Back to Multiple platform build/check report for BioC 3.19: simplified long |
|
This page was generated on 2024-10-18 20:42 -0400 (Fri, 18 Oct 2024).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo1 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4763 |
palomino7 | Windows Server 2022 Datacenter | x64 | 4.4.1 (2024-06-14 ucrt) -- "Race for Your Life" | 4500 |
merida1 | macOS 12.7.5 Monterey | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4530 |
kjohnson1 | macOS 13.6.6 Ventura | arm64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4480 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 728/2300 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 1.10.3 (landing page) Changqing Wang
| nebbiolo1 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | OK | ![]() | ||||||||
palomino7 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
merida1 | macOS 12.7.5 Monterey / x86_64 | OK | OK | OK | OK | ![]() | ||||||||
kjohnson1 | macOS 13.6.6 Ventura / arm64 | OK | OK | OK | OK | ![]() | ||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 1.10.3 |
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.10.3.tar.gz |
StartedAt: 2024-10-17 21:45:49 -0400 (Thu, 17 Oct 2024) |
EndedAt: 2024-10-17 21:57:40 -0400 (Thu, 17 Oct 2024) |
EllapsedTime: 711.0 seconds |
RetCode: 0 |
Status: OK |
CheckDir: FLAMES.Rcheck |
Warnings: 0 |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.10.3.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck’ * using R version 4.4.1 (2024-06-14) * using platform: aarch64-apple-darwin20 * R was compiled by Apple clang version 14.0.0 (clang-1400.0.29.202) GNU Fortran (GCC) 12.2.0 * running under: macOS Ventura 13.6.6 * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * checking extension type ... Package * this is package ‘FLAMES’ version ‘1.10.3’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .BBSoptions These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’ * used SDK: ‘MacOSX11.3.sdk’ * checking C++ specification ... OK Not all R platforms support C++17 * checking installed package size ... NOTE installed size is 5.8Mb sub-directories of 1Mb or more: data 2.7Mb libs 1.4Mb * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... NOTE Package listed in more than one of Depends, Imports, Suggests, Enhances: ‘txdbmaker’ A package should be listed in only one of these fields. * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... NOTE Namespace in Imports field not imported from: 'IRanges' All declared Imports should be used. * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE find_variants_grange: no visible binding for global variable 'which_label' find_variants_grange: no visible binding for global variable 'nucleotide' find_variants_grange: no visible binding for global variable 'pos' find_variants_grange: no visible binding for global variable 'count' find_variants_grange: no visible binding for global variable 'counts_no_ins' find_variants_grange: no visible binding for global variable 'ref' generate_sc_sce: no visible binding for global variable 'FSM_match' homopolymer_pct : <anonymous>: no visible binding for global variable 'Freq' homopolymer_pct : <anonymous>: no visible binding for global variable 'pct' plot_coverage: no visible binding for global variable 'x' plot_coverage: no visible binding for global variable 'transcript' plot_coverage: no visible binding for global variable 'length_bin' plot_demultiplex: no visible binding for global variable 'Freq' plot_demultiplex: no visible binding for global variable '.' plot_demultiplex: no visible binding for global variable 'x' plot_demultiplex: no visible binding for global variable 'FlankEditDist' plot_demultiplex: no visible binding for global variable 'n' plot_demultiplex: no visible binding for global variable 'BarcodeEditDist' plot_flagstat: no visible global function definition for 'everything' plot_flagstat: no visible binding for global variable 'name' plot_flagstat: no visible binding for global variable 'value' sc_DTU_analysis: no visible binding for global variable 'FSM_match' sc_DTU_analysis: no visible binding for global variable 'gene_id' sc_DTU_analysis: no visible binding for global variable '.' sc_DTU_analysis: no visible binding for global variable 'cell_id' sc_DTU_analysis: no visible binding for global variable 'cnt' sc_DTU_analysis: no visible binding for global variable 'tr_id' sc_DTU_analysis: no visible binding for global variable 'label' sc_DTU_analysis : filter_tr: no visible binding for global variable 'gene_id' sc_DTU_analysis : filter_tr: no visible global function definition for 'all_vars' sc_DTU_analysis : filter_tr: no visible binding for global variable '.' sc_DTU_analysis: no visible global function definition for 'all_vars' sc_heatmap_expression: no visible binding for global variable 'transcript_id' sc_heatmap_expression: no visible binding for global variable 'gene_id' sc_heatmap_expression : group_annotation: no visible binding for global variable 'heatmap_annotation_colors' sc_mutations: no visible binding for global variable 'mutation_index' sc_mutations: no visible binding for global variable 'bam_index' sc_umap_expression: no visible binding for global variable 'transcript_id' sc_umap_expression: no visible binding for global variable 'gene_id' sc_umap_expression: no visible binding for global variable 'x' sc_umap_expression: no visible binding for global variable 'y' sc_umap_expression : plot_idx: no visible binding for global variable 'x' sc_umap_expression : plot_idx: no visible binding for global variable 'y' transcript_coverage: no visible binding for global variable 'mat' variant_count_tb: no visible binding for global variable 'barcode' variant_count_tb: no visible binding for global variable 'allele_count' variant_count_tb: no visible binding for global variable 'cell_total_reads' Undefined global functions or variables: . BarcodeEditDist FSM_match FlankEditDist Freq all_vars allele_count bam_index barcode cell_id cell_total_reads cnt count counts_no_ins everything gene_id heatmap_annotation_colors label length_bin mat mutation_index n name nucleotide pct pos ref tr_id transcript transcript_id value which_label x y * checking Rd files ... NOTE checkRd: (-1) bulk_long_pipeline.Rd:80-81: Lost braces in \itemize; meant \describe ? checkRd: (-1) bulk_long_pipeline.Rd:82-83: Lost braces in \itemize; meant \describe ? checkRd: (-1) bulk_long_pipeline.Rd:84-86: Lost braces in \itemize; meant \describe ? checkRd: (-1) bulk_long_pipeline.Rd:40: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) bulk_long_pipeline.Rd:41: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) bulk_long_pipeline.Rd:42: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) bulk_long_pipeline.Rd:43: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) bulk_long_pipeline.Rd:44: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) bulk_long_pipeline.Rd:45: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) create_config.Rd:14: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:15: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:20: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:21: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:22: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:23: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:24: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:25: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:26: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:27: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:28: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:29: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:30: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:31: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:32: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:33: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:34: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:35: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:36: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:37: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:38: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:39: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:40: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:41: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:42: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:43: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:44: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:45: Lost braces in \itemize; meant \describe ? checkRd: (-1) create_config.Rd:46: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_DTU_analysis.Rd:18: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_DTU_analysis.Rd:19: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_DTU_analysis.Rd:20: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_DTU_analysis.Rd:21: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_DTU_analysis.Rd:22: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_DTU_analysis.Rd:23: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_DTU_analysis.Rd:24: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_long_multisample_pipeline.Rd:88-89: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_long_multisample_pipeline.Rd:90-91: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_long_multisample_pipeline.Rd:92-94: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_long_pipeline.Rd:94-95: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_long_pipeline.Rd:96-97: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_long_pipeline.Rd:98-100: Lost braces in \itemize; meant \describe ? checkRd: (-1) sc_long_pipeline.Rd:53: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_long_pipeline.Rd:54: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_long_pipeline.Rd:55: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_long_pipeline.Rd:56: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_long_pipeline.Rd:57: Lost braces in \itemize; \value handles \item{}{} directly checkRd: (-1) sc_long_pipeline.Rd:58: Lost braces in \itemize; \value handles \item{}{} directly * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/libs/FLAMES.so’: Found ‘___assert_rtn’, possibly from ‘assert’ (C) Found ‘___stderrp’, possibly from ‘stderr’ (C) Found ‘___stdoutp’, possibly from ‘stdout’ (C) Found ‘_abort’, possibly from ‘abort’ (C) Found ‘_exit’, possibly from ‘exit’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed sc_heatmap_expression 44.553 0.705 45.389 sc_umap_expression 38.410 0.551 39.788 sc_reduce_dims 27.119 0.318 26.899 quantify_transcript 9.158 0.138 9.635 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 9 NOTEs See ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’ using C++17 using SDK: ‘MacOSX11.3.sdk’ clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang -arch arm64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/zlibbioc/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.4.1 (2024-06-14) -- "Race for Your Life" Copyright (C) 2024 The R Foundation for Statistical Computing Platform: aarch64-apple-darwin20 R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > # This file is part of the standard setup for testthat. > # It is recommended that you do not modify it. > # > # Where should you do additional test configuration? > # Learn more about the roles of various files in: > # * https://r-pkgs.org/tests.html > # * https://testthat.r-lib.org/reference/test_package.html#special-files > > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/Rtmp27fB87/file451640024e5e/config_file_17686.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/Rtmp27fB87/bc_allow.tsv Number of known barcodes: 143 Searching for barcodes... Number of reads processed: 393 Number of reads where a barcode was found: 368 Number of reads where more than one barcode was found: 4 All done! Skipping TSO trimming... [ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ] > > proc.time() user system elapsed 25.831 1.634 30.722
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
annotation_to_fasta | 1.515 | 0.073 | 1.653 | |
blaze | 0.416 | 0.074 | 2.311 | |
bulk_long_pipeline | 0.967 | 0.154 | 2.250 | |
combine_sce | 1.748 | 0.086 | 1.854 | |
create_config | 0.008 | 0.002 | 0.010 | |
create_sce_from_dir | 0.152 | 0.043 | 0.217 | |
create_se_from_dir | 0.673 | 0.093 | 0.798 | |
cutadapt | 0 | 0 | 0 | |
filter_annotation | 0.517 | 0.006 | 0.529 | |
find_barcode | 0.167 | 0.013 | 0.186 | |
find_isoform | 1.346 | 0.089 | 1.595 | |
find_variants | 0.061 | 0.029 | 0.368 | |
get_GRangesList | 1.389 | 0.101 | 1.603 | |
minimap2_align | 1.131 | 0.090 | 1.366 | |
minimap2_realign | 2.248 | 0.120 | 2.475 | |
parse_gff_tree | 1.156 | 0.031 | 1.207 | |
plot_coverage | 4.493 | 0.109 | 4.691 | |
plot_demultiplex | 0.445 | 0.032 | 0.493 | |
quantify_transcript | 9.158 | 0.138 | 9.635 | |
sc_DTU_analysis | 0.184 | 0.038 | 0.258 | |
sc_heatmap_expression | 44.553 | 0.705 | 45.389 | |
sc_long_multisample_pipeline | 1.650 | 0.100 | 1.758 | |
sc_long_pipeline | 0.154 | 0.031 | 0.192 | |
sc_mutations | 0.099 | 0.030 | 0.380 | |
sc_reduce_dims | 27.119 | 0.318 | 26.899 | |
sc_umap_expression | 38.410 | 0.551 | 39.788 | |
sys_which | 0.004 | 0.014 | 0.037 | |