Back to Multiple platform build/check report for BioC 3.19:   simplified   long
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2024-10-18 20:42 -0400 (Fri, 18 Oct 2024).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 22.04.3 LTS)x86_644.4.1 (2024-06-14) -- "Race for Your Life" 4763
palomino7Windows Server 2022 Datacenterx644.4.1 (2024-06-14 ucrt) -- "Race for Your Life" 4500
merida1macOS 12.7.5 Montereyx86_644.4.1 (2024-06-14) -- "Race for Your Life" 4530
kjohnson1macOS 13.6.6 Venturaarm644.4.1 (2024-06-14) -- "Race for Your Life" 4480
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 728/2300HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 1.10.3  (landing page)
Changqing Wang
Snapshot Date: 2024-10-16 14:00 -0400 (Wed, 16 Oct 2024)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: RELEASE_3_19
git_last_commit: 66bc0bd
git_last_commit_date: 2024-10-13 20:16:38 -0400 (Sun, 13 Oct 2024)
nebbiolo1Linux (Ubuntu 22.04.3 LTS) / x86_64  OK    OK    OK  YES
palomino7Windows Server 2022 Datacenter / x64... NOT SUPPORTED ...
merida1macOS 12.7.5 Monterey / x86_64  OK    OK    OK    OK  YES
kjohnson1macOS 13.6.6 Ventura / arm64  OK    OK    OK    OK  YES


CHECK results for FLAMES on kjohnson1

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: FLAMES
Version: 1.10.3
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.10.3.tar.gz
StartedAt: 2024-10-17 21:45:49 -0400 (Thu, 17 Oct 2024)
EndedAt: 2024-10-17 21:57:40 -0400 (Thu, 17 Oct 2024)
EllapsedTime: 711.0 seconds
RetCode: 0
Status:   OK  
CheckDir: FLAMES.Rcheck
Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.10.3.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck’
* using R version 4.4.1 (2024-06-14)
* using platform: aarch64-apple-darwin20
* R was compiled by
    Apple clang version 14.0.0 (clang-1400.0.29.202)
    GNU Fortran (GCC) 12.2.0
* running under: macOS Ventura 13.6.6
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.10.3’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
  Not all R platforms support C++17
* checking installed package size ... NOTE
  installed size is  5.8Mb
  sub-directories of 1Mb or more:
    data   2.7Mb
    libs   1.4Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
Package listed in more than one of Depends, Imports, Suggests, Enhances:
  ‘txdbmaker’
A package should be listed in only one of these fields.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: 'IRanges'
  All declared Imports should be used.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
find_variants_grange: no visible binding for global variable
  'which_label'
find_variants_grange: no visible binding for global variable
  'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
  'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'pct'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
  'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
  'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
  variable 'heatmap_annotation_colors'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
sc_umap_expression: no visible binding for global variable
  'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
  'x'
sc_umap_expression : plot_idx: no visible binding for global variable
  'y'
transcript_coverage: no visible binding for global variable 'mat'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
  'cell_total_reads'
Undefined global functions or variables:
  . BarcodeEditDist FSM_match FlankEditDist Freq all_vars allele_count
  bam_index barcode cell_id cell_total_reads cnt count counts_no_ins
  everything gene_id heatmap_annotation_colors label length_bin mat
  mutation_index n name nucleotide pct pos ref tr_id transcript
  transcript_id value which_label x y
* checking Rd files ... NOTE
checkRd: (-1) bulk_long_pipeline.Rd:80-81: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:82-83: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:84-86: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:40: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:41: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:42: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:43: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:44: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:45: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) create_config.Rd:14: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:15: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:20: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:21: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:22: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:23: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:24: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:25: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:26: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:27: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:28: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:29: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:30: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:31: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:32: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:33: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:34: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:35: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:36: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:37: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:38: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:39: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:40: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:41: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:42: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:43: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:44: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:45: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:46: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_DTU_analysis.Rd:18: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:19: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:20: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:21: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:22: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:23: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:24: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_multisample_pipeline.Rd:88-89: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_multisample_pipeline.Rd:90-91: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_multisample_pipeline.Rd:92-94: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:94-95: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:96-97: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:98-100: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:53: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:54: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:55: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:56: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:57: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:58: Lost braces in \itemize; \value handles \item{}{} directly
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                        user system elapsed
sc_heatmap_expression 44.553  0.705  45.389
sc_umap_expression    38.410  0.551  39.788
sc_reduce_dims        27.119  0.318  26.899
quantify_transcript    9.158  0.138   9.635
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 9 NOTEs
See
  ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00check.log’
for details.


Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch arm64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/Rtmp27fB87/file451640024e5e/config_file_17686.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp27fB87/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
> 
> proc.time()
   user  system elapsed 
 25.831   1.634  30.722 

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
annotation_to_fasta1.5150.0731.653
blaze0.4160.0742.311
bulk_long_pipeline0.9670.1542.250
combine_sce1.7480.0861.854
create_config0.0080.0020.010
create_sce_from_dir0.1520.0430.217
create_se_from_dir0.6730.0930.798
cutadapt000
filter_annotation0.5170.0060.529
find_barcode0.1670.0130.186
find_isoform1.3460.0891.595
find_variants0.0610.0290.368
get_GRangesList1.3890.1011.603
minimap2_align1.1310.0901.366
minimap2_realign2.2480.1202.475
parse_gff_tree1.1560.0311.207
plot_coverage4.4930.1094.691
plot_demultiplex0.4450.0320.493
quantify_transcript9.1580.1389.635
sc_DTU_analysis0.1840.0380.258
sc_heatmap_expression44.553 0.70545.389
sc_long_multisample_pipeline1.6500.1001.758
sc_long_pipeline0.1540.0310.192
sc_mutations0.0990.0300.380
sc_reduce_dims27.119 0.31826.899
sc_umap_expression38.410 0.55139.788
sys_which0.0040.0140.037