3.678E-38	31	716.6896	0.1144587	14090.78	1834.198	8.098168E-22	27	876.4382	0.1320084	17226.01	2635.025	6.459931E-24	25	1243.498	0.139265	9415.658	1539.612	7.803124E-13	30	899.7877	0.1030588	13827.96	1600.327	1.210408E-25	33	657.9354	TP73	TP73_P945_F	4885644	NM_005427.1	TP73	7161	1	36.1	3558044	-945	Y	GTGTCGCTGGCCGGTAGAGAGCTTCGGCCTGACCTAGCGCAGGTCTGG	P73	p53-related protein; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: transcription factor activity; go_process: apoptosis; go_process: cell cycle; go_process: transcription; go_process: mismatch repair; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle; go_process: DNA damage response, signal transduction resulting in induction of apoptosis	tumor protein p73
TPEF_seq_44_S36_F	6131	0.08042683	3982.488	357.0587	0.00676128	28	154.9809	0.05941553	13914.79	885.2969	5.195369E-22	28	728.4969	0.04271707	14501.53	651.5675	2.472856E-25	36	798.2125	0.06756312	2018.801	153.5255	0.3815188	34	83.67126	0.03773061	13322.45	526.2946	1.057693E-20	33	607.7123	0.05993998	15014.32	963.717	2.854039E-32	33	713.5373	0.03823245	15955.48	638.242	8.892517E-24	24	736.7647	0.04880152	15047.5	777.1469	5.553345E-15	27	662.441	0.08525493	7304.086	690.0664	9.50678E-07	32	791.6779	0.03923363	17580.08	721.9796	1.162592E-36	31	680.6229	TPEF	TPEF_seq_44_S36_F	12383050	NM_016192.2	TMEFF2	23671	2	36.1	192767447	442	Y	CCCGCGGCAGTGCAGCAGCTGGACACTTTGCGAGGGCTTTTGCTGGCTGCT	TR, HPP1, TPEF, TENB2	transmembrane protein TENB2; tomoregulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: molecular function unknown	transmembrane protein with EGF-like and two follistatin-like domains 2
TPEF_seq_44_S88_R	6130	0.05069408	7700.349	416.5481	2.598109E-09	30	360.5905	0.1359027	10437.79	1657.353	1.598393E-14	30	742.3561	0.1138073	15060.59	1946.965	2.61556E-32	32	783.0775	0.03461231	7503.435	272.608	3.494497E-05	31	339.4171	0.1251105	12419.02	1790.238	7.698277E-22	29	1012.007	0.2282885	12373.67	3689.972	1.231823E-32	27	1036.886	0.110891	14171.04	1779.906	6.823021E-22	34	800.5634	0.1291079	14868.91	2219.109	1.549211E-17	25	1354.752	0.1402774	8796.305	1451.574	3.555886E-11	32	475.6679	0.09696758	15762.51	1703.316	3.05367E-33	33	1032.941	TPEF	TPEF_seq_44_S88_R	12383050	NM_016192.2	TMEFF2	23671	2	36.1	192767395	494	Y	CCGTCATGCTACTCATCGTAGCCCGCCCGGTGAAGCTCGCTGCTTTCCCTAC	TR, HPP1, TPEF, TENB2	transmembrane protein TENB2; tomoregulin; go_component: membrane; go_component: integral to membrane; go_component: integral to membrane; go_function: molecular function unknown	transmembrane protein with EGF-like and two follistatin-like domains 2
TRAF4_P372_F	6080	0.07154375	8380.316	653.465	1.379446E-11	30	391.7848	0.1098809	10054.56	1253.531	1.165127E-12	31	417.0764	0.1113504	12424.86	1569.402	1.986115E-21	26	800.8065	0.1444522	6559.966	1124.48	4.490445E-05	26	315.8765	0.1309101	9344.319	1422.587	2.633918E-12	31	632.5402	0.1243388	10569.74	1515.042	5.977041E-18	37	506.6884	0.1578955	9701.978	1837.881	3.387698E-11	34	444.6972	0.1493675	12957.23	2292.795	6.817667E-14	28	702.6505	0.1317956	7704.531	1184.748	2.373143E-08	29	637.7464	0.09986817	10769.16	1205.916	3.902315E-15	33	500.6234	TRAF4	TRAF4_P372_F	22027623	NM_145751.1	TRAF4	9618	17	36.1	24094801	-372	Y	CCCCGGAGCTGGTTGCCAGGCTTCGGCTGCCTAGCACCTGGAAGCTG	CART1, MLN62, RNF83	isoform 2 is encoded by transcript variant 2; tumor necrosis receptor-associated factor 4A; malignant 62; cysteine-rich domain associated with ring and TRAF domain; go_component: nucleus; go_component: ubiquitin ligase complex; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: ubiquitin-protein ligase activity; go_process: development; go_process: protein ubiquitination; go_process: regulation of apoptosis; go_process: signal transduction	TNF receptor-associated factor 4 isoform 2
TRIM29_E189_F	2952	0.451855	2622.976	2244.644	0.001635571	34	223.212	0.9443927	977.7007	18302.87	3.901736E-38	21	1110.357	0.9475832	1181.953	23174.95	3.678E-38	28	722.1444	0.5846543	1658.934	2475.933	0.05606935	30	121.339	0.9379425	1111.642	18312.87	3.678E-38	21	762.8782	0.938053	1270.971	20760.38	3.678E-38	28	1048.626	0.9304982	1276.193	18424.65	4.591126E-34	27	1284.074	0.9505478	1222.208	25414.87	3.678E-38	29	897.1631	0.9300096	732.2062	11058.08	5.859753E-15	32	787.0037	0.9454092	995.2853	18968.28	3.678E-38	28	1069.695	TRIM29	TRIM29_E189_F	17402908	NM_012101.2	TRIM29	23650	11	36.1	119513884	189	Y	CAGGCTGCCACTGGGGCCCGACGGGCTCCGGGCATCCCTGGCTTCTGGG	ATDC	isoform alpha is encoded by transcript variant 1; tripartite motif protein TRIM29; ataxia-telangiectasia group D-associated protein; go_component: intracellular; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transcription factor activity; go_process: transcription from RNA polymerase II promoter	tripartite motif protein TRIM29 isoform alpha
TRIM29_P135_F	2398	0.5851625	2077.884	3072.084	0.0007039096	16	120.0937	0.9149215	1158.539	13534.14	1.109548E-21	25	1357.48	0.9404284	1333.258	22626.16	3.678E-38	31	981.0707	0.7935635	380.7577	1848.083	0.3674706	23	178.0829	0.9286597	1428.686	19899.41	3.678E-38	25	892.0253	0.8870174	2013.204	16590.59	3.678E-38	34	1036.189	0.9249358	1391.622	18379.66	2.547504E-34	25	1342.439	0.9275454	1738.486	23535.81	3.678E-38	27	1003.59	0.8982025	1132.491	10874.79	1.535546E-15	26	789.347	0.9425191	1120.176	20007.33	3.678E-38	28	681.4812	TRIM29	TRIM29_P135_F	17402908	NM_012101.2	TRIM29	23650	11	36.1	119514208	-135	N	GAGCAGATAATTGCACAGGAACCACGCCCTGCACATTCATCCCTAACCTGA	ATDC	isoform alpha is encoded by transcript variant 1; tripartite motif protein TRIM29; ataxia-telangiectasia group D-associated protein; go_component: intracellular; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transcription factor activity; go_process: transcription from RNA polymerase II promoter	tripartite motif protein TRIM29 isoform alpha
TRIM29_P261_F	2394	0.9082078	548.0296	6411.714	7.615448E-07	28	633.3409	0.9586303	504.6922	14012.09	3.793167E-21	25	946.684	0.97007	488.6591	19079.2	3.678E-38	23	919.147	0.8979405	362.7354	4071.238	0.03714472	30	252.486	0.9638575	532.2463	16860.89	2.595184E-33	44	993.0056	0.9680404	589.9226	20897.44	3.678E-38	25	1293.87	0.968401	543.6639	19726.08	3.690513E-36	22	1803.042	0.9702549	653.0009	24562.12	3.678E-38	18	1337.418	0.9479125	685.3892	14292.88	9.819617E-25	23	1124.678	0.9650253	566.7275	18396.42	3.678E-38	28	920.6678	TRIM29	TRIM29_P261_F	17402908	NM_012101.2	TRIM29	23650	11	36.1	119514334	-261	N	GCACTTGCTTCTCATCCGGGGAGCGGGGAGTCTCCGTCTTCACAAGTGGGCA	ATDC	isoform alpha is encoded by transcript variant 1; tripartite motif protein TRIM29; ataxia-telangiectasia group D-associated protein; go_component: intracellular; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: transcription factor activity; go_process: transcription from RNA polymerase II promoter	tripartite motif protein TRIM29 isoform alpha
TRIP6_E33_F	2954	0.3222523	4445.074	2161.07	3.517417E-06	31	285.1127	0.1523441	8466.969	1539.69	6.843518E-10	32	547.8329	0.1440608	11355	1927.959	3.327283E-19	24	653.9539	0.1407931	4006.031	672.8307	0.02586098	23	162.2634	0.105997	9288.308	1113.119	1.814289E-11	26	481.3863	0.3270658	7416.22	3653.103	6.051372E-15	23	654.0004	0.1819989	9343.192	2101.037	5.231968E-11	31	508.977	0.1405892	11791.38	1945.287	3.053794E-11	35	715.2919	0.1784812	7010.264	1544.759	9.947181E-08	26	588.6195	0.1583915	10473.47	1989.936	1.93053E-16	30	753.4653	TRIP6	TRIP6_E33_F	23308730	NM_003302.1	TRIP6	7205	7	36.1	100303014	33	Y	AGGGGGTGAAGGCCAGAGGCTCGGGGCTTCAAGACCGCTGTCTG	OIP1, ZRP-1, MGC3837, MGC4423, MGC10556, MGC10558, MGC29959	OPA-interacting protein 1; zyxin related protein 1; go_component: cellular component unknown; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: thyroid hormone receptor binding; go_process: biological process unknown	thyroid hormone receptor interactor 6
TRIP6_P1090_F	2401	0.08376858	7407.978	686.4343	2.930096E-09	29	470.5279	0.7410159	3247.091	9576.833	2.24946E-16	34	835.1031	0.7442265	4465.7	13284.86	2.351409E-35	29	799.4965	0.06872265	3448.395	261.8502	0.09507108	26	228.2695	0.7769367	2876.188	10366.16	7.323829E-19	25	1003.865	0.8161892	2287.403	10600.97	1.52959E-20	33	1281.163	0.6005095	5363.023	8211.955	1.202033E-15	26	682.7461	0.6120526	6851.13	10966.58	4.115237E-19	31	634.5326	0.7651289	2769.857	9349.001	7.628437E-16	31	769.556	0.6220959	5439.063	9118.261	1.032547E-22	35	615.4777	TRIP6	TRIP6_P1090_F	23308730	NM_003302.1	TRIP6	7205	7	36.1	100301891	-1090	Y	AAGGGGACTTTGTGAACAGTGGGCGGGGAGACGCAGAGGCAGAGG	OIP1, ZRP-1, MGC3837, MGC4423, MGC10556, MGC10558, MGC29959	OPA-interacting protein 1; zyxin related protein 1; go_component: cellular component unknown; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: thyroid hormone receptor binding; go_process: biological process unknown	thyroid hormone receptor interactor 6
TRIP6_P1274_R	2402	0.4067706	4367.496	3063.312	8.542536E-08	33	286.721	0.8195482	2638.521	12437.39	7.198626E-23	30	749.4114	0.827581	3043.67	15089.06	5.602422E-37	30	947.7064	0.333638	3369.287	1737.023	0.01301418	34	156.588	0.8356369	2354.174	12477.23	7.008053E-24	39	905.4852	0.8306249	2845.005	14442.47	4.344036E-38	34	812.939	0.7380601	3811.555	11021.47	8.205572E-19	30	820.7385	0.7364876	4906.374	13992.25	1.396289E-21	33	715.5769	0.8283251	2077.33	10505.53	3.839859E-17	36	680.1092	0.7731363	3655.635	12798.95	2.430744E-29	29	666.8123	TRIP6	TRIP6_P1274_R	23308730	NM_003302.1	TRIP6	7205	7	36.1	100301707	-1274	Y	CTTGGGCATGGTGCCCGCTTGGCATAGCGCCCGGCTCCGGATCTTCCTGTGCCT	OIP1, ZRP-1, MGC3837, MGC4423, MGC10556, MGC10558, MGC29959	OPA-interacting protein 1; zyxin related protein 1; go_component: cellular component unknown; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: thyroid hormone receptor binding; go_process: biological process unknown	thyroid hormone receptor interactor 6
TRPM5_E87_F	3986	0.4039268	5384.413	3716.491	9.161965E-12	25	463.9569	0.9267688	1063.837	14728.8	3.503389E-25	32	983.4777	0.9498132	1009.186	20991.96	3.678E-38	28	661.9614	0.4095739	2205.512	1599.316	0.08500181	30	269.4628	0.9319069	1076.646	16103.32	1.828897E-32	27	756.2238	0.9127712	1621.892	18018.04	3.678E-38	30	821.5898	0.9264308	1183.936	16168.15	4.149815E-26	26	1122.498	0.934839	1188.641	18487.62	1.855377E-23	25	1002.097	0.8815085	1122.436	9094.218	4.180126E-11	33	797.5141	0.9376596	888.9253	14874.39	8.034922E-27	39	476.1393	TRPM5	TRPM5_E87_F	24475627	NM_014555.2	TRPM5	29850	11	36.1	2400764	87	N	AGACCCTCCAAAGTTGACCTCGCCCCTGTGCAAGCCCAGCTCCC	MTR1, LTRPC5	MLSN1 and TRP-related; MLSN1- and TRP-related; go_component: membrane; go_component: integral to membrane; go_function: cation channel activity; go_process: cation transport	transient receptor potential cation channel, subfamily M, member 5
TRPM5_P721_F	2153	0.4251165	509.4905	450.7078	0.7076872	36	25.21891	0.9065917	563.7122	6441.777	5.695624E-05	36	320.3396	0.9128285	696.797	8343.77	1.179556E-08	27	312.4541	0.3417984	441.3679	281.1277	0.741959	32	26.02749	0.9141689	549.3079	6915.642	6.173409E-06	31	296.0692	0.892388	689.7907	6549.458	2.651019E-06	26	533.0827	0.8887671	684.3328	6266.936	0.0003565473	33	348.7217	0.8957675	957.8992	9091.516	4.321474E-06	34	359.6559	0.8751575	623.1828	5069.576	0.001481219	26	451.7091	0.8869289	642.3489	5822.981	0.0001773774	31	219.8027	TRPM5	TRPM5_P721_F	24475627	NM_014555.2	TRPM5	29850	11	36.1	2401572	-721	N	GGCTCATGTCTCCCAGCTGCCCGGTGAGGTCGGGCATCTCAGCCCCT	MTR1, LTRPC5	MLSN1 and TRP-related; MLSN1- and TRP-related; go_component: membrane; go_component: integral to membrane; go_function: cation channel activity; go_process: cation transport	transient receptor potential cation channel, subfamily M, member 5
TRPM5_P979_F	2155	0.7256032	947.6435	2770.344	0.02775185	19	172.3143	0.9121154	1061.051	12050.04	3.88077E-17	31	508.0405	0.9187382	1156.683	14207.93	4.393392E-26	22	679.0914	0.9032236	495.1473	5554.568	0.0022239	35	267.3581	0.9072509	1124.354	11976.35	1.911118E-18	32	778.3862	0.9187301	1098.109	13544.23	7.4138E-27	26	701.6038	0.9069083	1216.139	12821.96	8.942075E-17	33	425.509	0.913452	1435.22	16203.16	1.019708E-18	27	602.7361	0.8973061	1253.988	11830.7	1.3105E-18	27	634.4719	0.87723	1264.174	9747.449	9.855885E-13	19	265.3592	TRPM5	TRPM5_P979_F	24475627	NM_014555.2	TRPM5	29850	11	36.1	2401830	-979	N	TCTGTCTGCCCTCCTGGAACCACGCGTCGGGTCACAGGCCGCTGGGCAGA	MTR1, LTRPC5	MLSN1 and TRP-related; MLSN1- and TRP-related; go_component: membrane; go_component: integral to membrane; go_function: cation channel activity; go_process: cation transport	transient receptor potential cation channel, subfamily M, member 5
TSC2_E140_F	4202	0.2291792	358.95	136.4543	0.8318514	29	15.15871	0.7208273	2067.432	5596.337	7.075292E-06	37	328.1471	0.6877129	2572.272	5884.828	1.449745E-07	26	440.696	0.05955216	1918.096	127.7923	0.4134932	29	87.90343	0.5608752	2969.941	3921.104	4.209546E-05	30	286.1454	0.7234818	2019.792	5546.222	7.095588E-07	26	505.1442	0.7598919	1829.515	6106.511	2.467659E-05	24	389.4029	0.6022253	3170.328	4951.231	0.000397657	27	389.7158	0.7264226	1822.519	5104.813	4.195059E-05	28	221.84	0.720294	2079.105	5611.595	3.308913E-06	38	300.174	TSC2	TSC2_E140_F	10938006	NM_000548.2	TSC2	7249	16	36.1	2038740	140	N	AGAGGGTAAACAGACGGAGTTTATCATCACCGCGGAAATACTGAGAGTGAGTGA	LAM, TSC4, uberin, TUBERIN	isoform 1 is encoded by transcript variant 1; tuberin isoform 1; tuberin isoform 2; tuberin isoform 3; go_component: cytosol; go_component: plasma membrane; go_component: membrane fraction; go_function: unfolded protein binding; go_function: GTPase activator activity; go_process: cell cycle; go_process: endocytosis; go_process: protein folding; go_process: negative regulation of progression through cell cycle	tuberous sclerosis 2 isoform 1
TSG101_P139_R	6082	0.07381952	4150.864	338.8073	0.004611184	34	188.2927	0.1687564	9291.029	1906.536	2.072851E-12	32	561.4753	0.1901735	10411.67	2468.48	5.289086E-18	33	717.8263	0.2222066	4206.975	1230.453	0.007283781	24	238.413	0.1769419	8973.018	1950.527	1.125143E-12	31	649.8615	0.1997441	9912.523	2499.129	5.558951E-19	23	491.0334	0.2021659	9584.471	2453.981	3.282581E-12	32	705.591	0.2082054	12339.31	3270.964	1.432741E-14	27	645.7187	0.2059773	8254.492	2167.237	1.429792E-11	32	656.0599	0.1937658	10881.32	2639.189	1.803104E-19	29	571.5209	TSG101	TSG101_P139_R	18765712	NM_006292.2	TSG101	7251	11	36.1	18505204	-139	Y	CGAGTGCCGGAATCAGCAGGACGAATCGGGTCCCAAAGATGTGGGCAAG	TSG10, VPS23	go_component: membrane; go_function: DNA binding; go_function: protein binding; go_function: protein binding; go_function: ubiquitin-protein ligase activity; go_function: transcription corepressor activity; go_process: protein transport; go_process: ubiquitin cycle; go_process: regulation of cell growth	tumor susceptibility gene 101
TSG101_P257_R	6052	0.1743139	4229.362	913.9888	0.0007184415	25	234.613	0.2537174	6198.055	2141.181	6.599608E-07	24	543.4849	0.2399215	6368.825	2041.908	1.754544E-07	22	390.3698	0.05380091	4708.414	273.4066	0.01601082	16	198.066	0.2713785	6109.012	2312.576	1.667357E-07	23	297.6596	0.2975379	5905.276	2543.621	1.417526E-08	30	327.0375	0.307353	6114.742	2757.711	1.302638E-06	26	373.3812	0.3339063	6505.879	3311.462	7.911965E-06	25	448.8046	0.2802026	6141.278	2429.604	9.307112E-08	33	281.7643	0.279763	7441.413	2929.325	2.913453E-11	19	481.3957	TSG101	TSG101_P257_R	18765712	NM_006292.2	TSG101	7251	11	36.1	18505322	-257	Y	GCTAGTGCCGGAGAGGGAAGAAGTACGAAGGGCTTGCCAGTGAGCCTTAA	TSG10, VPS23	go_component: membrane; go_function: DNA binding; go_function: protein binding; go_function: protein binding; go_function: ubiquitin-protein ligase activity; go_function: transcription corepressor activity; go_process: protein transport; go_process: ubiquitin cycle; go_process: regulation of cell growth	tumor susceptibility gene 101
TSP50_E21_R	3987	0.4544726	7120.733	6015.509	2.87816E-25	32	674.1208	0.9070912	2083.746	21320.44	3.678E-38	33	1613.103	0.8894475	2841.479	23665.59	3.678E-38	29	1389.873	0.7921943	1813.5	7294.621	6.168153E-07	36	373.0717	0.9037504	2014.439	19853.84	3.678E-38	33	1167.381	0.8488298	3483.794	20123.22	3.678E-38	25	856.8334	0.8066878	4168.441	17812.11	3.678E-38	23	1065.598	0.8479546	3929.084	22470.14	3.678E-38	25	1560.465	0.841777	2225.041	12369.67	2.033645E-23	28	1098.107	0.8783351	2727.284	20411	3.678E-38	29	1035.243	TSP50	TSP50_E21_R	31543829	NM_013270.2	TSP50	29122	3	36.1	46734347	21	Y	GGGTGGCAGCCGACTGCGTCTCTCCGGAAGGCGCTCCCAGTGCCGCCC	.	go_function: trypsin activity; go_function: chymotrypsin activity; go_process: proteolysis	testes-specific protease 50
TSP50_P137_F	2158	0.3484644	3518.674	1935.395	0.0002656512	29	158.2083	0.8886589	1338.25	11479.26	2.338295E-16	31	711.2889	0.6797605	4943.395	10705.43	4.132199E-27	33	1119.448	0.2671241	3852.062	1440.477	0.009439075	26	274.0302	0.693514	3163.974	7385.693	8.371102E-12	45	857.2885	0.4851695	6809.795	6511.701	5.11839E-22	24	790.0659	0.3221058	8075.297	3884.545	4.778916E-12	24	532.0535	0.56963	5601.214	7546.025	2.707096E-10	25	997.1251	0.5880063	3894.807	5701.476	9.219244E-10	21	645.8871	0.7608981	2899.384	9544.991	2.175995E-16	23	393.264	TSP50	TSP50_P137_F	31543829	NM_013270.2	TSP50	29122	3	36.1	46734505	-137	Y	GCTCGTGGTGTCTGACCCGCAAGGGCGCCCCTAGTGACAGCCCTCCCTTATA	.	go_function: trypsin activity; go_function: chymotrypsin activity; go_process: proteolysis	testes-specific protease 50
TUBB3_E91_F	3990	0.03952116	6614.396	276.2796	1.034595E-06	20	308.8599	0.02741287	11054.03	314.382	8.484704E-13	30	692.0887	0.02291317	16713.33	394.2809	1.03692E-32	22	906.9409	0.1260169	6002.77	879.9393	0.0003484176	22	450.6739	0.5615969	8476.913	10987.08	3.678E-38	12	1155.451	0.02731481	13629.49	385.5497	1.706296E-24	31	827.8173	0.3469511	10263.03	5505.657	2.255821E-21	20	1121.093	0.3487486	12917.09	6970.721	5.538932E-24	29	1158.536	0.3388793	6945.94	3611.63	6.929193E-12	27	678.3011	0.6299967	7185.529	12404.92	3.678E-38	25	1082.624	TUBB3	TUBB3_E91_F	50592995	NM_006086.2	TUBB3	10381	16	36.1	88517337	91	Y	AGTATGAGGGAGATCGTGCACATCCAGGCCGGCCAGTGCGGCAACCAGATCGG	MC1R, TUBB4, beta-4	go_component: cytoplasm; go_component: cytoskeleton; go_component: microtubule; go_component: protein complex; go_component: integral to membrane; go_function: GTP binding; go_function: GTPase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: structural molecule activity; go_function: rhodopsin-like receptor activity; go_function: structural constituent of cytoskeleton; go_function: melanocyte stimulating hormone receptor activity; go_process: signal transduction; go_process: protein polymerization; go_process: microtubule-based movement; go_process: G-protein coupled receptor protein signaling pathway	tubulin, beta, 4
TUBB3_P364_F	2162	0.047833	2819.216	146.6496	0.1068271	26	128.1207	0.03750167	7461.645	294.6232	5.184589E-06	27	329.3158	0.02532525	9907.581	260.0298	5.258684E-11	29	317.5266	0.05264886	2563.193	148.0065	0.2562591	26	145.4324	0.03437823	7191.547	259.5949	6.479233E-06	30	384.1335	0.03204428	7479.052	250.9054	3.567036E-07	28	597.7259	0.02891414	7822.156	235.8827	1.719977E-05	24	563.6398	0.02787009	9458.092	274.0219	9.838498E-06	34	423.6181	0.06194312	5431.664	365.2747	0.001133823	28	282.2611	0.03260877	8410.718	286.8788	6.709669E-08	22	346.4123	TUBB3	TUBB3_P364_F	50592995	NM_006086.2	TUBB3	10381	16	36.1	88516882	-364	Y	GGCGTGGGGAAAAAAGACCCTCCGTACAAAGCCGCAGGGTGGGGC	MC1R, TUBB4, beta-4	go_component: cytoplasm; go_component: cytoskeleton; go_component: microtubule; go_component: protein complex; go_component: integral to membrane; go_function: GTP binding; go_function: GTPase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: structural molecule activity; go_function: rhodopsin-like receptor activity; go_function: structural constituent of cytoskeleton; go_function: melanocyte stimulating hormone receptor activity; go_process: signal transduction; go_process: protein polymerization; go_process: microtubule-based movement; go_process: G-protein coupled receptor protein signaling pathway	tubulin, beta, 4
TUBB3_P721_R	2163	0.08440717	2567.967	245.956	0.1339397	23	79.98982	0.07835822	7312.909	630.2474	2.729253E-06	24	310.9643	0.07550206	8064.685	666.7949	4.567809E-08	33	227.891	0.03675373	3628.963	142.2827	0.08848127	23	139.8285	0.08243407	6730.972	613.6941	9.373372E-06	31	346.1302	0.1149026	6996.049	921.2036	1.590996E-07	24	343.2448	0.09733395	6556.23	717.7373	0.000155823	33	355.3396	0.09011701	8747.032	876.2314	1.295363E-05	22	230.3243	0.09691162	6271.401	683.7235	3.832899E-05	23	353.5839	0.08749308	6973.138	678.1874	3.809611E-06	21	377.5368	TUBB3	TUBB3_P721_R	50592995	NM_006086.2	TUBB3	10381	16	36.1	88516525	-721	Y	CCTTGTGACAATTCCTGACACGGATGCGCACCGGGCAGTGGCACGTCCAGGTGCT	MC1R, TUBB4, beta-4	go_component: cytoplasm; go_component: cytoskeleton; go_component: microtubule; go_component: protein complex; go_component: integral to membrane; go_function: GTP binding; go_function: GTPase activity; go_function: receptor activity; go_function: nucleotide binding; go_function: structural molecule activity; go_function: rhodopsin-like receptor activity; go_function: structural constituent of cytoskeleton; go_function: melanocyte stimulating hormone receptor activity; go_process: signal transduction; go_process: protein polymerization; go_process: microtubule-based movement; go_process: G-protein coupled receptor protein signaling pathway	tubulin, beta, 4
TUSC3_E29_R	3992	0.2048769	3612.681	956.6351	0.003738841	28	135.7895	0.2547226	7920.37	2741.22	3.091924E-11	28	358.6974	0.2191707	7971.043	2265.459	3.686583E-11	24	762.2278	0.06212839	4211.53	285.6131	0.03390576	27	276.0194	0.2174427	7451.042	2098.146	1.213017E-09	27	497.884	0.3964553	6834.797	4555.316	7.327699E-16	31	591.8466	0.1922292	8701.834	2094.616	8.900171E-10	34	489.3767	0.2014753	10023.66	2554.294	2.007784E-09	24	605.3254	0.2165297	6867.127	1925.523	3.615564E-08	25	390.7301	0.1384108	10590.75	1717.425	5.094957E-16	22	822.2753	TUSC3	TUSC3_E29_R	30410789	NM_178234.1	TUSC3	7991	8	36.1	15442130	29	Y	CAGGTCTTCTCCCGGTGAACCGGATGCTCTGTCAGTCTCCTCCTCTGCGTC	N33, OST3A, D8S1992, MGC13453	isoform b is encoded by transcript variant 2; Putative prostate cancer tumor suppressor; go_component: membrane; go_component: integral to membrane; go_function: electron transporter activity; go_process: electron transport	tumor suppressor candidate 3 isoform b
TUSC3_P85_R	2164	0.07540753	1850.187	159.0526	0.348374	22	83.45113	0.1691873	5276.966	1094.969	0.0003439768	25	450.5459	0.1385279	6654.192	1086.099	2.407338E-06	25	380.1389	0.1714063	2864.928	613.337	0.1234296	29	130.9079	0.1180578	6095.29	829.3084	3.781759E-05	21	366.2889	0.2265244	5675.165	1691.347	1.599907E-06	36	464.5762	0.1668267	5797.353	1180.83	0.000333348	25	401.8126	0.1504311	7349.609	1319.084	0.000123685	28	345.3907	0.1291906	5362.191	810.3538	0.0004110714	32	375.9473	0.09616552	7658.957	825.5317	1.605605E-07	23	336.0924	TUSC3	TUSC3_P85_R	30410789	NM_178234.1	TUSC3	7991	8	36.1	15442016	-85	Y	TCCTCTCCTCAGCGCTGGTCCGGGAAAGGCAAGCTCCGGGCGGGAGC	N33, OST3A, D8S1992, MGC13453	isoform b is encoded by transcript variant 2; Putative prostate cancer tumor suppressor; go_component: membrane; go_component: integral to membrane; go_function: electron transporter activity; go_process: electron transport	tumor suppressor candidate 3 isoform b
TWIST1_E117_R	3995	0.05576723	3063.124	186.8169	0.06717833	25	94.62795	0.0406809	5912.519	254.9669	0.0005884425	31	128.2474	0.03519908	6865.744	254.1331	2.152712E-05	22	203.6953	0.2230538	330.9394	123.7186	0.7953317	24	14.92902	0.0419632	6537.545	290.7327	5.135336E-05	21	222.0309	0.04172837	6558.869	289.9634	1.168125E-05	35	272.5543	0.06052107	5959.829	390.3731	0.001474635	20	279.7381	0.03094258	6770.336	219.3739	0.003344257	28	201.3803	0.03730136	6665.761	262.1507	4.187187E-05	18	236.4691	0.02187855	6617.326	150.2526	7.175981E-05	25	224.4477	TWIST1	TWIST1_E117_R	68160957	NM_000474.3	TWIST1	7291	7	36.1	19123703	117	Y	GATGGCCCCGAGGTCCAAAAAGAAAGCGCCCAACGGCTGGACGCACACCCC	SCS, ACS3, BPES2, BPES3, TWIST	blepharophimosis, epicanthus inversus and ptosis 3; acrocephalosyndactyly 3; TWIST homolog of drosophila; blepharophimosis, epicanthus inversus, and ptosis 2; H-twist; B-HLH DNA binding protein; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: enzyme inhibitor activity; go_function: RNA polymerase II transcription factor activity; go_process: morphogenesis; go_process: cell differentiation; go_process: skeletal development; go_process: regulation of transcription, DNA-dependent; go_process: chromosome organization and biogenesis (sensu Eukaryota); go_process: negative regulation of transcription from RNA polymerase II promoter	twist
TWIST1_P355_R	2167	0.1117152	4129.77	531.9573	0.002914322	24	191.2567	0.1105002	6204.719	783.2188	6.003057E-05	27	292.5015	0.1049856	8760.205	1039.306	3.345398E-10	29	433.629	0.04242561	5223.627	235.8649	0.006996831	31	408.2632	0.1332773	6993.406	1090.765	6.3223E-07	20	411.9876	0.1507834	6985.875	1258.139	3.680004E-08	27	316.4933	0.133895	6882.917	1079.52	2.283487E-05	32	393.8965	0.1419992	9317.394	1558.58	4.378433E-07	25	411.1454	0.154833	5823.957	1085.258	4.448313E-05	19	375.9855	0.1368579	7825.723	1256.685	1.301062E-08	30	362.1956	TWIST1	TWIST1_P355_R	68160957	NM_000474.3	TWIST1	7291	7	36.1	19124175	-355	Y	TCCTGGCCGCGGTGGCAGCCCCATCCGGAGTGGCTGTGACAGCAGCAATG	SCS, ACS3, BPES2, BPES3, TWIST	blepharophimosis, epicanthus inversus and ptosis 3; acrocephalosyndactyly 3; TWIST homolog of drosophila; blepharophimosis, epicanthus inversus, and ptosis 2; H-twist; B-HLH DNA binding protein; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: enzyme inhibitor activity; go_function: RNA polymerase II transcription factor activity; go_process: morphogenesis; go_process: cell differentiation; go_process: skeletal development; go_process: regulation of transcription, DNA-dependent; go_process: chromosome organization and biogenesis (sensu Eukaryota); go_process: negative regulation of transcription from RNA polymerase II promoter	twist
TWIST1_P44_R	2168	0.09058919	1815.205	190.7794	0.3494489	30	79.79092	0.1516433	3623.417	665.559	0.03095463	38	293.3621	0.1944301	5328.507	1310.209	0.000101034	25	247.0142	0.09096446	2109.668	221.1149	0.3425843	28	113.2227	0.1733316	4788.334	1024.961	0.0009441585	18	328.2452	0.2081169	4747.096	1273.878	0.000195274	35	319.7022	0.1917258	4660.795	1129.279	0.004806119	22	240.8665	0.1858052	5058.28	1177.157	0.01119117	22	257.4764	0.1785527	3611.347	806.7119	0.02391236	26	317.2647	0.2285345	5904.575	1778.761	3.3975E-06	30	256.4105	TWIST1	TWIST1_P44_R	68160957	NM_000474.3	TWIST1	7291	7	36.1	19123864	-44	Y	GGGGGCAGCAGTGTCATTGGCCTGACGTGAGGAGGAGGGACTTTT	SCS, ACS3, BPES2, BPES3, TWIST	blepharophimosis, epicanthus inversus and ptosis 3; acrocephalosyndactyly 3; TWIST homolog of drosophila; blepharophimosis, epicanthus inversus, and ptosis 2; H-twist; B-HLH DNA binding protein; go_component: nucleus; go_function: DNA binding; go_function: protein binding; go_function: enzyme inhibitor activity; go_function: RNA polymerase II transcription factor activity; go_process: morphogenesis; go_process: cell differentiation; go_process: skeletal development; go_process: regulation of transcription, DNA-dependent; go_process: chromosome organization and biogenesis (sensu Eukaryota); go_process: negative regulation of transcription from RNA polymerase II promoter	twist
TYK2_P494_F	5329	0.2240896	2190.176	661.4224	0.1268128	27	101.7887	0.09342242	9921.756	1032.738	7.194199E-12	25	673.9114	0.0674161	13943.43	1015.193	1.182699E-24	26	521.879	0.01416879	14420.47	208.6944	1.226331E-17	23	1408.135	0.1613498	8932.14	1737.713	4.430062E-12	25	663.872	0.2292715	8932.024	2686.79	1.559392E-16	33	588.4783	0.2085981	7188.328	1921.061	5.813073E-07	28	727.2639	0.2056327	11829.12	3088.013	2.778448E-13	26	783.0693	0.2098561	7286.277	1961.738	4.737806E-09	31	552.3626	0.09485437	11936.44	1261.354	1.623407E-18	22	779.9777	TYK2	TYK2_P494_F	34222294	NM_003331.3	TYK2	7297	19	36.1	10352705	-494	Y	CGGTCCTGTCTCCTTTCCCTCGTTTCTACCTGGCCGACTCCATCCTG	JTK1	go_component: cytoskeleton; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: Janus kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	tyrosine kinase 2
TYRO3_P366_F	5236	0.03213873	5476.873	185.1852	0.0001310761	29	201.9403	0.2763266	6324.111	2452.975	1.249822E-07	42	228.1143	0.2871389	7497.257	3060.159	6.791993E-12	21	325.012	0.1739555	4843.135	1040.968	0.003110427	25	207.181	0.2649356	6405.496	2344.744	4.278333E-08	39	385.3753	0.3365004	6180.671	3185.305	1.408243E-10	27	425.3738	0.2484492	6963.164	2334.955	3.001882E-07	34	276.8693	0.2285834	9128.661	2734.604	2.151016E-08	30	398.9747	0.2955468	5567.324	2377.673	1.148525E-06	39	393.1705	0.2485129	7407.703	2482.758	3.16261E-10	22	468.7394	TYRO3	TYRO3_P366_F	27597077	NM_006293.2	TYRO3	7301	15	36.1	39638158	-366	Y	ATGCTGGATTCTGGGATCAGAGTCCGAACAAGAGTTGGGGTGTGG	BYK, Brt, Dtk, RSE, Sky, Tif	tyrosine-protein kinase receptor TYRO3 precursor; Tyro3 protein tyrosine kinase (sea-related receptor tyrosine kinase); TYRO3 protein tyrosine kinase variant; go_component: integral to plasma membrane; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: signal transduction; go_process: protein amino acid phosphorylation	TYRO3 protein tyrosine kinase
TYRO3_P501_F	5237	0.1406952	3153.918	532.7687	0.02958195	26	186.92	0.08124448	11244.08	1003.144	6.720027E-15	22	674.4395	0.0639296	15283.08	1050.599	1.137558E-29	31	650.6972	0.3279266	317.9161	203.915	0.7826003	26	15.36011	0.0695634	12711.25	957.8235	3.795674E-20	29	647.9442	0.1156054	10186.1	1344.568	2.842917E-16	27	674.9606	0.05759134	11522.1	710.2358	1.2842E-12	25	852.895	0.04893189	16261.63	841.7964	1.437468E-17	20	707.1609	0.0859423	7456.717	710.504	4.831346E-07	25	391.7152	0.05650207	13232.79	798.4436	4.926401E-21	25	659.3652	TYRO3	TYRO3_P501_F	27597077	NM_006293.2	TYRO3	7301	15	36.1	39638023	-501	N	GAATGGCTCAATGAAAGGGAGGCACGAAGGGATGCTAGCCGATCCTGT	BYK, Brt, Dtk, RSE, Sky, Tif	tyrosine-protein kinase receptor TYRO3 precursor; Tyro3 protein tyrosine kinase (sea-related receptor tyrosine kinase); TYRO3 protein tyrosine kinase variant; go_component: integral to plasma membrane; go_function: ATP binding; go_function: protein binding; go_function: receptor activity; go_function: nucleotide binding; go_function: transferase activity; go_function: protein serine/threonine kinase activity; go_function: receptor signaling protein tyrosine kinase activity; go_function: transmembrane receptor protein tyrosine kinase activity; go_process: cell adhesion; go_process: signal transduction; go_process: protein amino acid phosphorylation	TYRO3 protein tyrosine kinase
UBA52_P293_R	2404	0.2040488	1869.377	504.8663	0.2371471	34	85.33411	0.3330984	4396.503	2245.875	0.0001636769	24	296.818	0.4072768	3815.243	2690.274	0.0001514125	24	401.4979	0.1838975	939.6675	234.2748	0.6380717	38	39.26823	0.4229208	4017.408	3017.501	2.647028E-05	21	278.3735	0.3494359	4056.03	2232.318	8.254385E-05	19	192.2495	0.3566666	4249.449	2411.352	0.0007221992	19	296.8916	0.3852534	4387.072	2811.987	0.002321592	24	171.6254	0.3891525	3938.471	2572.789	0.000153697	26	356.8221	0.3861411	4575.61	2941.141	6.126306E-06	30	299.3162	UBA52	UBA52_P293_R	15451941	NM_003333.2	UBA52	7311	19	36.1	18543375	-293	Y	TTAGAAAACATTCTCCTCTACTCCGTTCAGCTATTCGCTGAGGGCCCGCC	CEP52, RPL40, RPS27A, HUBCEP52, MGC57125	ubiquitin-52 amino acid fusion protein; ubiquitin carboxyl extension protein 52; 60S ribosomal protein L40; ubiquitin-CEP52; ribosomal protein S27a; go_component: ribosome; go_component: nucleus; go_function: protein binding; go_function: structural constituent of ribosome; go_function: transcription regulator activity; go_process: cell cycle; go_process: axon guidance; go_process: protein biosynthesis; go_process: protein modification; go_process: protein ubiquitination; go_process: ER-associated protein catabolism; go_process: regulation of synaptic plasticity; go_process: positive regulation of transcription; go_process: long-term strengthening of neuromuscular junction	ubiquitin and ribosomal protein L40 precursor
UGT1A1_E11_F	2962	0.7489966	1010.665	3314.236	0.007012338	29	131.0166	0.9695592	564.4661	21163.66	3.678E-38	27	1588.192	0.9719983	536.6859	22100.76	3.678E-38	31	1480.581	0.772334	468.3006	1927.903	0.3269586	22	121.3669	0.968542	556.223	20204.05	3.678E-38	26	1179.881	0.9664558	650.6617	21627.65	3.678E-38	29	1323.569	0.972627	615.7376	25431.89	3.678E-38	28	810.3711	0.9743255	615.3732	27147.82	3.678E-38	30	736.861	0.947063	507.2078	10863.17	7.223206E-14	26	1154.24	0.9730136	566.5277	24032.18	3.678E-38	25	1211.711	UGT1A1	UGT1A1_E11_F	45827762	NM_000463.2	UGT1A1	54658	2	36.1	234333669	11	N	GGCGAACCTCTGGCAGGAGCAAAGGCGCCATGGCTGTGGAGTCCCAGG	GNT1, UGT1, UDPGT, UGT1A, UGT1*1, HUG-BR1	UDP glycosyltransferase 1 family, polypeptide A1; bilirubin UDP-glucuronosyltransferase isozyme 1; UDP glucuronosyltransferase 1A1; bilirubin UDP-glucuronosyltransferase 1-1; go_component: membrane; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: glucuronosyltransferase activity; go_function: glucuronosyltransferase activity; go_function: glucuronosyltransferase activity; go_process: metabolism; go_process: digestion; go_process: estrogen metabolism; go_process: bilirubin conjugation	UDP glycosyltransferase 1 family, polypeptide A1 precursor
UGT1A1_P315_R	2406	0.3535877	2742.087	1554.623	0.007518894	31	161.9755	0.8673784	1616.826	11228.46	1.976751E-16	31	966.4879	0.9074084	1530.541	15979.47	2.362049E-34	23	891.8134	0.802943	669.7617	3136.527	0.0848528	26	115.4375	0.8967173	1176.46	11082.43	4.498849E-16	21	1335.394	0.8517926	2033.051	12259.29	1.592796E-25	38	775.8449	0.9016598	1369.019	13469.12	7.954016E-19	33	760.4713	0.8962036	1824.186	16613.9	1.647668E-20	29	994.5095	0.8579625	1483.538	9565.193	4.607418E-13	29	512.2007	0.9125806	1580.431	17542.21	3.678E-38	34	822.2328	UGT1A1	UGT1A1_P315_R	45827762	NM_000463.2	UGT1A1	54658	2	36.1	234333343	-315	N	AGAAGCCTAACTTGTTCACTACATAGTCGTCCTTCTTCCTCTCTGGTAACACTTGTTGG	GNT1, UGT1, UDPGT, UGT1A, UGT1*1, HUG-BR1	UDP glycosyltransferase 1 family, polypeptide A1; bilirubin UDP-glucuronosyltransferase isozyme 1; UDP glucuronosyltransferase 1A1; bilirubin UDP-glucuronosyltransferase 1-1; go_component: membrane; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: glucuronosyltransferase activity; go_function: glucuronosyltransferase activity; go_function: glucuronosyltransferase activity; go_process: metabolism; go_process: digestion; go_process: estrogen metabolism; go_process: bilirubin conjugation	UDP glycosyltransferase 1 family, polypeptide A1 precursor
UGT1A1_P564_R	2820	0.8279839	2643.008	13203.21	1.826628E-37	40	469.0263	0.9252796	1738.231	22763.2	3.678E-38	29	2173.319	0.941856	1633.013	28072.55	3.678E-38	27	1749.867	0.8473259	1897.252	11084.55	7.341796E-14	22	950.1746	0.9182559	1967.118	23220.56	3.678E-38	35	1652.996	0.9265254	1945.887	25798.91	3.678E-38	29	2069.292	0.9153404	2175.576	24603.54	3.678E-38	36	1802.97	0.9218925	2266.739	27934.28	3.678E-38	33	1580.833	0.8962968	1851.767	16868.94	3.678E-38	23	1948.485	0.9410759	1694.444	28659.06	3.678E-38	31	1441.544	UGT1A1	UGT1A1_P564_R	45827762	NM_000463.2	UGT1A1	54658	2	36.1	234333094	-564	N	TCTGGCTCACCTCATGGCGCGTGCTCGTGTGGTGGGCTCTGCTGCAGCCTCAAGACC	GNT1, UGT1, UDPGT, UGT1A, UGT1*1, HUG-BR1	UDP glycosyltransferase 1 family, polypeptide A1; bilirubin UDP-glucuronosyltransferase isozyme 1; UDP glucuronosyltransferase 1A1; bilirubin UDP-glucuronosyltransferase 1-1; go_component: membrane; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: glucuronosyltransferase activity; go_function: glucuronosyltransferase activity; go_function: glucuronosyltransferase activity; go_process: metabolism; go_process: digestion; go_process: estrogen metabolism; go_process: bilirubin conjugation	UDP glycosyltransferase 1 family, polypeptide A1 precursor
UGT1A7_P751_R	2413	0.7282389	508.8324	1631.49	0.3061769	30	61.12442	0.9701063	501.9518	19534.47	3.678E-38	25	1667.322	0.9792365	483.199	27504.51	3.678E-38	28	868.3004	0.883445	376.6985	3613.203	0.06764331	22	203.7021	0.9752654	439.9983	21291.67	3.678E-38	30	892.9829	0.9733523	471.468	20873.84	3.678E-38	39	1155.018	0.9710604	459.4742	18773.01	2.174809E-32	32	1641.571	0.9783998	514.285	27824.56	3.678E-38	34	822.738	0.9402962	486.3994	9235.411	5.021522E-10	18	726.5226	0.9794376	422.9332	24908.61	3.678E-38	33	856.4901	UGT1A7	UGT1A7_P751_R	41282212	NM_019077.2	UGT1A7	54577	2	36.1	234254572	-751	N	CGCTAAGACCCTTGCTCTCTTTCCGTCGAACATGAGATGCCAATTTCTTTCTGGG	UDPGT, UGT1G, UGT1*7	UDP-glucuronosyltransferase 1A7; UGT1A7*5 (Gly115Ser); UGT1A7*6 (Glu139Asp); UDP glycosyltransferase 1 family, polypeptide A7; UDP glycosyltransferase 1 family, polypeptide A6; go_component: microsome; go_component: integral to membrane; go_component: endoplasmic reticulum; go_function: glucuronosyltransferase activity; go_process: metabolism	UDP glycosyltransferase 1 family, polypeptide A7 precursor
UNG_P170_F	2180	0.1234692	2493.003	365.2535	0.1255812	32	94.90812	0.0514225	8313.277	456.0847	1.288163E-07	28	429.9612	0.03897354	9728.862	398.6004	6.459672E-11	30	371.1529	0.5467626	676.579	936.8253	0.5259458	26	39.11332	0.06203298	8220.802	550.301	3.916279E-08	29	375.1068	0.05916796	7614.867	485.1801	7.07555E-08	17	345.1151	0.06245292	7821.295	527.662	7.080449E-06	34	460.5655	0.04739005	11371.56	570.6825	1.66819E-08	27	458.6548	0.07312801	6052.863	485.4463	0.0001416827	27	410.1282	0.04449557	9221.559	434.0829	9.67608E-10	42	393.0928	UNG	UNG_P170_F	19718744	NM_003362.2	UNG	7374	12	36.1	108019628	-170	Y	AGCAGAGGTGGGCTGAAGGCACAAAGCGAATGAAAGAATAGGCCCCCGG	DGU, UDG, UNG1, HIGM4, UNG15, DKFZp781L1143	isoform UNG1 precursor is encoded by transcript variant 1; uracil-DNA glycosylase 1; HUMAN URACIL-DNA GLYCOSYLASE 2; go_component: nucleus; go_component: mitochondrion; go_function: uracil DNA N-glycosylase activity; go_function: uracil DNA N-glycosylase activity; go_function: hydrolase activity, acting on glycosyl bonds; go_process: DNA repair; go_process: carbohydrate metabolism; go_process: base-excision repair	uracil-DNA glycosylase isoform UNG1 precursor
USP29_E274_F	4004	0.8048435	1170.55	5239.865	7.873904E-06	20	309.9581	0.9664486	617.0535	20654.72	3.678E-38	28	1539.48	0.9733347	524.2474	22786.2	3.678E-38	28	1351.241	0.6826301	355.8247	980.4318	0.5974891	30	60.3157	0.9682066	499.9569	18270.55	3.678E-38	40	1368.884	0.9599644	659.6048	18213.63	3.678E-38	30	1227.112	0.9649401	614.0431	19652.3	3.800283E-36	20	1604.06	0.9668717	773.9951	25508.15	3.678E-38	23	1335.587	0.9593163	538.4358	15054.22	6.365319E-27	29	1184.314	0.9780895	463.3517	25148.05	3.678E-38	37	1077.284	USP29	USP29_E274_F	56790915	NM_020903.2	USP29	57663	19	36.1	62323595	274	N	GATGACTTGAGCCTTGGGGATCGAGGGTGTAGTGAGGTATGATC	HOM-TES-84/86	ubiquitin-specific processing protease; ubiquitin carboxyl-terminal hydrolase 29; ubiquitin thiolesterase 29; deubiquitinating enzyme 29; go_component: cellular component unknown; go_function: cysteine-type endopeptidase activity; go_function: ubiquitin thiolesterase activity; go_process: ubiquitin cycle; go_process: ubiquitin-dependent protein catabolism	ubiquitin specific protease 29
USP29_P205_R	2184	0.1614538	7710.593	1503.853	4.548826E-12	36	386.0233	0.9355028	869.2965	14059.21	2.080486E-22	28	1094.218	0.9429727	1025.602	18612.33	3.678E-38	18	890.5128	0.0432541	5330.514	245.5114	0.005640777	29	193.0711	0.909931	1098.876	12111.77	9.086836E-19	25	941.149	0.8594604	1757.78	11361.13	2.547361E-21	24	1197.069	0.8838173	1671.747	13477.92	1.167405E-19	42	560.8854	0.8950673	1910.15	17146.42	5.896859E-22	16	1167.125	0.8694669	1570.533	11127.24	1.795558E-17	28	891.7162	0.9550385	709.4772	17194.31	5.198188E-35	30	1027.443	USP29	USP29_P205_R	56790915	NM_020903.2	USP29	57663	19	36.1	62323116	-205	Y	CCCGTACCTAGACCCGTAGGTCGGGAGGCCTGCGCCCGGCACTGCGCA	HOM-TES-84/86	ubiquitin-specific processing protease; ubiquitin carboxyl-terminal hydrolase 29; ubiquitin thiolesterase 29; deubiquitinating enzyme 29; go_component: cellular component unknown; go_function: cysteine-type endopeptidase activity; go_function: ubiquitin thiolesterase activity; go_process: ubiquitin cycle; go_process: ubiquitin-dependent protein catabolism	ubiquitin specific protease 29
USP29_P282_R	2185	0.1633929	6757.493	1339.298	2.893113E-09	31	249.4057	0.9369885	708.4341	12021.52	3.959844E-16	23	519.301	0.9458424	785.4703	15464.42	2.37539E-29	22	957.7308	0.03939318	4206.232	176.5927	0.03994883	24	220.6861	0.9359664	678.8074	11383.66	1.516806E-15	25	566.5363	0.9340349	738.2629	11869.42	1.292358E-19	31	645.8994	0.9347517	738.212	12008.29	9.803777E-14	28	860.0264	0.9357021	867.4141	14078.41	2.464937E-13	22	526.8532	0.9275542	778.5697	11248.71	1.355311E-15	34	486.4234	0.9482166	707.7468	14790.82	6.889202E-26	18	772.6591	USP29	USP29_P282_R	56790915	NM_020903.2	USP29	57663	19	36.1	62323039	-282	Y	TTTCTCTGAACCCTAACTCCTGCCGTTACGCCCCACCAGCTCTAGGCC	HOM-TES-84/86	ubiquitin-specific processing protease; ubiquitin carboxyl-terminal hydrolase 29; ubiquitin thiolesterase 29; deubiquitinating enzyme 29; go_component: cellular component unknown; go_function: cysteine-type endopeptidase activity; go_function: ubiquitin thiolesterase activity; go_process: ubiquitin cycle; go_process: ubiquitin-dependent protein catabolism	ubiquitin specific protease 29
VAMP8_E7_F	4005	0.2131185	5773.065	1590.658	1.178763E-07	32	240.5574	0.1637363	7967.809	1579.638	5.249035E-09	23	481.3193	0.185693	8739.595	2015.764	2.320964E-12	31	363.719	0.3017387	3384.402	1505.71	0.01858046	38	145.9981	0.1902293	7661.729	1823.366	1.636195E-09	27	428.6239	0.2558284	7615.819	2652.514	8.716848E-13	32	379.8867	0.2818212	7024.159	2795.598	4.442502E-08	30	586.8741	0.2604651	8283.083	2952.532	1.513205E-07	27	328.1612	0.2010872	6545.527	1672.687	3.944597E-07	34	548.3928	0.1819591	8622.861	1940.251	1.080468E-11	32	460.5362	VAMP8	VAMP8_E7_F	14043025	NM_003761.2	VAMP8	8673	2	36.1	85658235	7	N	GAGGGCCACCCTGGGAGGAAGCCGACTAGGCGAATTCACTTACTGACCGG	EDB, VAMP5	endobrevin; go_component: synaptic vesicle; go_component: early endosome; go_component: integral to membrane; go_component: membrane fraction; go_process: protein complex assembly; go_process: vesicle-mediated transport; go_process: vesicle docking during exocytosis	vesicle-associated membrane protein 8
VAMP8_P114_F	2187	0.1137695	5724.298	747.6921	6.130047E-06	29	343.6828	0.1318213	10700.25	1639.873	3.934587E-15	26	799.6534	0.1591497	12963.28	2472.517	2.441361E-26	39	826.7572	0.02765567	6250.56	180.6243	0.00098505	20	240.3052	0.156993	12005.99	2254.497	5.272484E-22	30	621.9098	0.1552172	11631.52	2155.504	1.15349E-23	25	900.4535	0.1409847	12685.36	2098.38	1.106901E-18	26	1110.007	0.1453362	15395.96	2635.101	1.379663E-19	34	818.2823	0.1373533	10143.5	1631.002	6.452369E-15	28	524.5038	0.1481357	15188.19	2658.555	8.891073E-35	26	691.3051	VAMP8	VAMP8_P114_F	14043025	NM_003761.2	VAMP8	8673	2	36.1	85658114	-114	N	CACTGGGAGGACAGTGAAGAATGCCCGCCTACCTGGGGAAACCTGAGT	EDB, VAMP5	endobrevin; go_component: synaptic vesicle; go_component: early endosome; go_component: integral to membrane; go_component: membrane fraction; go_process: protein complex assembly; go_process: vesicle-mediated transport; go_process: vesicle docking during exocytosis	vesicle-associated membrane protein 8
VAMP8_P241_F	2190	0.3401442	1780.316	969.2704	0.1467364	30	93.08662	0.7107612	3270.067	8281.437	3.202363E-13	29	773.4485	0.6862127	4222.728	9453.253	2.038969E-20	24	743.6315	0.04671239	3464.842	174.6821	0.1031553	37	135.1653	0.703238	2813.332	6903.73	5.477996E-10	29	880.5126	0.7239922	3615.83	9746.938	3.678522E-22	26	653.098	0.6101578	4021.938	6451.411	3.404941E-09	25	548.7903	0.6778283	4802.892	10315.37	1.19393E-13	28	664.0973	0.6941327	2664.406	6273.521	1.91585E-08	31	729.9276	0.7286454	3650.073	10069.75	4.503965E-20	33	678.4102	VAMP8	VAMP8_P241_F	14043025	NM_003761.2	VAMP8	8673	2	36.1	85657987	-241	N	ATCAGGAGGTCCAGCCTCTGGAAACCTCGGAGGGCTGCTTGATCTTT	EDB, VAMP5	endobrevin; go_component: synaptic vesicle; go_component: early endosome; go_component: integral to membrane; go_component: membrane fraction; go_process: protein complex assembly; go_process: vesicle-mediated transport; go_process: vesicle docking during exocytosis	vesicle-associated membrane protein 8
VAV1_E9_F	1645	0.0457139	4648.334	227.4631	0.001597443	27	219.8411	0.05820519	11158.55	695.8056	6.146687E-14	30	543.5944	0.05262608	12852.04	719.4782	4.321691E-20	26	528.2184	0.02291811	9218.888	218.5807	2.030087E-07	32	339.5702	0.05819934	11717.6	730.2784	1.368032E-16	34	570.8685	0.05713974	12228.52	747.1397	7.792028E-21	29	370.5138	0.06786224	12054.2	884.8599	3.625648E-14	29	782.5637	0.06675147	13623.32	981.5733	1.005226E-12	29	672.0995	0.07395292	9235.099	745.4889	1.393471E-10	26	521.8253	0.05485114	13821.69	807.9371	5.995092E-23	29	725.1735	VAV1	VAV1_E9_F	7108366	NM_005428.2	VAV1	7409	19	36.1	6723731	9	Y	AAAGAAGAGGAAGTGGTAGCACTAGCTGTCGCTCCACAGGCGAGCAGGGCAGGCG	VAV	oncogene vav; vav proto-oncogene; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: diacylglycerol binding; go_function: transcription factor activity; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	vav 1 oncogene
VAV1_P317_F	6062	0.04979535	3082.644	166.786	0.06723769	30	135.9611	0.4039615	4426.148	3067.57	1.238779E-05	34	272.6003	0.3769444	5341.125	3291.844	6.950164E-08	30	270.5017	0.03813541	3873.699	157.5468	0.06416865	24	170.9992	0.3675899	4733.72	2809.611	4.682068E-06	22	317.5848	0.3785801	4718.106	2935.277	4.929142E-07	34	274.5689	0.4319512	4298.768	3344.876	5.704119E-05	31	320.1406	0.3222741	5869.586	2838.675	0.0001132673	33	335.8106	0.3397882	4496.784	2365.806	5.168101E-05	41	328.3679	0.4582269	4646.889	4014.877	7.783765E-08	36	309.6561	VAV1	VAV1_P317_F	7108366	NM_005428.2	VAV1	7409	19	36.1	6723405	-317	N	TGGAGTCAGAAGACCAGCTGAGTGATGACGGGGCTGGACCAGACAGAGGA	VAV	oncogene vav; vav proto-oncogene; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding; go_function: diacylglycerol binding; go_function: transcription factor activity; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade	vav 1 oncogene
VAV2_E58_F	3069	0.07985082	5229.565	462.5012	0.0001180577	34	301.3232	0.1231473	10913.43	1546.753	1.956558E-15	22	1118.495	0.07265873	18508.1	1457.976	3.678E-38	20	651.5427	0.05160057	5569.95	308.4909	0.003145708	27	315.3222	0.08879653	14221.29	1395.606	1.34804E-26	24	964.5085	0.1026982	13632.89	1571.76	4.513106E-29	32	1023.013	0.1056501	12340.27	1469.577	3.25834E-16	24	1212.42	0.0953294	19467.67	2061.937	2.871609E-28	31	1170.505	0.1311935	11907.57	1813.194	1.458965E-20	23	1208.676	0.1276453	13101.38	1931.661	2.732262E-24	24	665.6293	VAV2	VAV2_E58_F	40549447	NM_003371.2	VAV2	7410	9	36.1	135847168	58	Y	CACACCACCCGGTGGTTGGGCGGCAGGACCTTGCAATCGATGAGCCAG	.	oncogene VAV2; go_component: integral to membrane; go_function: metal ion binding; go_function: protein binding; go_function: diacylglycerol binding; go_function: rhodopsin-like receptor activity; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade; go_process: G-protein coupled receptor protein signaling pathway	vav 2 oncogene
VAV2_P1182_F	2822	0.06875623	3390.533	257.7155	0.03196525	24	159.2025	0.09523781	7373.444	786.6757	1.266762E-06	32	418.1516	0.08889526	8810.028	869.3394	6.014562E-10	35	373.736	0.3490964	870.6146	520.5656	0.5834904	37	53.26373	0.1120892	7441.873	952.0807	1.864181E-07	25	391.9984	0.09154079	7864.417	802.5336	4.980908E-09	29	283.4536	0.09117392	8395.892	852.3124	3.580822E-07	24	305.8285	0.08641653	9249.507	884.3767	3.453335E-06	26	437.6746	0.08074863	7263.111	646.7883	1.313379E-06	24	435.5436	0.09395846	7954.136	835.2313	4.571925E-08	22	278.3518	VAV2	VAV2_P1182_F	40549447	NM_003371.2	VAV2	7410	9	36.1	135848408	-1182	Y	AGGTGCTCTCCGGCCCAGGGTCGCAGCCGGCCCCGGTGCTGATCCG	.	oncogene VAV2; go_component: integral to membrane; go_function: metal ion binding; go_function: protein binding; go_function: diacylglycerol binding; go_function: rhodopsin-like receptor activity; go_function: guanyl-nucleotide exchange factor activity; go_process: intracellular signaling cascade; go_process: G-protein coupled receptor protein signaling pathway	vav 2 oncogene
VBP1_E127_F	1370	0.1463547	1760.367	318.9538	0.3255382	34	75.30399	0.06805387	4289.805	320.5585	0.01774956	27	127.0278	0.07224953	4604.681	366.3819	0.00776101	24	200.7032	0.1625043	1841.772	376.7737	0.3700172	22	96.87381	0.7698529	2003.266	7035.521	1.232066E-08	36	356.4546	0.8225108	1940.067	9453.971	7.137774E-16	29	524.8213	0.8355463	1634.423	8812.147	3.797289E-09	37	483.5139	0.7559143	2451.851	7902.884	1.901352E-06	25	490.3246	0.7834018	1645.317	6312.539	1.093253E-06	32	394.9806	0.7989902	2321.754	9626.185	4.593477E-15	32	530.0968	VBP1	VBP1_E127_F	66346740	NM_003372.4	VBP1	7411	X	36.1	154097871	127	Y	ATGAATGTGCATGGAGATGGAGAGGCGGGCCTGCAAGTGCGAACAAGCCAA	PFD3, PFDN3, VBP-1	VHL binding protein-1; prefoldin 3; go_component: prefoldin complex; go_function: unfolded protein binding; go_process: protein folding	von Hippel-Lindau binding protein 1
VBP1_P12_R	5379	0.1876343	940.9854	240.4393	0.6365221	23	55.04684	0.08576353	4348.721	417.3297	0.01331894	32	250.1461	0.07681821	4785	406.4822	0.004780314	22	249.8909	0.1951107	505.9406	146.8842	0.756501	18	36.53537	0.571627	3292.584	4527.112	1.718088E-06	34	361.5233	0.5622743	3333.998	4411.093	3.344637E-07	24	600.66	0.5246414	3390.507	3852.386	0.0001690902	29	309.4929	0.5304635	4591.851	5300.664	6.516238E-06	26	343.1361	0.6203294	2619.103	4442.641	2.699636E-05	32	639.4603	0.598332	4493.793	6842.999	1.616665E-13	26	408.3515	VBP1	VBP1_P12_R	66346740	NM_003372.4	VBP1	7411	X	36.1	154097732	-12	Y	CCTGTCGCTCCAGCTTCTCTTTCGCGGCCCTTCCACGCTTGTCACTTAC	PFD3, PFDN3, VBP-1	VHL binding protein-1; prefoldin 3; go_component: prefoldin complex; go_function: unfolded protein binding; go_process: protein folding	von Hippel-Lindau binding protein 1
VBP1_P194_F	5242	0.06237127	4451.791	302.7861	0.002254669	26	224.8262	0.0716202	9663.772	753.2298	1.009246E-10	37	392.2307	0.06488968	10263.24	719.1317	6.583108E-13	22	445.4163	0.03419907	5213.113	188.1377	0.007776742	36	174.3582	0.5629097	6056.645	7928.878	3.948801E-21	30	580.0899	0.5647828	6086.441	8028.164	7.326072E-25	26	766.4558	0.5875971	5624.193	8155.907	3.849582E-16	29	861.023	0.5333017	7447.085	8624.145	1.833415E-15	25	861.8484	0.5258285	5071.438	5734.824	1.788131E-12	26	770.1833	0.5718979	7483.043	10130.12	7.853722E-34	27	990.7739	VBP1	VBP1_P194_F	66346740	NM_003372.4	VBP1	7411	X	36.1	154097550	-194	Y	TCGTGATGGCGCTAGGTCCCAGGTTCGCTAGCATCCGAGAGAGGGGATTG	PFD3, PFDN3, VBP-1	VHL binding protein-1; prefoldin 3; go_component: prefoldin complex; go_function: unfolded protein binding; go_process: protein folding	von Hippel-Lindau binding protein 1
VEGFB_P658_F	6107	0.05434197	9123.607	530.032	2.75714E-13	27	378.1056	0.05883035	11335.8	714.8258	2.055093E-14	40	583.644	0.04301067	13291.73	601.8746	4.175257E-21	36	685.7686	0.02826296	8915.042	262.2024	4.903207E-07	27	340.9414	0.05050486	11947.33	640.813	5.579562E-17	31	541.7086	0.07384088	9296.209	749.1416	3.221392E-12	26	659.168	0.04783016	13585.84	687.4783	2.30043E-17	27	881.6341	0.1444499	13073.89	2224.261	5.548527E-14	29	1019.47	0.06865501	11035.85	820.8904	3.899874E-15	29	734.1816	0.04391942	12049	558.0878	7.766452E-17	29	376.5471	VEGFB	VEGFB_P658_F	89034833	XM_938483.1	VEGFB	7423	11	36.1	63758184	-658	Y	CGGCTAGGGCAGCGGCAGCCGCCACCATCCGAGCCAACCCAAGGCCCCGAGATCGT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to vascular endothelial growth factor B
VIM_P343_R	5981	0.1628576	3247.275	651.1786	0.0189473	29	139.1854	0.05453059	9078.873	529.3978	4.033115E-09	42	402.5831	0.0392229	11954.74	492.1244	9.303976E-17	13	377.6381	0.03953962	5464.628	229.0811	0.004513391	27	300.4113	0.03944346	10724.49	444.4876	2.884588E-13	28	544.016	0.05405511	10075.06	581.4442	8.272505E-14	38	496.4447	0.06329294	11201.13	763.613	4.66867E-12	34	544.1534	0.0446139	14335.39	674.093	1.888245E-13	21	633.7233	0.06309432	8715.637	593.6741	3.570413E-09	26	539.9888	0.05847885	12083.84	756.7509	1.724185E-17	35	446.2796	VIM	VIM_P343_R	62414288	NM_003380.2	VIM	7431	10	36.1	17310961	-343	Y	GCCCCTTTGGCGTGGTGCCACCGGACCCCTCTGGTTCAGTCCCA	FLJ36605	go_component: cytoplasm; go_component: cytoskeleton; go_component: intermediate filament; go_component: intermediate filament; go_function: protein binding; go_function: protein binding; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton; go_process: cell motility	vimentin
VIM_P811_R	5982	0.03796668	3643.056	147.7198	0.02385842	26	145.7862	0.0325342	6619.016	225.9488	9.158198E-05	29	412.1385	0.03913587	7951.565	327.9392	2.99055E-07	35	301.8518	0.6892993	281.7779	846.9865	0.6491178	16	87.56715	0.0438398	6792.819	316.0347	2.076097E-05	25	258.6225	0.03412294	7872.522	281.6569	5.542514E-08	42	251.8974	0.03939326	7674.449	318.8203	2.084965E-05	27	336.5012	0.03801866	8112.033	324.5494	0.0002052614	28	475.9972	0.05468042	6485.245	380.9124	5.109348E-05	32	292.4834	0.02969834	7900.246	244.8661	6.11244E-07	28	284.0643	VIM	VIM_P811_R	62414288	NM_003380.2	VIM	7431	10	36.1	17310493	-811	Y	GGTCTAACGGTTTCCCCTAAACCGCTAGGAGCCCTCAATCGGCGGGAC	FLJ36605	go_component: cytoplasm; go_component: cytoskeleton; go_component: intermediate filament; go_component: intermediate filament; go_function: protein binding; go_function: protein binding; go_function: structural molecule activity; go_function: structural constituent of cytoskeleton; go_process: cell motility	vimentin
WEE1_P924_R	2828	0.8487953	478.6011	3248.006	0.02726478	31	118.689	0.9459111	827.418	16218.76	1.635955E-29	30	1416.017	0.9582896	984.2193	24909.75	3.678E-38	42	1367.359	0.869928	339.4333	2938.952	0.1522295	24	143.45	0.950706	918.3549	19640.45	3.678E-38	25	1665.716	0.9366245	1312.82	20880.01	3.678E-38	33	1755.059	0.9565718	1041.915	25152.39	3.678E-38	31	1715.419	0.9544168	1197.494	27166.79	3.678E-38	28	1722.215	0.9276413	811.6657	11687.58	6.643034E-17	27	679.1036	0.9578373	911.0176	22967.94	3.678E-38	33	1269.139	WEE1	WEE1_P924_R	19718775	NM_003390.2	WEE1	7465	11	36.1	9549992	-924	N	AAACAACAAAACCACATCAACGAACATCCACTGATGTCCTGAATTCACAG	WEE1hu, DKFZp686I18166	WEE1+ homolog (S. pombe); wee1+ (S. pombe) homolog; wee1-like protein kinase; go_component: nucleus; go_function: ATP binding; go_function: nucleotide binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_process: mitosis; go_process: cell division; go_process: protein amino acid phosphorylation; go_process: regulation of progression through cell cycle	wee1 tyrosine kinase
WNT1_E157_F	1757	0.2947815	2319.546	1011.371	0.05827522	32	169.9922	0.1143015	6583.742	862.5529	1.444368E-05	38	321.6871	0.1130457	7370.625	952.1594	2.511048E-07	19	443.4467	0.2214026	2397.093	710.0753	0.1801949	24	133.8016	0.1377863	5928.107	963.3234	4.204385E-05	29	422.3725	0.1223049	6515.763	921.8917	1.200827E-06	21	330.5229	0.1283359	6851.497	1023.475	2.948788E-05	26	330.9652	0.1442963	7002.057	1197.612	0.0003384665	30	309.6951	0.1570117	6246.313	1182.04	7.692809E-06	32	346.3912	0.1459301	6909.779	1197.722	7.060381E-07	26	259.8769	WNT1	WNT1_E157_F	16936523	NM_005430.2	WNT1	7471	12	36.1	47658660	157	Y	GTCCCACCGTCGCGGGCAACAACCAAAGTCGCCGCAACTGCAGCACAGAGCGGGCAAA	INT1	Wingless-type MMTV integration site family, member 1 (oncogene INT1); go_component: soluble fraction; go_component: extracellular region; go_function: receptor binding; go_process: spermatogenesis; go_process: morphogenesis; go_process: cell migration; go_process: cell differentiation; go_process: cell fate specification; go_process: frizzled-2 signaling pathway; go_process: central nervous system development; go_process: establishment and/or maintenance of cell polarity	wingless-type MMTV integration site family, member 1 precursor
WNT1_P79_R	6115	0.244486	5529.545	1821.733	1.25084E-07	31	385.2514	0.2344195	11582.81	3577.257	3.907065E-23	36	525.1489	0.1876164	13439.15	3126.805	1.445197E-30	26	697.0483	0.2274129	4169.718	1256.802	0.007429434	28	488.1511	0.2211269	10676.02	3059.38	2.373412E-20	37	494.7003	0.2354663	11299.34	3510.846	1.653566E-27	31	491.0613	0.243108	9157.426	2973.415	2.103452E-12	30	1017.033	0.2510043	12627.03	4265.097	3.986748E-17	33	639.743	0.25689	9991.244	3488.501	8.252734E-20	21	912.3644	0.2193379	12378.46	3505.998	2.965682E-27	34	527.1028	WNT1	WNT1_P79_R	16936523	NM_005430.2	WNT1	7471	12	36.1	47658424	-79	Y	CCATTGTCTGCGCCCCTAACCGGTGCGCCCTGGTGCCACAGTGCGGCC	INT1	Wingless-type MMTV integration site family, member 1 (oncogene INT1); go_component: soluble fraction; go_component: extracellular region; go_function: receptor binding; go_process: spermatogenesis; go_process: morphogenesis; go_process: cell migration; go_process: cell differentiation; go_process: cell fate specification; go_process: frizzled-2 signaling pathway; go_process: central nervous system development; go_process: establishment and/or maintenance of cell polarity	wingless-type MMTV integration site family, member 1 precursor
WNT10B_P823_R	5381	0.03993256	5118.338	217.049	0.0003917862	24	229.3495	0.3793811	8127.008	5029.128	2.934159E-17	25	541.8259	0.3351582	11305.23	5749.571	1.691098E-32	31	833.1177	0.1568919	1009.409	206.447	0.6277196	25	53.98256	0.3179147	8632.063	4069.947	2.671665E-17	23	756.6999	0.3153324	9890.816	4601.398	2.791418E-26	25	759.7168	0.3502324	9165.249	4994.079	4.456026E-17	28	852.7465	0.3519962	11283.12	6183.319	2.410577E-18	33	967.7276	0.3595719	7336.691	4175.372	3.131622E-14	30	720.9296	0.3250878	10747.98	5225.193	1.421726E-27	20	759.7172	WNT10B	WNT10B_P823_R	16936521	NM_003394.2	WNT10B	7480	12	36.1	47652633	-823	Y	CTTGGGGTGCACAGGCAAAGGCAAACCGCCTTAGGGAGACCCAGTGGCAGCG	WNT-12	WNT-10B protein; go_component: extracellular region; go_function: signal transducer activity; go_process: development; go_process: signal transduction; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family, member 10B precursor
WNT10B_P993_F	5383	0.04418473	4695.346	221.6758	0.001417281	24	199.7068	0.0806362	8082.493	717.6758	1.141691E-07	24	531.2299	0.08127625	10149.11	906.7027	4.350726E-13	30	475.4813	0.02531689	7783.65	204.7737	1.928088E-05	27	681.9081	0.06886134	9348.977	698.7888	1.091521E-10	27	448.1962	0.07723916	8495.539	719.4846	3.126478E-10	33	677.5182	0.08163546	9472.204	850.8945	6.2522E-09	33	579.6633	0.07642309	11349.43	947.4045	5.201456E-09	20	449.7385	0.1227595	6725.748	955.1833	3.095515E-06	29	543.3979	0.1113678	7999.772	1015.104	1.745608E-08	30	366.5122	WNT10B	WNT10B_P993_F	16936521	NM_003394.2	WNT10B	7480	12	36.1	47652803	-993	Y	CAAGGCACGGCTGGCCCCACGCGCCCCAGGCACATTGACTCAGAC	WNT-12	WNT-10B protein; go_component: extracellular region; go_function: signal transducer activity; go_process: development; go_process: signal transduction; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family, member 10B precursor
WNT2_E109_R	1377	0.09644715	1425.328	162.8168	0.4944737	28	69.49816	0.1060267	1481.881	187.6137	0.5215005	23	76.61162	0.07638267	1703.218	149.1252	0.5018753	23	76.1877	0.08997743	1162.998	124.8774	0.6097182	22	64.49189	0.07960042	1519.278	140.0427	0.5288564	22	73.87907	0.1186408	1381.837	199.4718	0.5479482	24	78.55238	0.08645029	1429.813	144.768	0.6167008	27	94.90963	0.08320896	1953.858	186.4104	0.5162632	26	58.96595	0.1317575	1417.571	230.2944	0.5708074	25	88.46846	0.06417283	2025.258	145.7361	0.3828377	29	56.07702	WNT2	WNT2_E109_R	4507926	NM_003391.1	WNT2	7472	7	36.1	116750470	109	Y	AAAGTTTCAAACGATGGGCCCAGCGAGCGATAAAGGCCAGCCCGGACCGCCT	IRP, INT1L1	secreted growth factor; go_component: extracellular region; go_function: signal transducer activity; go_function: extracellular matrix structural constituent; go_process: development; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family member 2 precursor
WNT2_P217_F	5252	0.2000678	4537.464	1159.857	0.0001159066	28	229.0582	0.2165745	9276.903	2592.203	5.664858E-14	38	484.5368	0.2008821	11257.72	2855.1	8.213555E-22	25	726.095	0.1069251	4998.22	610.394	0.005305914	37	196.4689	0.1813222	9878.194	2209.988	1.295351E-15	25	460.7322	0.2815663	9391.876	3720.027	2.691368E-21	29	543.8326	0.2047428	9500.843	2471.783	4.496623E-12	32	525.3091	0.2215076	11112.16	3190.241	3.392596E-12	30	536.7402	0.1492148	8581.967	1522.686	7.431417E-11	26	686.9606	0.2035954	10875.25	2805.746	5.912047E-20	26	755.7807	WNT2	WNT2_P217_F	4507926	NM_003391.1	WNT2	7472	7	36.1	116750796	-217	Y	AGAGCATCCGTGGGCTCTCGGAGCGTGCGTTCCGGATTGCCGAGGCCAT	IRP, INT1L1	secreted growth factor; go_component: extracellular region; go_function: signal transducer activity; go_function: extracellular matrix structural constituent; go_process: development; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family member 2 precursor
WNT2B_P1185_R	5394	0.4694445	1976.44	1837.269	0.0227312	25	160.919	0.04749137	6431.917	325.6765	0.0001179453	35	400.2258	0.05259213	8592.397	482.5289	1.01123E-08	19	413.5325	0.421328	1772.543	1363.389	0.175284	22	143.0152	0.07992817	6564.757	578.9786	1.84933E-05	26	316.1712	0.07289048	7065.307	563.3452	5.467368E-07	24	421.1609	0.070158	6355.396	487.0695	0.0004664729	30	311.8904	0.07332193	7178.594	575.9072	0.0008273809	25	382.6486	0.1011945	4637.283	533.3602	0.005158619	39	254.8222	0.07462019	8098.73	661.1241	5.174893E-08	24	389.6389	WNT2B	WNT2B_P1185_R	13518020	NM_024494.1	WNT2B	7482	1	36.1	112810378	-1185	Y	CATGTGGTTCTGACGCCAAGGCCCGGCTGCAACGTGCCCGACGGGCTACTCC	WNT13, XWNT2	isoform WNT-2B2 is encoded by transcript variant WNT-2B2; XWNT2, Xenopus, homolog of; wingless-type MMTV integration site family, member 13; go_component: extracellular region; go_component: extracellular space; go_function: signal transducer activity; go_process: development; go_process: protein folding; go_process: morphogenesis; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family, member 2B isoform WNT-2B2
WNT2B_P1195_F	5389	0.02953391	7376.084	227.5175	3.668109E-08	33	268.0338	0.03759523	11429.96	450.4044	5.322436E-14	27	1014.782	0.0363033	13303.02	504.9035	7.821936E-21	23	969.2979	0.04640333	4625.531	229.9509	0.01963821	28	180.8486	0.03802212	11870.66	473.1396	2.641967E-16	30	532.5444	0.0426007	12339.01	553.4894	1.481749E-20	23	833.2288	0.05261871	12506.62	700.1872	8.837628E-15	26	913.4103	0.05818898	13650.05	849.535	1.54028E-12	15	951.2067	0.06017184	8259.794	535.2299	3.578603E-08	28	446.5928	0.03783562	14433.97	571.5258	3.383792E-24	37	499.0653	WNT2B	WNT2B_P1195_F	13518020	NM_024494.1	WNT2B	7482	1	36.1	112810368	-1195	Y	CTAGATTGGAAGCCATGTGGTTCTGACGCCAAGGCCCGGCTGCAACGTGCC	WNT13, XWNT2	isoform WNT-2B2 is encoded by transcript variant WNT-2B2; XWNT2, Xenopus, homolog of; wingless-type MMTV integration site family, member 13; go_component: extracellular region; go_component: extracellular space; go_function: signal transducer activity; go_process: development; go_process: protein folding; go_process: morphogenesis; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family, member 2B isoform WNT-2B2
WNT5A_E43_F	1389	0.06984619	4400.235	337.9272	0.002360406	25	301.8382	0.08506754	8893.412	836.1791	2.370652E-09	29	374.5516	0.07351746	10121.64	811.0992	8.693727E-13	36	513.7477	0.03800616	5973.985	239.9692	0.001577403	26	242.6931	0.09195544	8515.171	872.4371	2.567826E-09	33	513.7145	0.09748736	9988.679	1089.756	5.704607E-15	22	802.0867	0.09414153	9995.475	1049.174	3.07396E-10	30	607.9182	0.1032288	11131.62	1292.89	3.386171E-09	29	512.6219	0.1017743	8405.45	963.7183	2.702781E-09	34	436.6485	0.08632872	8630.048	824.8632	2.455223E-09	25	364.4745	WNT5A	WNT5A_E43_F	40806204	NM_003392.3	WNT5A	7474	3	36.1	55496328	43	Y	CAAGGGCAGGGCCTGGTCGGGGCGCAACTAGGGAGCCGCCGGTCCGGC	hWNT5A	WNT-5A protein precursor; go_component: soluble fraction; go_component: extracellular space; go_function: receptor binding; go_function: receptor binding; go_process: morphogenesis; go_process: cell-cell signaling; go_process: signal transduction; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family, member 5A precursor
WNT5A_P655_F	5397	0.04044972	3688.203	159.6912	0.02113439	29	116.5799	0.04977835	8209.037	435.2775	2.091983E-07	26	460.6024	0.04964874	8845.669	467.3442	3.413676E-09	26	520.5889	0.2337048	299.8864	121.9574	0.8013863	20	18.16228	0.05660976	9450.254	573.0795	1.232312E-10	25	337.797	0.09738486	8242.705	900.1102	4.554234E-10	21	498.4022	0.07699357	8782.717	740.9614	1.334072E-07	29	485.3097	0.04431915	9518.205	446.0387	5.405861E-06	28	416.9723	0.08925208	7683.323	762.7553	1.56455E-07	26	346.4208	0.1060023	8859.754	1062.368	2.713477E-10	15	419.7451	WNT5A	WNT5A_P655_F	40806204	NM_003392.3	WNT5A	7474	3	36.1	55497026	-655	Y	CGTATCCCGTTCTTTCTCTCTTCGGGTTGATCTCTCTTTTCCCCGTTTT	hWNT5A	WNT-5A protein precursor; go_component: soluble fraction; go_component: extracellular space; go_function: receptor binding; go_function: receptor binding; go_process: morphogenesis; go_process: cell-cell signaling; go_process: signal transduction; go_process: frizzled-2 signaling pathway	wingless-type MMTV integration site family, member 5A precursor
WNT8B_E487_F	1650	0.4386151	947.7327	818.6031	0.431364	39	71.70401	0.8507594	1676.762	10128.59	8.054911E-14	40	504.1474	0.8928707	1386.863	12392.27	9.649171E-21	29	595.282	0.2397276	485.9398	184.7574	0.7528133	17	45.60715	0.8646154	1188.349	8227.869	2.250956E-09	30	470.5696	0.8149059	1812.041	8418.065	1.093217E-12	23	396.2255	0.8742926	1319.87	9875.168	1.592159E-10	26	596.6851	0.8865845	1529.699	12739.58	3.869157E-12	27	466.6459	0.815317	1690.952	7906.486	9.168248E-10	39	409.7959	0.8830802	1258.393	10259.78	5.745462E-14	31	647.3232	WNT8B	WNT8B_E487_F	17505196	NM_003393.2	WNT8B	7479	10	36.1	102213275	487	N	GGGGTAAATGGACAGCAGCCCTTTTCACGAAATCCTGATGTCAGCATTGTAGAGAG	.	go_component: extracellular region; go_function: signal transducer activity; go_function: signal transducer activity; go_process: development; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: frizzled-2 signaling pathway; go_process: nervous system development	wingless-type MMTV integration site family, member 8B precursor
WNT8B_P216_R	6070	0.6655788	335.885	867.5164	0.6291345	30	39.75211	0.9558057	389.9755	10596.88	6.106916E-12	25	659.8043	0.9578245	422.2876	11861.39	2.661163E-16	38	571.3788	0.2249746	287.8453	112.5838	0.8052787	27	13.42531	0.9546871	360.7662	9707.764	9.843179E-11	24	677.2405	0.9530764	412.5285	10410.08	2.92826E-14	20	661.5811	0.9552715	389.7637	10459.94	7.101789E-10	26	458.6826	0.9625522	409.2439	13089.53	7.465038E-11	25	396.3594	0.9362141	496.8726	8760.569	4.536765E-09	39	399.1249	0.961206	405.2747	12519.3	9.958231E-18	30	476.3308	WNT8B	WNT8B_P216_R	17505196	NM_003393.2	WNT8B	7479	10	36.1	102212572	-216	N	GATTTGCTATGTCTCTTCCCCCCGCTTCTTTCTTTGTCCTCTTTCTCCTGGTC	.	go_component: extracellular region; go_function: signal transducer activity; go_function: signal transducer activity; go_process: development; go_process: cell-cell signaling; go_process: signal transduction; go_process: signal transduction; go_process: frizzled-2 signaling pathway; go_process: nervous system development	wingless-type MMTV integration site family, member 8B precursor
WRN_E57_F	1462	0.06983122	3581.421	276.378	0.02068983	34	122.2254	0.2044545	6316.022	1648.912	2.529654E-06	19	361.0842	0.1654588	7620.106	1530.613	7.182611E-09	25	358.1864	0.03665371	7369.013	284.1834	4.887692E-05	28	434.816	0.1545826	6555.439	1216.932	2.046105E-06	27	304.7001	0.1891452	6620.399	1567.644	4.75263E-08	40	190.9646	0.1831742	7440.191	1690.897	5.392155E-07	28	228.7129	0.2319999	7075.607	2167.63	3.288909E-05	35	283.5092	0.1659779	6311.548	1275.955	4.353627E-06	36	363.3071	0.2008789	5874.202	1501.763	9.962083E-06	31	246.5614	WRN	WRN_E57_F	62865861	NM_001015508.1	PURG	29942	8	36.1	31010377	396	Y	GCCGCCTGACTTCGGACACCGGCCCCGCACCCGCCAGGAGGGGAGG	PURG-A, PURG-B, MGC119274	isoform B is encoded by transcript variant B; Pur-gamma	purine-rich element binding protein G isoform B
WRN_P969_F	5444	0.8744205	593.377	4828.039	0.0002959336	32	134.378	0.9609109	600.8187	17227.91	2.11673E-32	24	1401.79	0.9689306	606.9572	22047.17	3.678E-38	36	1493.554	0.8514988	374.637	2721.547	0.1820927	19	214.4168	0.9621863	620.623	18336.6	3.678E-38	27	954.9567	0.9510667	686.7646	15291.54	2.846609E-32	23	1310.397	0.9570523	697.1669	17764.16	9.988803E-30	30	1462.986	0.9685174	704.1473	24738.45	3.678E-38	24	906.4624	0.9368649	658.9622	11262.27	2.620297E-15	24	1164.967	0.9614795	623.8005	18066.24	3.678E-38	29	1002.333	WRN	WRN_P969_F	19924171	NM_000553.2	WRN	7486	8	36.1	31009351	-969	Y	TTTCAGGACACTGTGAGGATGCTCTTCGGACCCCACCGAGACTGGTGG	RECQ3, RECQL2, RECQL3	Werner syndrome; Werner Syndrome helicase; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: DNA helicase activity; go_function: 3'-5' exonuclease activity; go_function: ATP-dependent helicase activity; go_process: aging; go_process: DNA metabolism	Werner syndrome protein
WT1_E32_F	4207	0.1819446	2328.642	540.1569	0.1236483	37	93.5782	0.08028802	7374.282	652.4818	2.036285E-06	26	459.0317	0.05919409	8838.959	562.4258	2.261938E-09	30	414.8927	0.2465138	387.0403	159.3422	0.7778354	33	22.47152	0.07497362	7198.344	591.5327	1.918326E-06	32	394.9557	0.08060243	8162.986	724.4056	1.675623E-09	23	267.537	0.072734	8222.852	652.8378	1.288578E-06	16	337.6012	0.07667626	10059.83	843.71	4.041799E-07	32	474.2524	0.07758863	7659.362	652.6788	2.705406E-07	26	328.9705	0.0705863	7903.161	607.8171	1.442579E-07	25	409.9744	WT1	WT1_E32_F	65507816	NM_024424.2	WT1	7490	11	36.1	32413631	32	Y	CGGAGAGCCCCCGGGTGTGGGCGCTGCCTTGAACTCCTTACCCCAGCTG	GUD, WAGR, WT33, WIT-2	isoform B is encoded by transcript variant B; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: cell cycle; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle	Wilms tumor 1 isoform B
WT1_P1131_F	2968	0.1527936	5441.291	999.3712	6.965287E-06	28	247.2687	0.1153219	13336.32	1751.488	6.604214E-23	20	1292.712	0.1005777	15600.94	1755.754	1.00942E-33	29	1288.61	0.03778101	6561.557	261.5625	0.0004015244	23	374.3042	0.1069528	13245.57	1598.287	6.364581E-24	32	693.1725	0.4079328	9609.928	6690.117	1.179304E-33	32	625.1316	0.1421544	12481.64	2084.915	4.085139E-18	36	937.4832	0.1417045	15079.4	2506.117	1.329801E-18	21	1325.968	0.3082908	7429.176	3355.71	2.011835E-12	29	633.8283	0.2076277	12401.95	3275.926	1.614509E-26	22	916.7615	WT1	WT1_P1131_F	65507816	NM_024424.2	WT1	7490	11	36.1	32414794	-1131	Y	AGCTTCGCTAAATCTGACTCCCTTCGTCTAGTCTCTGTTTGGCAGCCCCCGC	GUD, WAGR, WT33, WIT-2	isoform B is encoded by transcript variant B; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: cell cycle; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle	Wilms tumor 1 isoform B
WT1_P853_F	2966	0.1191588	4681.048	646.7723	0.0004014694	28	197.1799	0.02562554	7197.919	191.9315	1.73138E-05	18	792.718	0.03039188	9299.923	294.6359	9.053367E-10	26	318.2238	0.0272916	5314.061	151.9041	0.006914567	24	223.4271	0.02875635	8187.44	245.3725	1.593277E-07	25	422.7122	0.2259222	6703.789	1985.753	4.461356E-09	25	862.282	0.02689668	8958.688	250.3831	4.108518E-07	30	540.6617	0.02894291	9695.844	291.9708	5.08222E-06	33	387.8995	0.1834468	5911.619	1350.57	1.372131E-05	33	298.8692	0.08526882	8652.931	815.925	2.303129E-09	33	455.1244	WT1	WT1_P853_F	65507816	NM_024424.2	WT1	7490	11	36.1	32414516	-853	Y	CCAAAGCCTGCGTATATTCCGGCCGGAGCATCCTGGCGCCCAGTTTGGGG	GUD, WAGR, WT33, WIT-2	isoform B is encoded by transcript variant B; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: cell cycle; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent; go_process: negative regulation of progression through cell cycle	Wilms tumor 1 isoform B
Xist_seq_80_S47_R	6136	0.3983647	2126.146	1474.012	0.03516812	31	115.6312	0.9364069	718.5143	12052.61	3.092699E-16	40	603.9567	0.9297692	873.9635	12894.08	1.04609E-20	33	976.1488	0.3041861	948.2206	458.2463	0.5795744	32	52.29916	0.8212309	2169.968	10427.8	5.244359E-17	34	735.9214	0.8018144	2638.881	11080.9	2.013042E-23	35	687.6086	0.8083872	2760.155	12066.59	8.524992E-19	20	690.6194	0.8050123	3228.08	13740.08	2.766412E-17	37	778.0502	0.8011645	2463.992	10331.05	9.377407E-18	31	1018.532	0.8150271	2888.497	13167.9	7.103514E-28	20	1347.927	Xist	Xist_seq_80_S47_R	37704377	NR_001564.1	XIST	7503	X	36.1	72989344	-31	N	CGGCTTTCAATCTTCTAGGCCACGCCTCTTATGCTCTCTCCGCCCTCAG	XCE, XIC, SXI1, swd66, DXS1089, DXS399E	synonyms: XCE, XIC, SXI1, swd66, DXS1089, DXS399E	.
Xist_seq_80_S95_R	6137	0.1229546	1734.459	257.1763	0.3542019	32	66.65417	0.9502614	364.0443	8865.621	2.015176E-08	25	380.5384	0.9528918	347.4641	9051.181	2.291147E-09	26	396.9955	0.3461461	288.8968	205.8795	0.7877822	37	12.22194	0.7499037	2076.209	6525.277	7.97916E-08	28	424.5461	0.7913164	2038.237	8108.074	1.789792E-12	29	477.7041	0.7831014	2010.258	7618.979	9.055342E-08	36	343.737	0.8165465	2114.949	9858.678	1.507093E-08	33	559.1938	0.7961357	1692.649	7000.694	5.541302E-08	30	445.2633	0.778375	2289.726	8393.021	5.768884E-12	36	353.2495	Xist	Xist_seq_80_S95_R	37704377	NR_001564.1	XIST	7503	X	36.1	72989296	17	N	CCCCCTTCAGTTCTTAAAGCGCTGCAATTCGCTGCTGCAGCCATATTTCTT	XCE, XIC, SXI1, swd66, DXS1089, DXS399E	synonyms: XCE, XIC, SXI1, swd66, DXS1089, DXS399E	.
XPC_P226_R	5297	0.1629218	4507.57	896.7781	0.0003130116	25	230.21	0.801799	4027.995	16699.32	3.678E-38	30	855.3298	0.8025357	4504.679	18714.36	3.678E-38	38	1049.731	0.3248353	4044.799	1994.147	0.002273703	23	178.4285	0.7847594	3841.006	14368.76	1.146061E-36	26	1072.915	0.731953	5027.055	14000.39	3.678E-38	30	988.745	0.7794506	3502.167	12730.53	1.042282E-22	30	1214.098	0.8127179	4386.93	19471.21	5.478626E-35	32	1248.269	0.7827269	2714.776	10140.23	6.265136E-18	22	740.7006	0.7965513	4793.193	19158.04	3.678E-38	27	1048.99	XPC	XPC_P226_R	54607142	NM_004628.3	XPC	7508	3	36.1	14195369	-226	Y	AAGGGCGCAGGGTTTGAAACATGGCGGACGACGTAGACCAGGTAAGTGTATTT	XP3, XPCC	xeroderma pigmentosum group C protein; go_component: nucleus; go_function: protein binding; go_function: damaged DNA binding; go_function: single-stranded DNA binding; go_process: nucleotide-excision repair	xeroderma pigmentosum, complementation group C
XRCC1_P681_R	5328	0.6975213	1261.528	3139.708	0.005788782	22	237.697	0.9321052	976.0004	14772.06	4.918021E-25	28	1067.584	0.9641798	803.1287	24309.68	3.678E-38	24	1260.63	0.8849004	511.2541	4699.4	0.01088883	30	212.1031	0.9443185	928.5789	17443.96	2.346214E-37	21	839.1832	0.9229149	1260.208	16285.31	3.678E-38	32	849.9509	0.9530525	918.5056	20676.06	3.678E-38	28	1290.74	0.9433789	1083.892	19725.15	2.426114E-26	32	1355.469	0.922246	831.6558	11050.43	3.336613E-15	36	745.2123	0.9653818	692.8312	22109.32	3.678E-38	29	1205.728	XRCC1	XRCC1_P681_R	5454171	NM_006297.1	XRCC1	7515	19	36.1	48772236	-681	Y	GGCTAGGACAGCAAATCTGAGTGAATTTTCGTAGTTTCGTAGGGAACCTGGATT	RCC	DNA repair protein XRCC1; X-ray-repair, complementing defective, repair in Chinese hamster; go_component: nucleus; go_function: damaged DNA binding; go_function: protein binding; go_process: single strand break repair	X-ray repair cross complementing protein 1
XRCC2_P1077_F	5449	0.844162	370.2936	2547.544	0.1149315	33	84.18736	0.976837	340.8306	18590.86	1.032507E-36	31	1285.226	0.9795076	344.6577	21254	3.678E-38	40	1276.918	0.7630562	286.286	1243.999	0.5475989	33	47.26335	0.9733148	326.2679	15547.67	1.611373E-27	19	1775.617	0.9734098	361.8045	16905.66	5.377704E-38	21	1509.344	0.9729784	356.2013	16426.62	2.391355E-24	28	1265.007	0.9787662	378.1567	22040.5	9.58219E-31	30	988.5497	0.961064	426.5542	12997.04	1.229612E-19	26	840.6363	0.9821489	333.7775	23866.04	3.678E-38	25	1228.23	XRCC2	XRCC2_P1077_F	4885656	NM_005431.1	XRCC2	7516	7	36.1	152005260	-1077	N	CCTTGGCCTCTTCTCTACGTAGGGCTGCGGGCCCGTATCTGAAACATTAACAACCA	DKFZp781P0919	Xrcc2; DNA repair protein XRCC2; X-ray repair, complementing defective, repair in Chinese hamster; go_component: nucleus; go_function: ATP binding; go_function: DNA binding; go_function: DNA-dependent ATPase activity; go_process: meiosis; go_process: DNA repair; go_process: DNA recombination	X-ray repair cross complementing protein 2
YES1_P216_F	5357	0.02310471	8402.209	201.0871	1.750647E-10	29	326.2311	0.0241048	9036.773	225.6801	1.758301E-08	24	306.1906	0.02991636	10578.99	329.3289	9.963198E-13	20	501.0542	0.0767047	1342.873	119.8697	0.5650933	22	64.77257	0.02570908	9806.479	261.407	9.874847E-11	29	375.3968	0.02674881	9191.474	255.3667	9.12873E-11	25	320.2587	0.03935868	9741.475	403.2175	1.26943E-08	27	457.9096	0.03395079	11669.22	413.6169	1.055904E-08	17	476.3875	0.04403535	7878.868	367.5368	3.523975E-07	27	423.0787	0.02759099	9724.093	278.7473	1.831544E-10	27	426.8309	YES1	YES1_P216_F	51702529	NM_005433.3	YES1	7525	18	36.1	802543	-216	Y	CGGTCCGTGTCACTTCTCCCGACCCAACATGGCGGCGGGGTCCG	Yes, c-yes, HsT441, P61-YES	proto-oncogene tyrosine-protein kinase YES; Yamaguchi sarcoma oncogene; cellular yes-1 protein; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	viral oncogene yes-1 homolog 1
YES1_P600_F	5452	0.02375628	8620.573	212.2097	4.599853E-11	34	385.9026	0.06692472	12532.46	906.0615	4.961254E-18	32	995.751	0.06338017	17179.77	1169.305	6.498099E-38	31	815.1864	0.02197604	8588.288	195.2244	1.764896E-06	32	300.1404	0.07341687	11898.87	950.7181	1.017266E-17	35	887.019	0.06793734	14050.05	1031.387	1.405659E-28	31	1007.673	0.06903771	12995.14	971.1009	1.347003E-16	28	823.5296	0.08578017	16102.12	1520.226	1.105291E-18	34	864.634	0.07196971	11037.28	863.7075	2.969561E-15	28	690.7957	0.08292329	17012.76	1547.358	9.436129E-38	35	1029.573	YES1	YES1_P600_F	51702529	NM_005433.3	YES1	7525	18	36.1	802927	-600	Y	CCCTCATCACCATCCTGATCGCCGTCCAAAAAACGTTCACGTCTTGC	Yes, c-yes, HsT441, P61-YES	proto-oncogene tyrosine-protein kinase YES; Yamaguchi sarcoma oncogene; cellular yes-1 protein; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_process: intracellular signaling cascade; go_process: protein amino acid phosphorylation	viral oncogene yes-1 homolog 1
ZAP70_P220_R	5350	0.5527959	1249.484	1668.118	0.1149724	24	82.30542	0.4111085	4922.439	3506.194	4.736777E-07	26	288.5319	0.3915925	5963.954	3902.975	2.398125E-10	31	464.6486	0.4354949	1628.16	1333.211	0.2063932	21	127.5824	0.4795753	4416.693	4162.167	8.763001E-08	30	385.5571	0.3564462	5650.146	3184.843	2.177308E-09	27	319.9473	0.3735869	4739.91	2886.477	5.986177E-05	18	586.2169	0.4269371	5861.469	4441.349	2.19068E-06	35	268.2531	0.3609718	4932.898	2842.964	2.177562E-06	23	210.8236	0.3263222	6380.045	3138.864	1.829096E-09	32	391.4188	ZAP70	ZAP70_P220_R	46488942	NM_001079.3	ZAP70	7535	2	36.1	97696243	-220	N	GGTATGCAGGCTTCCTCCCTTCTGACGGTTCCTGCTGCTGGAGTCGTCCTTCCTGA	SRK, STD, TZK, ZAP-70	isoform 1 is encoded by transcript variant 1; truncated ZAP kinase; zeta-chain (TCR) associated protein kinase (70 kD); zeta-chain associated protein kinase, 70kD; syk-related tyrosine kinase; go_component: cytoplasm; go_component: T cell receptor complex; go_function: ATP binding; go_function: ATP binding; go_function: nucleotide binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: protein binding; go_function: transferase activity; go_function: protein-tyrosine kinase activity; go_function: protein serine/threonine kinase activity; go_function: non-membrane spanning protein tyrosine kinase activity; go_process: immune response; go_process: protein kinase cascade; go_process: protein amino acid phosphorylation; go_process: positive thymic T cell selection; go_process: protein amino acid phosphorylation; go_process: positive regulation of T cell differentiation	zeta-chain associated protein kinase 70kDa isoform 1
ZIM2_E110_F	4009	0.1175159	5695.375	771.7402	6.253427E-06	33	241.4159	0.7835818	2854.979	10699.04	2.368959E-18	29	759.0025	0.7813907	4052.237	14841.63	3.678E-38	25	1021.891	0.8738067	609.188	4910.664	0.006262213	28	168.2538	0.7580997	3224.051	10417.36	4.613399E-20	32	587.7266	0.7678588	3532.357	12014.83	1.816758E-30	45	611.3821	0.7418069	3717.23	10967.17	2.016842E-18	27	739.2427	0.7157375	5427.337	13917.15	1.200301E-22	25	674.7039	0.7670428	2669.194	9117.942	5.973597E-15	27	727.4057	0.6496477	5334.856	10077.69	1.372765E-25	27	828.3885	ZIM2	ZIM2_E110_F	33354272	NM_015363.3	ZIM2	23619	19	36.1	62043777	110	Y	CACTCACCTCACCTCAGTGCTGCGCAGCCTCGGGCACGAACAGCCGC	ZNF656	go_component: nucleus; go_function: DNA binding; go_function: metal ion binding; go_function: zinc ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger, imprinted 2
ZIM2_P22_F	2198	0.3886779	1789.87	1201.577	0.1026824	29	83.14138	0.7244101	4191.314	11280.06	3.943094E-24	30	753.7347	0.6990376	6169.989	14563.14	3.678E-38	22	1301.063	0.2079408	4134.744	1111.755	0.01023192	30	185.7908	0.6494129	4977.903	9406.096	2.103984E-22	20	812.9056	0.7061075	4414.888	10847.49	2.640953E-29	29	844.4673	0.6787053	5435.345	11692.9	2.080258E-25	28	945.3304	0.6917431	6109.239	13933.83	2.260398E-24	22	1172.222	0.7096093	2763.886	6998.297	4.122027E-10	31	515.7422	0.5915992	7142.783	10491.71	6.445265E-34	30	1052.282	ZIM2	ZIM2_P22_F	33354272	NM_015363.3	ZIM2	23619	19	36.1	62043909	-22	Y	GCAGCTGCCCAGACTTCTGCACCGAGGTGCAGCTCGACGCCTCCTTGTCA	ZNF656	go_component: nucleus; go_function: DNA binding; go_function: metal ion binding; go_function: zinc ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger, imprinted 2
ZIM3_E203_F	4010	0.5876773	480.4843	827.3555	0.5934164	35	35.33549	0.9627455	512.3887	15825.58	5.072132E-27	23	878.6204	0.9652626	598.0772	19397.77	3.678E-38	35	1248.828	0.9147794	402.5875	5394.901	0.003691002	23	200.8659	0.9622055	509.9351	15528.24	4.064387E-28	32	1106.332	0.9547066	559.8088	13907.62	3.469257E-26	24	1447.952	0.9581916	606.1097	16183.09	2.287056E-24	36	1114.987	0.9715096	591.3239	23573.79	6.260572E-36	39	833.2057	0.9465414	582.4126	12082.83	2.228445E-17	23	850.0339	0.9725016	529.0949	22248.46	3.678E-38	26	944.613	ZIM3	ZIM3_E203_F	16418390	NM_052882.1	ZIM3	114026	19	36.1	62348179	203	N	AAAACTTAATCGGCCCTCTACCCGCTGTATTCCGCATCATAATCCAGTCAA	ZNF657	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger, imprinted 3
ZIM3_P451_R	2204	0.7784087	533.9907	2227.09	0.1443918	26	100.1455	0.9717543	404.862	17369.1	3.407247E-32	36	1423.182	0.9761839	450.9695	22583.35	3.678E-38	32	1054.946	0.7058656	379.7096	1151.21	0.5474341	30	63.22232	0.9704416	468.2114	18655.18	3.678E-38	33	974.1747	0.9671027	477.8366	16987.02	3.678E-38	30	1229.482	0.9659182	522.3087	17636.94	1.022276E-28	28	1247.115	0.9759153	506.7144	24584.11	3.678E-38	24	875.9726	0.9457439	560.6332	11515.57	9.976251E-16	45	710.216	0.9749085	422.8262	20313.91	3.678E-38	26	1747.245	ZIM3	ZIM3_P451_R	16418390	NM_052882.1	ZIM3	114026	19	36.1	62348833	-451	Y	AGGTGGAACAATGCCTTAAAGTGCTCTCCGCCCGACAGAAAGAATTCAGGCTCCAA	ZNF657	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger, imprinted 3
ZIM3_P718_R	2205	0.6469168	501.8018	1102.617	0.4886799	16	89.8205	0.9377862	699.2334	12047.32	3.584664E-16	37	666.4502	0.9425989	822.9766	15156.46	2.485936E-28	18	685.4999	0.5871707	443.9182	773.6195	0.6273022	16	67.67799	0.9351912	682.7089	11294.5	2.552987E-15	31	436.1522	0.9364726	798.7257	13248.33	1.30114E-24	20	645.8415	0.9508929	667.9896	14871.08	9.954867E-21	22	856.9055	0.9509214	826.5483	17952.33	2.670031E-21	21	853.1778	0.9303971	527.5043	8387.982	2.115039E-08	26	827.9974	0.9542413	618.4249	14981.86	3.031822E-26	35	669.0723	ZIM3	ZIM3_P718_R	16418390	NM_052882.1	ZIM3	114026	19	36.1	62349100	-718	N	CCTCCCAGGAGAAGAGGTATCCAAAGATCGTATTAGCAAATGACCCTTGGCGGTG	ZNF657	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger, imprinted 3
ZMYND10_E77_R	4012	0.1506758	3348.688	611.8206	0.01652884	36	117.8065	0.09733254	8926.723	973.3306	1.109076E-09	34	456.3943	0.09980795	9888.474	1107.463	6.099864E-13	20	412.1241	0.3232172	391.9504	234.9452	0.7617978	20	28.90538	0.09616934	7827.789	843.5322	5.964313E-08	37	343.933	0.09423569	8775.774	923.4353	2.294398E-11	41	446.2971	0.09677471	8590.127	931.0906	1.346095E-07	18	602.5938	0.08118183	10905.09	972.3508	2.055358E-08	22	373.0504	0.09514948	8305.938	883.9258	6.18365E-09	37	478.229	0.09175212	8946.974	913.9344	3.64682E-10	21	327.3315	ZMYND10	ZMYND10_E77_R	37594443	NM_015896.2	ZMYND10	51364	3	36.1	50358083	77	Y	GGATGCTGTCACATTCGGGGACGACGGACCCCGACGGTGCCAAAGTCT	BLU, FLU	zinc finger, MYND domain containing 10; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding	zinc finger, MYND domain-containing 10
ZMYND10_P329_F	2208	0.1887469	3687.228	881.1397	0.00374829	39	119.9563	0.2864773	6153.275	2510.672	1.939683E-07	21	441.2285	0.1965502	6966.654	1728.735	5.330602E-08	17	500.5366	0.4303691	564.3884	501.9605	0.6641718	28	31.00102	0.2019896	6620.81	1701.148	2.488045E-07	21	790.6148	0.2232535	7659.071	2230.122	7.888633E-12	30	582.2296	0.1313221	8381.633	1282.208	7.96643E-08	33	315.3366	0.1587553	8355.169	1595.615	5.599401E-06	31	393.3135	0.1832469	5893.885	1344.79	1.487296E-05	21	395.7438	0.1437607	10013.32	1698.004	1.870168E-14	23	541.2911	ZMYND10	ZMYND10_P329_F	37594443	NM_015896.2	ZMYND10	51364	3	36.1	50358489	-329	Y	ATGGCTTCTTGGTTCCTCTATTTCTCGCGTCCCGGCTCCACTAGTTGGCTCCTGA	BLU, FLU	zinc finger, MYND domain containing 10; go_function: zinc ion binding; go_function: metal ion binding; go_function: protein binding	zinc finger, MYND domain-containing 10
ZNF215_P129_R	2216	0.05604886	3477.994	212.4501	0.02935709	29	140.1694	0.08419225	6116.838	571.5278	0.0001437271	25	271.7934	0.07765816	6194.291	529.9586	7.750377E-05	23	347.0132	0.04793538	2558.548	133.8549	0.2602438	25	101.83	0.09363885	5707.824	600.0235	0.0002453462	40	182.817	0.2561153	5173.972	1815.798	6.91789E-06	35	282.9329	0.07282374	6418.085	511.9537	0.0003758961	25	199.7553	0.1124362	6784.444	872.1187	0.0009991449	32	269.4032	0.1012916	5825.78	667.8823	0.0001620186	24	360.9486	0.1427214	6252.202	1057.527	1.247484E-05	18	336.5944	ZNF215	ZNF215_P129_R	7019582	NM_013250.1	ZNF215	7762	11	36.1	6904101	-129	Y	CGATTTGGACTAGTTTCCCCGGACGGGATGAGGCAGCGCCGGAAGTATGACGCTC	BAZ2	go_component: nucleus; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	zinc finger protein 215
ZNF215_P71_R	2215	0.03030762	6594.742	209.2433	1.511983E-06	30	236.2708	0.3041281	5797.592	2577.52	5.780066E-07	35	318.3111	0.3416929	6031.528	3182.556	5.382056E-09	28	334.6794	0.4713727	2303.672	2143.335	0.03645651	31	150.456	0.3649531	5084.167	2979.272	6.847448E-07	26	299.2645	0.4944361	5423.523	5401.948	2.875841E-14	22	478.0476	0.3190602	6569.098	3124.863	7.122621E-08	28	278.6052	0.3973088	6086.967	4078.6	3.172929E-06	37	290.058	0.2936883	6048.694	2556.661	8.050208E-08	34	363.7543	0.3716199	5639.158	3394.101	1.611795E-08	38	299.9283	ZNF215	ZNF215_P71_R	7019582	NM_013250.1	ZNF215	7762	11	36.1	6904159	-71	Y	TCTTTAAGCCACTAGAAGCTCACCGTGAGTCCATTCACAGGGCCAGAG	BAZ2	go_component: nucleus; go_component: nucleus; go_function: zinc ion binding; go_function: metal ion binding; go_function: nucleic acid binding; go_function: transcription factor activity; go_function: transcription factor activity; go_process: transcription; go_process: regulation of transcription, DNA-dependent; go_process: regulation of transcription, DNA-dependent	zinc finger protein 215
ZNF264_E48_R	4017	0.3950942	859.5049	626.7007	0.5307425	24	87.65291	0.2176578	5395.777	1528.997	7.243878E-05	24	292.214	0.2572681	5333.503	1882.061	1.557936E-05	27	538.2999	0.1704281	1271.866	281.8375	0.5415097	34	65.06282	0.2226135	5123.341	1495.763	9.804002E-05	28	297.377	0.2421981	5825.257	1893.748	3.736806E-07	34	350.322	0.1901454	5825.681	1391.287	0.0001809599	29	446.2739	0.2261714	6709.663	1990.3	0.0001153813	22	248.9586	0.23289	5162.072	1597.534	7.165909E-05	33	245.3787	0.2339979	6281.908	1949.541	4.377021E-07	20	392.3486	ZNF264	ZNF264_E48_R	55769562	NM_003417.2	ZNF264	9422	19	36.1	62394729	48	Y	AGGTCTGTAGCCACTGAGGGCCCCGGTCGGGGCCGCTTTGCAGGTCCCTA	.	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger protein 264
ZNF264_P397_F	2225	0.6351236	521.7153	1082.191	0.4888624	23	49.40736	0.7867284	1893.164	7352.496	1.885623E-08	25	520.7145	0.835519	1568.197	8473.988	9.967572E-11	30	393.5685	0.8968571	409.8975	4433.704	0.02001268	26	341.188	0.853919	1174.944	7452.709	7.157134E-08	25	482.5334	0.8130196	1494.423	6932.795	1.570155E-08	22	571.9047	0.7748649	1786.374	6492.478	8.799491E-06	27	357.2908	0.8117477	1912.091	8676.176	9.950921E-07	30	432.1108	0.8460175	955.52	5799.287	7.274788E-05	35	303.9561	0.7665287	1913.47	6610.586	1.368106E-07	29	368.8845	ZNF264	ZNF264_P397_F	55769562	NM_003417.2	ZNF264	9422	19	36.1	62394284	-397	Y	GGGATGTGAAAGGGGGTCAGTCGCCAGGCGAGCTGAGGACCCAGTTC	.	go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: regulation of transcription, DNA-dependent	zinc finger protein 264
ZNFN1A1_E102_F	1653	0.4941835	431.9649	519.7305	0.7102894	30	43.87686	0.9452416	816.1163	15814.04	4.913263E-28	40	927.9747	0.951278	802.7621	17626.09	3.678E-38	34	651.2054	0.8065367	325.6417	1774.475	0.3996959	26	87.24043	0.9468335	728.4161	14753.12	4.062846E-26	42	664.938	0.9456521	830.9402	16198.32	6.684277E-37	36	841.0852	0.9446543	738.9643	14319.67	2.054699E-19	27	1278.7	0.9499964	883.9218	18693.1	3.255027E-23	26	984.1622	0.9130868	820.1528	9666.88	1.010723E-11	23	677.8829	0.947058	793.3347	15980.5	1.520138E-30	27	663.6314	ZNFN1A1	ZNFN1A1_E102_F	31657112	NM_006060.2	ZNFN1A1	10320	7	36.1	50411827	102	Y	GGAGGATTTACGAATGCTTGATGCCTCGGGAGAGAAAATGAATGGCT	IK1, LYF1, hIk-1, IKAROS, PRO0758, Hs.54452	Ikaros (zinc finger protein); CLL-associated antigen KW-6; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: mesoderm development; go_process: regulation of transcription, DNA-dependent	zinc finger protein, subfamily 1A, 1 (Ikaros)
ZNFN1A1_P179_F	6078	0.8602331	383.3633	2974.991	0.05547823	41	169.4122	0.9739004	313.244	15420.11	5.499303E-25	30	916.7827	0.9777673	312.0432	18121.16	3.678E-38	24	914.4005	0.8637292	281.1437	2415.814	0.2592753	32	107.0991	0.9739459	279.2391	14176.61	1.227905E-22	42	918.0537	0.9731364	309.8226	14845.89	7.095402E-29	28	1373.327	0.9719264	311.3906	14242.6	4.402634E-18	40	1069.322	0.9794778	296.2407	18911.62	2.563196E-22	17	971.162	0.9411264	447.9111	8758.66	5.729308E-09	29	433.2946	0.9757943	301.4323	16182.78	1.884067E-29	22	645.1763	ZNFN1A1	ZNFN1A1_P179_F	31657112	NM_006060.2	ZNFN1A1	10320	7	36.1	50411546	-179	N	AACCCCAGGTGCATCCCGAGGCCTGCCACCGAAGCCCACTCAAGGCTGAATGCACGG	IK1, LYF1, hIk-1, IKAROS, PRO0758, Hs.54452	Ikaros (zinc finger protein); CLL-associated antigen KW-6; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_process: transcription; go_process: mesoderm development; go_process: regulation of transcription, DNA-dependent	zinc finger protein, subfamily 1A, 1 (Ikaros)
ZP3_E90_F	4018	0.2378607	6947.412	2199.47	6.908409E-12	20	511.3384	0.06232028	14846.72	993.3926	2.438316E-25	24	1250.106	0.0523026	20056.42	1112.416	3.678E-38	32	1156.787	0.1097104	7220.297	902.0801	1.31251E-05	27	338.7158	0.07724132	12723.12	1073.384	1.536581E-20	37	998.603	0.1218682	14922.06	2084.779	8.457017E-37	37	912.0325	0.06810857	15766.03	1159.591	8.772875E-25	34	1287.166	0.0740777	22050.38	1772.124	7.033898E-35	27	797.5021	0.1191178	12844.53	1750.431	2.029775E-23	34	1200.42	0.07050801	18516	1412.144	3.678E-38	24	1273.284	ZP3	ZP3_E90_F	89026125	XM_939654.1	ZP3	7784	7	36.1	75864894	90	Y	CGCAGTGCACGTTGTCCAGCAGGATGTGTCCGGTGCCATAGCCGAAGAAGGCGTT	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Zona pellucida sperm-binding protein 3 precursor (Zona pellucida glycoprotein ZP3) (Zona pellucida protein C) (Sperm receptor) (ZP3A/ZP3B)
ZP3_P220_F	2232	0.4625415	1337.899	1237.468	0.1853857	22	85.58052	0.8943092	1667.809	14958.42	5.071489E-28	31	1011.609	0.8924965	2055.114	17891.79	3.678E-38	33	877.9922	0.4059316	1898.786	1365.786	0.1543726	32	135.4907	0.9081914	1369.21	14533.76	1.264536E-27	31	1053.811	0.8831867	1500.372	12099.88	5.376033E-23	25	735.7215	0.8967798	1685.351	15511.17	1.27544E-25	24	1406.58	0.8980668	2177.207	20062.97	3.072249E-30	28	1003.771	0.8966901	1169.876	11022.04	4.80573E-16	23	640.9319	0.9080263	1714.602	17914.96	3.678E-38	27	1052.871	ZP3	ZP3_P220_F	89026125	XM_939654.1	ZP3	7784	7	36.1	75864584	-220	N	GAGTGTACCACAAGGAGTTCTGGGATATTCGGAGGCACTTCTAGAACAGGACTGA	.	Derived by automated computational analysis using gene prediction method: GNOMON.	similar to Zona pellucida sperm-binding protein 3 precursor (Zona pellucida glycoprotein ZP3) (Zona pellucida protein C) (Sperm receptor) (ZP3A/ZP3B)
