Multiple platform build/check report for BioC 3.20 - CHECK results for affxparser on lconway

Hostname	OS	Arch (*)	R version	Installed pkgs
teran2	Linux (Ubuntu 24.04.1 LTS)	x86_64	4.4.1 (2024-06-14) -- "Race for Your Life"	4503
nebbiolo2	Linux (Ubuntu 24.04.1 LTS)	x86_64	4.4.1 (2024-06-14) -- "Race for Your Life"	4763
palomino8	Windows Server 2022 Datacenter	x64	4.4.1 (2024-06-14 ucrt) -- "Race for Your Life"	4506
lconway	macOS 12.7.1 Monterey	x86_64	4.4.1 (2024-06-14) -- "Race for Your Life"	4539
kunpeng2	Linux (openEuler 22.03 LTS-SP1)	aarch64	4.4.1 (2024-06-14) -- "Race for Your Life"	4493
Click on any hostname to see more info about the system (e.g. compilers) () as reported by 'uname -p', except on Windows and Mac OS X*

CHECK results for affxparser on lconway

To the developers/maintainers of the affxparser package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/affxparser.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results

Summary

Package: affxparser

Version: 1.78.0

Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:affxparser.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings affxparser_1.78.0.tar.gz

StartedAt: 2024-11-04 19:56:23 -0500 (Mon, 04 Nov 2024)

EndedAt: 2024-11-04 20:01:20 -0500 (Mon, 04 Nov 2024)

EllapsedTime: 296.6 seconds

RetCode: 0

Status: WARNINGS

CheckDir: affxparser.Rcheck

Warnings: 2

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:affxparser.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings affxparser_1.78.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.20-bioc/meat/affxparser.Rcheck’
* using R version 4.4.1 (2024-06-14)
* using platform: x86_64-apple-darwin20
* R was compiled by
    Apple clang version 14.0.0 (clang-1400.0.29.202)
    GNU Fortran (GCC) 12.2.0
* running under: macOS Monterey 12.7.6
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘affxparser/DESCRIPTION’ ... OK
* this is package ‘affxparser’ version ‘1.78.0’
* checking package namespace information ... OK
* checking package dependencies ...Warning: unable to access index for repository https://CRAN.R-project.org/src/contrib:
  cannot open URL 'https://CRAN.R-project.org/src/contrib/PACKAGES'
 OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘affxparser’ can be installed ... WARNING
Found the following significant warnings:
  fusion/util/AffxConv.cpp:124:8: warning: self-comparison always evaluates to false [-Wtautological-compare]
See ‘/Users/biocbuild/bbs-3.20-bioc/meat/affxparser.Rcheck/00install.out’ for details.
* used C compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used SDK: ‘MacOSX11.3.sdk’
* checking installed package size ... NOTE
  installed size is  8.9Mb
  sub-directories of 1Mb or more:
    libs   8.2Mb
* checking package directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... NOTE
checkRd: (-1) applyCdfGroups.Rd:37-46: Lost braces in \itemize; meant \describe ?
checkRd: (-1) applyCdfGroups.Rd:47-59: Lost braces in \itemize; meant \describe ?
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... OK
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... WARNING
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/affxparser/libs/affxparser.so’:
  Found ‘__ZNSt3__14cerrE’, possibly from ‘std::cerr’ (C++)
  Found ‘__ZNSt3__14coutE’, possibly from ‘std::cout’ (C++)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)
  Found ‘_printf’, possibly from ‘printf’ (C)
  Found ‘_rand’, possibly from ‘rand’ (C)
  Found ‘_sprintf’, possibly from ‘sprintf’ (C)
  Found ‘_srand’, possibly from ‘srand’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking examples ... OK
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘convertCel.R’
  Running ‘readCdfDataFrame.R’
  Running ‘readCdfQc.R’
  Running ‘readCdfUnitsWriteMap.R’
  Running ‘readCdfUnits_etal.R’
  Running ‘readCel.R’
  Running ‘readCelIntensities.R’
  Running ‘readCelRectangle.R’
  Running ‘readCelUnits.R’
  Running ‘readPgf.R’
  Running ‘testWriteAndReadEmptyCdf.R’
  Running ‘testWriteAndReadEmptyCel.R’
 OK
* checking PDF version of manual ... OK
* DONE

Status: 2 WARNINGs, 2 NOTEs
See
  ‘/Users/biocbuild/bbs-3.20-bioc/meat/affxparser.Rcheck/00check.log’
for details.

Installation output

affxparser.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL affxparser
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library’
* installing *source* package ‘affxparser’ ...
** using staged installation
** libs
using C compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
using SDK: ‘MacOSX11.3.sdk’
rm -f fusion/calvin_files/data/src/CDFData.o fusion/calvin_files/data/src/CDFProbeGroupInformation.o fusion/calvin_files/data/src/CDFProbeInformation.o fusion/calvin_files/data/src/CDFProbeSetInformation.o fusion/calvin_files/data/src/CDFQCProbeInformation.o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o fusion/calvin_files/data/src/CELData.o fusion/calvin_files/data/src/CHPBackgroundZone.o fusion/calvin_files/data/src/CHPData.o fusion/calvin_files/data/src/CHPExpressionEntry.o fusion/calvin_files/data/src/CHPMultiDataData.o fusion/calvin_files/data/src/CHPTilingData.o fusion/calvin_files/data/src/CHPQuantificationData.o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o fusion/calvin_files/data/src/CHPGenotypeEntry.o fusion/calvin_files/data/src/CHPUniversalEntry.o fusion/calvin_files/data/src/ColumnInfo.o fusion/calvin_files/data/src/DataGroup.o fusion/calvin_files/data/src/DataGroupHeader.o fusion/calvin_files/data/src/DataSet.o fusion/calvin_files/data/src/DataSetHeader.o fusion/calvin_files/data/src/FileHeader.o fusion/calvin_files/data/src/GenericData.o fusion/calvin_files/data/src/GenericDataHeader.o fusion/calvin_files/exception/src/ExceptionBase.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionBPMAPData.o fusion/calvin_files/fusion/src/FusionCDFData.o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o fusion/calvin_files/fusion/src/FusionCELData.o fusion/calvin_files/fusion/src/FusionCHPData.o fusion/calvin_files/fusion/src/FusionProbeSetResults.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o fusion/calvin_files/fusion/src/FusionCHPTilingData.o fusion/calvin_files/fusion/src/FusionCHPGenericData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o fusion/calvin_files/parameter/src/ParameterNameValueType.o fusion/calvin_files/parsers/src/CDFFileReader.o fusion/calvin_files/parsers/src/CelFileReader.o fusion/calvin_files/parsers/src/CHPFileReader.o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o fusion/calvin_files/parsers/src/CHPTilingFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o fusion/calvin_files/parsers/src/DataGroupReader.o fusion/calvin_files/parsers/src/DataSetHeaderReader.o fusion/calvin_files/parsers/src/DataSetReader.o fusion/calvin_files/parsers/src/FileHeaderReader.o fusion/calvin_files/parsers/src/FileInput.o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o fusion/calvin_files/parsers/src/GenericFileReader.o fusion/calvin_files/utils/src/AffymetrixGuid.o fusion/calvin_files/utils/src/DateTime.o fusion/calvin_files/utils/src/FileUtils.o fusion/calvin_files/utils/src/StringUtils.o fusion/calvin_files/utils/src/checksum.o fusion/file/BPMAPFileData.o fusion/file/BPMAPFileWriter.o fusion/file/CDFFileData.o fusion/file/CELFileData.o fusion/file/CHPFileData.o fusion/file/FileIO.o fusion/file/FileWriter.o fusion/file/TsvFile/ClfFile.o fusion/file/TsvFile/PgfFile.o fusion/file/TsvFile/TsvFile.o fusion/util/AffxByteArray.o fusion/util/AffxConv.o fusion/util/MsgStream.o fusion/util/Util.o fusion/util/Err.o fusion/util/Fs.o fusion/util/Verbose.o fusion/util/RowFile.o fusion/util/TableFile.o fusion/util/Convert.o R_affx_cel_parser.o R_affx_cdf_parser.o R_affx_cdf_extras.o R_affx_bpmap_parser.o R_affx_clf_pgf_parser.o R_affx_chp_parser.o 000.init.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFData.cpp -o fusion/calvin_files/data/src/CDFData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeGroupInformation.cpp -o fusion/calvin_files/data/src/CDFProbeGroupInformation.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeInformation.cpp -o fusion/calvin_files/data/src/CDFProbeInformation.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeSetInformation.cpp -o fusion/calvin_files/data/src/CDFProbeSetInformation.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFQCProbeInformation.cpp -o fusion/calvin_files/data/src/CDFQCProbeInformation.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFQCProbeSetInformation.cpp -o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CELData.cpp -o fusion/calvin_files/data/src/CELData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPBackgroundZone.cpp -o fusion/calvin_files/data/src/CHPBackgroundZone.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPData.cpp -o fusion/calvin_files/data/src/CHPData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPExpressionEntry.cpp -o fusion/calvin_files/data/src/CHPExpressionEntry.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPMultiDataData.cpp -o fusion/calvin_files/data/src/CHPMultiDataData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPTilingData.cpp -o fusion/calvin_files/data/src/CHPTilingData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPQuantificationData.cpp -o fusion/calvin_files/data/src/CHPQuantificationData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPQuantificationDetectionData.cpp -o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPGenotypeEntry.cpp -o fusion/calvin_files/data/src/CHPGenotypeEntry.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPUniversalEntry.cpp -o fusion/calvin_files/data/src/CHPUniversalEntry.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/ColumnInfo.cpp -o fusion/calvin_files/data/src/ColumnInfo.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataGroup.cpp -o fusion/calvin_files/data/src/DataGroup.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataGroupHeader.cpp -o fusion/calvin_files/data/src/DataGroupHeader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataSet.cpp -o fusion/calvin_files/data/src/DataSet.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataSetHeader.cpp -o fusion/calvin_files/data/src/DataSetHeader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/FileHeader.cpp -o fusion/calvin_files/data/src/FileHeader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/GenericData.cpp -o fusion/calvin_files/data/src/GenericData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/GenericDataHeader.cpp -o fusion/calvin_files/data/src/GenericDataHeader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/exception/src/ExceptionBase.cpp -o fusion/calvin_files/exception/src/ExceptionBase.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.cpp -o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.cpp -o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionBPMAPData.cpp -o fusion/calvin_files/fusion/src/FusionBPMAPData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCDFData.cpp -o fusion/calvin_files/fusion/src/FusionCDFData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.cpp -o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCELData.cpp -o fusion/calvin_files/fusion/src/FusionCELData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPData.cpp -o fusion/calvin_files/fusion/src/FusionCHPData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionProbeSetResults.cpp -o fusion/calvin_files/fusion/src/FusionProbeSetResults.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.cpp -o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.cpp -o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPLegacyData.cpp -o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.cpp -o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPMultiDataData.cpp -o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPTilingData.cpp -o fusion/calvin_files/fusion/src/FusionCHPTilingData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPGenericData.cpp -o fusion/calvin_files/fusion/src/FusionCHPGenericData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPQuantificationData.cpp -o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.cpp -o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parameter/src/ParameterNameValueType.cpp -o fusion/calvin_files/parameter/src/ParameterNameValueType.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CDFFileReader.cpp -o fusion/calvin_files/parsers/src/CDFFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CelFileReader.cpp -o fusion/calvin_files/parsers/src/CelFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPFileReader.cpp -o fusion/calvin_files/parsers/src/CHPFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPMultiDataFileReader.cpp -o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPTilingFileReader.cpp -o fusion/calvin_files/parsers/src/CHPTilingFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPQuantificationFileReader.cpp -o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.cpp -o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataGroupHeaderReader.cpp -o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataGroupReader.cpp -o fusion/calvin_files/parsers/src/DataGroupReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataSetHeaderReader.cpp -o fusion/calvin_files/parsers/src/DataSetHeaderReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataSetReader.cpp -o fusion/calvin_files/parsers/src/DataSetReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/FileHeaderReader.cpp -o fusion/calvin_files/parsers/src/FileHeaderReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/FileInput.cpp -o fusion/calvin_files/parsers/src/FileInput.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/GenericDataHeaderReader.cpp -o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/GenericFileReader.cpp -o fusion/calvin_files/parsers/src/GenericFileReader.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/AffymetrixGuid.cpp -o fusion/calvin_files/utils/src/AffymetrixGuid.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/DateTime.cpp -o fusion/calvin_files/utils/src/DateTime.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/FileUtils.cpp -o fusion/calvin_files/utils/src/FileUtils.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/StringUtils.cpp -o fusion/calvin_files/utils/src/StringUtils.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/checksum.cpp -o fusion/calvin_files/utils/src/checksum.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/BPMAPFileData.cpp -o fusion/file/BPMAPFileData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/BPMAPFileWriter.cpp -o fusion/file/BPMAPFileWriter.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/CDFFileData.cpp -o fusion/file/CDFFileData.o
fusion/file/CDFFileData.cpp:1040:7: warning: unused typedef 'TilingTypes' [-Wunused-local-typedef]
    } TilingTypes;
      ^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/CELFileData.cpp -o fusion/file/CELFileData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/CHPFileData.cpp -o fusion/file/CHPFileData.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/FileIO.cpp -o fusion/file/FileIO.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/FileWriter.cpp -o fusion/file/FileWriter.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/TsvFile/ClfFile.cpp -o fusion/file/TsvFile/ClfFile.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/TsvFile/PgfFile.cpp -o fusion/file/TsvFile/PgfFile.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/TsvFile/TsvFile.cpp -o fusion/file/TsvFile/TsvFile.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/AffxByteArray.cpp -o fusion/util/AffxByteArray.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/AffxConv.cpp -o fusion/util/AffxConv.o
fusion/util/AffxConv.cpp:124:8: warning: self-comparison always evaluates to false [-Wtautological-compare]
        if (i != i) {return "nan";}
              ^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/MsgStream.cpp -o fusion/util/MsgStream.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Util.cpp -o fusion/util/Util.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Err.cpp -o fusion/util/Err.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Fs.cpp -o fusion/util/Fs.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Verbose.cpp -o fusion/util/Verbose.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/RowFile.cpp -o fusion/util/RowFile.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/TableFile.cpp -o fusion/util/TableFile.o
In file included from fusion/util/TableFile.cpp:28:
fusion/util/TableFile.h:231:8: warning: private field 'm_Comment' is not used [-Wunused-private-field]
  char m_Comment;            ///< Comment character for data.
       ^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Convert.cpp -o fusion/util/Convert.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_cel_parser.cpp -o R_affx_cel_parser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_cdf_parser.cpp -o R_affx_cdf_parser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_cdf_extras.cpp -o R_affx_cdf_extras.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_bpmap_parser.cpp -o R_affx_bpmap_parser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_clf_pgf_parser.cpp -o R_affx_clf_pgf_parser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_chp_parser.cpp -o R_affx_chp_parser.o
clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c 000.init.c -o 000.init.o
clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o affxparser.so fusion/calvin_files/data/src/CDFData.o fusion/calvin_files/data/src/CDFProbeGroupInformation.o fusion/calvin_files/data/src/CDFProbeInformation.o fusion/calvin_files/data/src/CDFProbeSetInformation.o fusion/calvin_files/data/src/CDFQCProbeInformation.o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o fusion/calvin_files/data/src/CELData.o fusion/calvin_files/data/src/CHPBackgroundZone.o fusion/calvin_files/data/src/CHPData.o fusion/calvin_files/data/src/CHPExpressionEntry.o fusion/calvin_files/data/src/CHPMultiDataData.o fusion/calvin_files/data/src/CHPTilingData.o fusion/calvin_files/data/src/CHPQuantificationData.o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o fusion/calvin_files/data/src/CHPGenotypeEntry.o fusion/calvin_files/data/src/CHPUniversalEntry.o fusion/calvin_files/data/src/ColumnInfo.o fusion/calvin_files/data/src/DataGroup.o fusion/calvin_files/data/src/DataGroupHeader.o fusion/calvin_files/data/src/DataSet.o fusion/calvin_files/data/src/DataSetHeader.o fusion/calvin_files/data/src/FileHeader.o fusion/calvin_files/data/src/GenericData.o fusion/calvin_files/data/src/GenericDataHeader.o fusion/calvin_files/exception/src/ExceptionBase.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionBPMAPData.o fusion/calvin_files/fusion/src/FusionCDFData.o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o fusion/calvin_files/fusion/src/FusionCELData.o fusion/calvin_files/fusion/src/FusionCHPData.o fusion/calvin_files/fusion/src/FusionProbeSetResults.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o fusion/calvin_files/fusion/src/FusionCHPTilingData.o fusion/calvin_files/fusion/src/FusionCHPGenericData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o fusion/calvin_files/parameter/src/ParameterNameValueType.o fusion/calvin_files/parsers/src/CDFFileReader.o fusion/calvin_files/parsers/src/CelFileReader.o fusion/calvin_files/parsers/src/CHPFileReader.o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o fusion/calvin_files/parsers/src/CHPTilingFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o fusion/calvin_files/parsers/src/DataGroupReader.o fusion/calvin_files/parsers/src/DataSetHeaderReader.o fusion/calvin_files/parsers/src/DataSetReader.o fusion/calvin_files/parsers/src/FileHeaderReader.o fusion/calvin_files/parsers/src/FileInput.o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o fusion/calvin_files/parsers/src/GenericFileReader.o fusion/calvin_files/utils/src/AffymetrixGuid.o fusion/calvin_files/utils/src/DateTime.o fusion/calvin_files/utils/src/FileUtils.o fusion/calvin_files/utils/src/StringUtils.o fusion/calvin_files/utils/src/checksum.o fusion/file/BPMAPFileData.o fusion/file/BPMAPFileWriter.o fusion/file/CDFFileData.o fusion/file/CELFileData.o fusion/file/CHPFileData.o fusion/file/FileIO.o fusion/file/FileWriter.o fusion/file/TsvFile/ClfFile.o fusion/file/TsvFile/PgfFile.o fusion/file/TsvFile/TsvFile.o fusion/util/AffxByteArray.o fusion/util/AffxConv.o fusion/util/MsgStream.o fusion/util/Util.o fusion/util/Err.o fusion/util/Fs.o fusion/util/Verbose.o fusion/util/RowFile.o fusion/util/TableFile.o fusion/util/Convert.o R_affx_cel_parser.o R_affx_cdf_parser.o R_affx_cdf_extras.o R_affx_bpmap_parser.o R_affx_clf_pgf_parser.o R_affx_chp_parser.o 000.init.o -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation
installing to /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/00LOCK-affxparser/00new/affxparser/libs
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** testing if installed package can be loaded from temporary location
** checking absolute paths in shared objects and dynamic libraries
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (affxparser)

Tests output

affxparser.Rcheck/tests/convertCel.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   ## rawData/
+   pathR <- system.file(package="AffymetrixDataTestFiles", mustWork=TRUE)
+   pathR <- file.path(pathR, "rawData")
+ 
+   ## File #1: Test3
+   chipType <- "Test3"
+   path <- file.path(pathR, "FusionSDK_Test3", chipType, "2.Calvin")
+   filename <- list.files(path=path, pattern="[.]CEL$")[1]
+   pathname <- file.path(path, filename)
+   hdr <- readCelHeader(pathname)
+   str(hdr)
+   stopifnot(hdr$chiptype == chipType)
+   filename4 <- gsub(".CEL", ",v4.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == hdr$chiptype)
+ 
+   ## New chip type
+   newChipType <- sprintf("%s-custom", chipType)
+   filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+ ## FIXME
+ ## stopifnot(hdr4$chiptype == newChipType)
+ 
+ 
+   ## File #2: FusionSDK_HG-U133A
+   chipType <- "HG-U133A"
+   path <- file.path(pathR, "FusionSDK_HG-U133A", chipType, "2.Calvin")
+   filename <- list.files(path=path, pattern="[.]CEL$")[1]
+   pathname <- file.path(path, filename)
+   hdr <- readCelHeader(pathname)
+   str(hdr)
+   stopifnot(hdr$chiptype == chipType)
+   filename4 <- gsub(".CEL", ",v4.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == hdr$chiptype)
+ 
+   ## New chip type
+   newChipType <- sprintf("%s-custom", chipType)
+   filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == newChipType)
+ 
+ 
+   ## File #3: FusionSDK_Focus
+   chipType <- "HG-Focus"
+   path <- file.path(pathR, "FusionSDK_HG-Focus", chipType, "2.Calvin")
+   filename <- list.files(path=path, pattern="[.]CEL$")[1]
+   pathname <- file.path(path, filename)
+   hdr <- readCelHeader(pathname)
+   str(hdr)
+   stopifnot(hdr$chiptype == chipType)
+   filename4 <- gsub(".CEL", ",v4.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == hdr$chiptype)
+ 
+   ## New chip type
+   newChipType <- sprintf("%s-custom", chipType)
+   filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+ ##  FIXME
+ ##  stopifnot(hdr4$chiptype == newChipType)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 14
 $ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
 $ version       : int 1
 $ cols          : int 126
 $ rows          : int 126
 $ total         : int 15876
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
 $ chiptype      : chr "Test3"
 $ header        : chr ""
 $ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 5
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
  CEL 1: /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL
  CEL 2: ./Test3-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
  Comparing CEL headers...
  Comparing CEL headers...done
  Comparing CEL data...
  Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./Test3-1-121502,v4.CEL"
List of 14
 $ filename      : chr "./Test3-1-121502,v4.CEL"
 $ version       : int 4
 $ cols          : int 126
 $ rows          : int 126
 $ total         : int 15876
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
 $ chiptype      : chr "Test3"
 $ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
 $ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 5
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'Test3' to 'Test3-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./Test3-1-121502,v4,custom.CEL"
List of 14
 $ filename      : chr "./Test3-1-121502,v4,custom.CEL"
 $ version       : int 4
 $ cols          : int 126
 $ rows          : int 126
 $ total         : int 15876
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
 $ chiptype      : chr "Test3"
 $ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
 $ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 5
 $ nmasked       : int 0
List of 14
 $ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
 $ version       : int 4
 $ cols          : int 712
 $ rows          : int 712
 $ total         : int 506944
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
 $ chiptype      : chr "HG-U133A"
 $ header        : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
 $ datheader     : chr "[46..48458]  ethan1-1:CLS=5377 RWS=5377 XIN=2  YIN=2  VE=30        2.0 11/10/04 18:23:42 M10SIM  M10   \024  \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 2085
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
  CEL 1: /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U133A/HG-U133A/2.Calvin/ethan1-1.CEL
  CEL 2: ./ethan1-1,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
  Comparing CEL headers...
  Comparing CEL headers...done
  Comparing CEL data...
  Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./ethan1-1,v4.CEL"
List of 14
 $ filename      : chr "./ethan1-1,v4.CEL"
 $ version       : int 4
 $ cols          : int 712
 $ rows          : int 712
 $ total         : int 506944
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
 $ chiptype      : chr "HG-U133A"
 $ header        : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
 $ datheader     : chr "[46..48458]  ethan1-1:CLS=5377 RWS=5377 XIN=2  YIN=2  VE=30        2.0 11/10/04 18:23:42 M10SIM  M10   \024  \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 2085
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-U133A' to 'HG-U133A-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./ethan1-1,v4,custom.CEL"
List of 14
 $ filename      : chr "./ethan1-1,v4,custom.CEL"
 $ version       : int 4
 $ cols          : int 712
 $ rows          : int 712
 $ total         : int 506944
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
 $ chiptype      : chr "HG-U133A-custom"
 $ header        : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
 $ datheader     : chr "[46..48458]  ethan1-1:CLS=5377 RWS=5377 XIN=2  YIN=2  VE=30        2.0 11/10/04 18:23:42 M10SIM  M10   \024  \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 2085
 $ nmasked       : int 0
List of 14
 $ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
 $ version       : int 1
 $ cols          : int 448
 $ rows          : int 448
 $ total         : int 200704
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
 $ chiptype      : chr "HG-Focus"
 $ header        : chr ""
 $ datheader     : chr "[7..46138]  B1:CLS=2920 RWS=2920 XIN=3  YIN=3  VE=17        2.0 05/15/02 11:07:10    \024  \024 HG-Focus.1sq \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 508
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
  CEL 1: /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Focus/HG-Focus/2.Calvin/HG-Focus-1-121502.CEL
  CEL 2: ./HG-Focus-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
  Comparing CEL headers...
  Comparing CEL headers...done
  Comparing CEL data...
  Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./HG-Focus-1-121502,v4.CEL"
List of 14
 $ filename      : chr "./HG-Focus-1-121502,v4.CEL"
 $ version       : int 4
 $ cols          : int 448
 $ rows          : int 448
 $ total         : int 200704
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
 $ chiptype      : chr "HG-Focus"
 $ header        : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
 $ datheader     : chr "[7..46138]  B1:CLS=2920 RWS=2920 XIN=3  YIN=3  VE=17        2.0 05/15/02 11:07:10    \024  \024 HG-Focus.1sq \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 508
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-Focus' to 'HG-Focus-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./HG-Focus-1-121502,v4,custom.CEL"
List of 14
 $ filename      : chr "./HG-Focus-1-121502,v4,custom.CEL"
 $ version       : int 4
 $ cols          : int 448
 $ rows          : int 448
 $ total         : int 200704
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
 $ chiptype      : chr "HG-Focus"
 $ header        : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
 $ datheader     : chr "[7..46138]  B1:CLS=2920 RWS=2920 XIN=3  YIN=3  VE=17        2.0 05/15/02 11:07:10    \024  \024 HG-Focus.1sq \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 508
 $ nmasked       : int 0
> 
> proc.time()
   user  system elapsed 
  2.925   0.460   3.421

affxparser.Rcheck/tests/readCdfDataFrame.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCdfDataFrame(cdf)
+   str(data)
+   stopifnot(length(unique(data$unitName)) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCdfDataFrame() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCdfDataFrame(cdf, units=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCdfDataFrame(cdf, units=idxs)
+       str(data)
+       units <- if (is.null(idxs)) seq_len(Jall) else as.integer(idxs)
+       stopifnot(length(unique(data$unitName)) == length(units))
+       stopifnot(identical(sort(unique(data$unit)), units))
+     }
+     message(sprintf("Testing readCdfDataFrame() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
'data.frame':	12708 obs. of  16 variables:
 $ unit           : int  1 1 1 1 1 1 1 1 1 1 ...
 $ unitName       : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ unitNbrOfAtoms : int  16 16 16 16 16 16 16 16 16 16 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ groupDirection : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ groupNbrOfAtoms: int  16 16 16 16 16 16 16 16 16 16 ...
 $ cell           : int  10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ x              : int  111 111 19 19 95 95 18 18 25 25 ...
 $ y              : int  79 80 19 20 39 40 55 56 113 114 ...
 $ pbase          : chr  "t" "a" "a" "t" ...
 $ tbase          : chr  "a" "a" "t" "t" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readAll' indices...
List of 1
 $ idxs: NULL
'data.frame':	12708 obs. of  16 variables:
 $ unit           : int  1 1 1 1 1 1 1 1 1 1 ...
 $ unitName       : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ unitNbrOfAtoms : int  16 16 16 16 16 16 16 16 16 16 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ groupDirection : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ groupNbrOfAtoms: int  16 16 16 16 16 16 16 16 16 16 ...
 $ cell           : int  10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ x              : int  111 111 19 19 95 95 18 18 25 25 ...
 $ y              : int  79 80 19 20 39 40 55 56 113 114 ...
 $ pbase          : chr  "t" "a" "a" "t" ...
 $ tbase          : chr  "a" "a" "t" "t" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readAll' indices...done
Testing readCdfDataFrame() with 'readOne' indices...
List of 1
 $ idxs: int 10
'data.frame':	24 obs. of  16 variables:
 $ unit           : int  10 10 10 10 10 10 10 10 10 10 ...
 $ unitName       : chr  "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "sense" "sense" "sense" "sense" ...
 $ unitNbrOfAtoms : int  12 12 12 12 12 12 12 12 12 12 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" ...
 $ groupDirection : chr  "sense" "sense" "sense" "sense" ...
 $ groupNbrOfAtoms: int  12 12 12 12 12 12 12 12 12 12 ...
 $ cell           : int  4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
 $ x              : int  37 37 79 79 68 68 51 51 79 79 ...
 $ y              : int  33 34 67 68 65 66 111 112 43 44 ...
 $ pbase          : chr  "t" "a" "c" "g" ...
 $ tbase          : chr  "a" "a" "g" "g" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readOne' indices...done
Testing readCdfDataFrame() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
'data.frame':	288 obs. of  16 variables:
 $ unit           : int  11 11 11 11 11 11 11 11 11 11 ...
 $ unitName       : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "sense" "sense" "sense" "sense" ...
 $ unitNbrOfAtoms : int  12 12 12 12 12 12 12 12 12 12 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ groupDirection : chr  "sense" "sense" "sense" "sense" ...
 $ groupNbrOfAtoms: int  12 12 12 12 12 12 12 12 12 12 ...
 $ cell           : int  5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ x              : int  15 15 35 35 83 83 113 113 119 119 ...
 $ y              : int  45 46 57 58 55 56 17 18 65 66 ...
 $ pbase          : chr  "t" "a" "t" "a" ...
 $ tbase          : chr  "a" "a" "a" "a" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readSome' indices...done
Testing readCdfDataFrame() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
'data.frame':	288 obs. of  16 variables:
 $ unit           : int  11 11 11 11 11 11 11 11 11 11 ...
 $ unitName       : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "sense" "sense" "sense" "sense" ...
 $ unitNbrOfAtoms : int  12 12 12 12 12 12 12 12 12 12 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ groupDirection : chr  "sense" "sense" "sense" "sense" ...
 $ groupNbrOfAtoms: int  12 12 12 12 12 12 12 12 12 12 ...
 $ cell           : int  5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ x              : int  15 15 35 35 83 83 113 113 119 119 ...
 $ y              : int  45 46 57 58 55 56 17 18 65 66 ...
 $ pbase          : chr  "t" "a" "t" "a" ...
 $ tbase          : chr  "a" "a" "a" "a" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readDouble' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCdfDataFrame(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCdfDataFrame(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,345]: 1000000000"
 $ call   : language readCdf(filename, units = units, readXY = readXY, readBases = readBases,      readIndexpos = readIndexpos, readAt| __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Warning messages:
1: In readCdfDataFrame(cdf) : Some of the fields were not read: expos
2: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
3: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
4: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
5: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
> 
> proc.time()
   user  system elapsed 
  2.286   0.133   2.428

affxparser.Rcheck/tests/readCdfQc.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nqcunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=5L,
+     readSome=5:10,
+     readDouble=as.double(5:10),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCdfQc(cdf)
+   str(head(data))
+   stopifnot(length(data) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCdfQc() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCdfQc(cdf, units=idxs)
+       str(head(data))
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(length(data) == J)
+     }
+     message(sprintf("Testing readCdfQc() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 82 83 84 85 86 82 83 84 85 86 ...
  ..$ indices   : int [1:300] 10410 10536 10662 10788 10914 10411 10537 10663 10789 10915 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE TRUE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpNegative"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 80 79 78 77 81 80 79 78 77 81 ...
  ..$ indices   : int [1:300] 10158 10032 9906 9780 10284 10159 10033 9907 9781 10285 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE FALSE TRUE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpPositive"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:204] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ y         : int [1:204] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:204] 121 119 117 115 113 111 109 107 105 103 ...
  ..$ length    : int [1:204] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybeNegative"
  ..$ ncells    : int 204
 $ :List of 8
  ..$ x         : int [1:32] 1 124 122 3 124 122 2 123 125 0 ...
  ..$ y         : int [1:32] 1 0 0 1 2 2 0 1 1 2 ...
  ..$ indices   : int [1:32] 128 125 123 130 377 375 3 250 252 253 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardPositive"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
Testing readCdfQc() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 82 83 84 85 86 82 83 84 85 86 ...
  ..$ indices   : int [1:300] 10410 10536 10662 10788 10914 10411 10537 10663 10789 10915 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE TRUE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpNegative"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 80 79 78 77 81 80 79 78 77 81 ...
  ..$ indices   : int [1:300] 10158 10032 9906 9780 10284 10159 10033 9907 9781 10285 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE FALSE TRUE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpPositive"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:204] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ y         : int [1:204] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:204] 121 119 117 115 113 111 109 107 105 103 ...
  ..$ length    : int [1:204] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybeNegative"
  ..$ ncells    : int 204
 $ :List of 8
  ..$ x         : int [1:32] 1 124 122 3 124 122 2 123 125 0 ...
  ..$ y         : int [1:32] 1 0 0 1 2 2 0 1 1 2 ...
  ..$ indices   : int [1:32] 128 125 123 130 377 375 3 250 252 253 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardPositive"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
Testing readCdfQc() with 'readAll' indices...done
Testing readCdfQc() with 'readOne' indices...
List of 1
 $ idxs: int 5
List of 1
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
Testing readCdfQc() with 'readOne' indices...done
Testing readCdfQc() with 'readSome' indices...
List of 1
 $ idxs: int [1:6] 5 6 7 8 9 10
List of 6
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
 $ :List of 8
  ..$ x         : int [1:24] 85 43 85 43 85 43 85 43 85 125 ...
  ..$ y         : int [1:24] 0 1 1 2 2 0 125 125 124 36 ...
  ..$ indices   : int [1:24] 86 170 212 296 338 44 15836 15794 15710 4662 ...
  ..$ length    : int [1:24] 20 18 18 16 16 20 20 20 18 16 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybePositive"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:24] 83 41 41 83 41 83 83 41 0 83 ...
  ..$ y         : int [1:24] 0 0 1 1 2 2 125 125 80 124 ...
  ..$ indices   : int [1:24] 84 42 168 210 294 336 15834 15792 10081 15708 ...
  ..$ length    : int [1:24] 20 20 18 18 16 16 20 20 20 18 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybeNegative"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:294] 12 16 18 19 20 21 22 24 25 26 ...
  ..$ y         : int [1:294] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:294] 1147 1151 1153 1154 1155 1156 1157 1159 1160 1161 ...
  ..$ length    : int [1:294] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesPositive"
  ..$ ncells    : int 294
 $ :List of 8
  ..$ x         : int [1:161] 13 14 15 37 38 39 42 66 67 68 ...
  ..$ y         : int [1:161] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:161] 1148 1149 1150 1172 1173 1174 1177 1201 1202 1203 ...
  ..$ length    : int [1:161] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesNegative"
  ..$ ncells    : int 161
Testing readCdfQc() with 'readSome' indices...done
Testing readCdfQc() with 'readDouble' indices...
List of 1
 $ idxs: num [1:6] 5 6 7 8 9 10
List of 6
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
 $ :List of 8
  ..$ x         : int [1:24] 85 43 85 43 85 43 85 43 85 125 ...
  ..$ y         : int [1:24] 0 1 1 2 2 0 125 125 124 36 ...
  ..$ indices   : int [1:24] 86 170 212 296 338 44 15836 15794 15710 4662 ...
  ..$ length    : int [1:24] 20 18 18 16 16 20 20 20 18 16 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybePositive"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:24] 83 41 41 83 41 83 83 41 0 83 ...
  ..$ y         : int [1:24] 0 0 1 1 2 2 125 125 80 124 ...
  ..$ indices   : int [1:24] 84 42 168 210 294 336 15834 15792 10081 15708 ...
  ..$ length    : int [1:24] 20 20 18 18 16 16 20 20 20 18 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybeNegative"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:294] 12 16 18 19 20 21 22 24 25 26 ...
  ..$ y         : int [1:294] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:294] 1147 1151 1153 1154 1155 1156 1157 1159 1160 1161 ...
  ..$ length    : int [1:294] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesPositive"
  ..$ ncells    : int 294
 $ :List of 8
  ..$ x         : int [1:161] 13 14 15 37 38 39 42 66 67 68 ...
  ..$ y         : int [1:161] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:161] 1148 1149 1150 1172 1173 1174 1177 1201 1202 1203 ...
  ..$ length    : int [1:161] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesNegative"
  ..$ ncells    : int 161
Testing readCdfQc() with 'readDouble' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.434   0.109   0.540

affxparser.Rcheck/tests/readCdfUnits_etal.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   fcnNames <- c(
+     "readCdf",
+     "readCdfUnits",
+     "readCdfUnitNames",
+     "readCdfNbrOfCellsPerUnitGroup",
+     "readCdfGroupNames",
+     "readCdfCellIndices",
+     "readCdfIsPm"
+   )
+ 
+   # Read full file
+   for (fcnName in fcnNames) {
+     fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+     data <- fcn(cdf)
+     str(head(data))
+     stopifnot(length(data) == Jall)
+   } # for (fcn ...)
+ 
+   for (fcnName in fcnNames) {
+     fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+ 
+     # Read different subsets of units
+     for (ii in seq_along(idxsList)) {
+       name <- names(idxsList)[ii]
+       message(sprintf("Testing %s() with '%s' indices...", fcnName, name))
+       idxs <- idxsList[[ii]]
+       str(list(idxs=idxs))
+       if (grepl("outOfRange", name)) {
+         res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+         str(res)
+         stopifnot(inherits(res, "error"))
+       } else {
+         data <- fcn(cdf, units=idxs)
+         str(head(data))
+         J <- if (is.null(idxs)) Jall else length(idxs)
+         stopifnot(length(data) == J)
+       }
+       message(sprintf("Testing %s() with '%s' indices...done", fcnName, name))
+     } # for (ii ...)
+   } # for (fcn ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ Pae_16SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y             : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase         : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1000
 $ Pae_23SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y             : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1001
 $ PA1178_oprH_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1178_oprH_at:List of 9
  .. .. ..$ x             : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y             : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1002
 $ PA1816_dnaQ_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_at:List of 9
  .. .. ..$ x             : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y             : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1003
 $ PA3183_zwf_at   :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_at:List of 9
  .. .. ..$ x             : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y             : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1004
 $ PA3640_dnaE_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_at:List of 9
  .. .. ..$ x             : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y             : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1005
List of 6
 $ Pae_16SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y        : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase    : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ Pae_23SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y        : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1178_oprH_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1178_oprH_at:List of 6
  .. .. ..$ x        : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y        : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1816_dnaQ_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_at:List of 6
  .. .. ..$ x        : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y        : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3183_zwf_at   :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_at:List of 6
  .. .. ..$ x        : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y        : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3640_dnaE_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_at:List of 6
  .. .. ..$ x        : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y        : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
List of 6
 $ Pae_16SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
 $ Pae_23SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
 $ PA1178_oprH_at  : Named int 24
  ..- attr(*, "names")= chr "PA1178_oprH_at"
 $ PA1816_dnaQ_at  : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_at"
 $ PA3183_zwf_at   : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_at"
 $ PA3640_dnaE_at  : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_at"
List of 6
 $ Pae_16SrRNA_s_at: chr ""
 $ Pae_23SrRNA_s_at: chr ""
 $ PA1178_oprH_at  : chr ""
 $ PA1816_dnaQ_at  : chr ""
 $ PA3183_zwf_at   : chr ""
 $ PA3640_dnaE_at  : chr ""
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
 $ PA1178_oprH_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1178_oprH_at:List of 1
  .. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_at:List of 1
  .. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
 $ PA3183_zwf_at   :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_at:List of 1
  .. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_at:List of 1
  .. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdf() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y             : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase         : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1000
 $ Pae_23SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y             : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1001
 $ PA1178_oprH_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1178_oprH_at:List of 9
  .. .. ..$ x             : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y             : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1002
 $ PA1816_dnaQ_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_at:List of 9
  .. .. ..$ x             : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y             : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1003
 $ PA3183_zwf_at   :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_at:List of 9
  .. .. ..$ x             : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y             : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1004
 $ PA3640_dnaE_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_at:List of 9
  .. .. ..$ x             : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y             : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1005
Testing readCdf() with 'readAll' indices...done
Testing readCdf() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 7
  ..$ groups       :List of 1
  .. ..$ PA1178_oprH_st:List of 9
  .. .. ..$ x             : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
  .. .. ..$ y             : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "c" "g" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "g" "g" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1052
Testing readCdf() with 'readOne' indices...done
Testing readCdf() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_st:List of 9
  .. .. ..$ x             : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y             : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1053
 $ PA3183_zwf_st          :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_st:List of 9
  .. .. ..$ x             : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y             : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1054
 $ PA3640_dnaE_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_st:List of 9
  .. .. ..$ x             : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y             : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1055
 $ PA4407_ftsZ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA4407_ftsZ_st:List of 9
  .. .. ..$ x             : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y             : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase         : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1056
 $ AFFX-Athal-Actin_5_r_at:List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 9
  .. .. ..$ x             : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y             : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase         : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1100
 $ AFFX-Athal-Actin_M_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 9
  .. .. ..$ x             : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y             : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1101
Testing readCdf() with 'readSome' indices...done
Testing readCdf() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_st:List of 9
  .. .. ..$ x             : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y             : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1053
 $ PA3183_zwf_st          :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_st:List of 9
  .. .. ..$ x             : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y             : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1054
 $ PA3640_dnaE_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_st:List of 9
  .. .. ..$ x             : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y             : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1055
 $ PA4407_ftsZ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA4407_ftsZ_st:List of 9
  .. .. ..$ x             : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y             : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase         : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1056
 $ AFFX-Athal-Actin_5_r_at:List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 9
  .. .. ..$ x             : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y             : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase         : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1100
 $ AFFX-Athal-Actin_M_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 9
  .. .. ..$ x             : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y             : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1101
Testing readCdf() with 'readDouble' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdfUnits() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y        : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase    : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ Pae_23SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y        : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1178_oprH_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1178_oprH_at:List of 6
  .. .. ..$ x        : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y        : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1816_dnaQ_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_at:List of 6
  .. .. ..$ x        : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y        : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3183_zwf_at   :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_at:List of 6
  .. .. ..$ x        : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y        : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3640_dnaE_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_at:List of 6
  .. .. ..$ x        : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y        : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
Testing readCdfUnits() with 'readAll' indices...done
Testing readCdfUnits() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA1178_oprH_st:List of 6
  .. .. ..$ x        : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
  .. .. ..$ y        : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "c" "g" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "g" "g" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
Testing readCdfUnits() with 'readOne' indices...done
Testing readCdfUnits() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_st:List of 6
  .. .. ..$ x        : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y        : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3183_zwf_st          :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_st:List of 6
  .. .. ..$ x        : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y        : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3640_dnaE_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_st:List of 6
  .. .. ..$ x        : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y        : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA4407_ftsZ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA4407_ftsZ_st:List of 6
  .. .. ..$ x        : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y        : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase    : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ AFFX-Athal-Actin_5_r_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 6
  .. .. ..$ x        : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y        : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase    : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ AFFX-Athal-Actin_M_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 6
  .. .. ..$ x        : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y        : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
Testing readCdfUnits() with 'readSome' indices...done
Testing readCdfUnits() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_st:List of 6
  .. .. ..$ x        : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y        : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3183_zwf_st          :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_st:List of 6
  .. .. ..$ x        : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y        : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3640_dnaE_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_st:List of 6
  .. .. ..$ x        : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y        : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA4407_ftsZ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA4407_ftsZ_st:List of 6
  .. .. ..$ x        : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y        : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase    : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ AFFX-Athal-Actin_5_r_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 6
  .. .. ..$ x        : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y        : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase    : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ AFFX-Athal-Actin_M_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 6
  .. .. ..$ x        : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y        : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
Testing readCdfUnits() with 'readDouble' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'readAll' indices...
List of 1
 $ idxs: NULL
 chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
Testing readCdfUnitNames() with 'readAll' indices...done
Testing readCdfUnitNames() with 'readOne' indices...
List of 1
 $ idxs: int 10
 chr "PA1178_oprH_st"
Testing readCdfUnitNames() with 'readOne' indices...done
Testing readCdfUnitNames() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
 chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readSome' indices...done
Testing readCdfUnitNames() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
 chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readDouble' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
 $ Pae_23SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
 $ PA1178_oprH_at  : Named int 24
  ..- attr(*, "names")= chr "PA1178_oprH_at"
 $ PA1816_dnaQ_at  : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_at"
 $ PA3183_zwf_at   : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_at"
 $ PA3640_dnaE_at  : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st: Named int 24
  ..- attr(*, "names")= chr "PA1178_oprH_st"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_st"
 $ PA3183_zwf_st          : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_st"
 $ PA3640_dnaE_st         : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_st"
 $ PA4407_ftsZ_st         : Named int 24
  ..- attr(*, "names")= chr "PA4407_ftsZ_st"
 $ AFFX-Athal-Actin_5_r_at: Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
 $ AFFX-Athal-Actin_M_at  : Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_st"
 $ PA3183_zwf_st          : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_st"
 $ PA3640_dnaE_st         : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_st"
 $ PA4407_ftsZ_st         : Named int 24
  ..- attr(*, "names")= chr "PA4407_ftsZ_st"
 $ AFFX-Athal-Actin_5_r_at: Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
 $ AFFX-Athal-Actin_M_at  : Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at: chr ""
 $ Pae_23SrRNA_s_at: chr ""
 $ PA1178_oprH_at  : chr ""
 $ PA1816_dnaQ_at  : chr ""
 $ PA3183_zwf_at   : chr ""
 $ PA3640_dnaE_at  : chr ""
Testing readCdfGroupNames() with 'readAll' indices...done
Testing readCdfGroupNames() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st: chr ""
Testing readCdfGroupNames() with 'readOne' indices...done
Testing readCdfGroupNames() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : chr ""
 $ PA3183_zwf_st          : chr ""
 $ PA3640_dnaE_st         : chr ""
 $ PA4407_ftsZ_st         : chr ""
 $ AFFX-Athal-Actin_5_r_at: chr ""
 $ AFFX-Athal-Actin_M_at  : chr ""
Testing readCdfGroupNames() with 'readSome' indices...done
Testing readCdfGroupNames() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : chr ""
 $ PA3183_zwf_st          : chr ""
 $ PA3640_dnaE_st         : chr ""
 $ PA4407_ftsZ_st         : chr ""
 $ AFFX-Athal-Actin_5_r_at: chr ""
 $ AFFX-Athal-Actin_M_at  : chr ""
Testing readCdfGroupNames() with 'readDouble' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
 $ PA1178_oprH_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1178_oprH_at:List of 1
  .. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_at:List of 1
  .. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
 $ PA3183_zwf_at   :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_at:List of 1
  .. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_at:List of 1
  .. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
Testing readCdfCellIndices() with 'readAll' indices...done
Testing readCdfCellIndices() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 1
  ..$ groups:List of 1
  .. ..$ PA1178_oprH_st:List of 1
  .. .. ..$ indices: int [1:24] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfCellIndices() with 'readOne' indices...done
Testing readCdfCellIndices() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_st:List of 1
  .. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ PA3183_zwf_st          :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_st:List of 1
  .. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_st:List of 1
  .. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA4407_ftsZ_st:List of 1
  .. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 1
  .. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readSome' indices...done
Testing readCdfCellIndices() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_st:List of 1
  .. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ PA3183_zwf_st          :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_st:List of 1
  .. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_st:List of 1
  .. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA4407_ftsZ_st:List of 1
  .. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 1
  .. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readDouble' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readAll' indices...done
Testing readCdfIsPm() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 1
  ..$ PA1178_oprH_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readOne' indices...done
Testing readCdfIsPm() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readSome' indices...done
Testing readCdfIsPm() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readDouble' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  1.100   0.247   1.358

affxparser.Rcheck/tests/readCdfUnitsWriteMap.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCdfUnitsWriteMap(cdf)
+   str(data)
+   Jall <- length(data)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCdfUnitsWriteMap() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCdfUnitsWriteMap(cdf, units=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCdfUnitsWriteMap(cdf, units=idxs)
+       str(data)
+       stopifnot(length(data) == Jall)
+     }
+     message(sprintf("Testing readCdfUnitsWriteMap() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
 int [1:15876] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
Testing readCdfUnitsWriteMap() with 'readAll' indices...
List of 1
 $ idxs: NULL
 int [1:15876] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
Testing readCdfUnitsWriteMap() with 'readAll' indices...done
Testing readCdfUnitsWriteMap() with 'readOne' indices...
List of 1
 $ idxs: int 10
 int [1:15876] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfUnitsWriteMap() with 'readOne' indices...done
Testing readCdfUnitsWriteMap() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
 int [1:15876] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
Testing readCdfUnitsWriteMap() with 'readSome' indices...done
Testing readCdfUnitsWriteMap() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
 int [1:15876] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
Testing readCdfUnitsWriteMap() with 'readDouble' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains non-positive indices: -1"
 $ call   : language readCdfUnitsWriteMap(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains non-positive indices: 0"
 $ call   : language readCdfUnitsWriteMap(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains indices out of range [1,345]: 1e+09"
 $ call   : language readCdfUnitsWriteMap(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.326   0.103   0.418

affxparser.Rcheck/tests/readCel.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+ 
+   # Find all CEL files
+   cels <- list.files(path=pathD, pattern="[.]CEL$",
+                      recursive=TRUE, full.names=TRUE)
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ #    readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   for (kk in seq_along(cels)) {
+     cel <- cels[kk]
+ 
+     # Read full file
+     data <- readCel(cel)
+     str(data)
+     Jall <- data$header$total
+     stopifnot(length(data$intensities) == Jall)
+ 
+     # Read different subsets of cells
+     for (ii in seq_along(idxsList)) {
+       name <- names(idxsList)[ii]
+       message(sprintf("Testing readCel() with '%s' indices...", name))
+       idxs <- idxsList[[ii]]
+       str(list(idxs=idxs))
+       if (grepl("outOfRange", name)) {
+         res <- tryCatch(readCel(cel, indices=idxs), error=function(ex) ex)
+         str(res)
+         stopifnot(inherits(res, "error"))
+       } else {
+         data <- readCel(cel, indices=idxs)
+         str(data)
+         J <- if (is.null(idxs)) Jall else length(idxs)
+         stopifnot(length(data$intensities) == J)
+       }
+       message(sprintf("Testing readCel() with '%s' indices...done", name))
+     } # for (ii ...)
+   } # for (kk ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num 143
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num 136
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num 143
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num 136
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  1.106   0.183   1.298

affxparser.Rcheck/tests/readCelIntensities.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+ 
+   # Find all CEL files
+   path <- file.path(pathD, "2.Calvin")
+   cels <- list.files(path=path, pattern="[.]CEL$", full.names=TRUE)
+ 
+   hdr <- readCelHeader(cels[1L])
+   I <- length(cels)
+   Jall <- hdr$total
+ 
+   # Read full file
+   data <- readCelIntensities(cels)
+   str(data)
+   stopifnot(all(dim(data) == c(Jall,I)))
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ #  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read different subsets of cells
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCelIntensities() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCelIntensities(cels, indices=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCelIntensities(cels, indices=idxs)
+       str(data)
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(all(dim(data) == c(J,I)))
+     }
+     message(sprintf("Testing readCelIntensities() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
 num [1:15876, 1:2] 190 11263 164 11272 181 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
Testing readCelIntensities() with 'readAll' indices...
List of 1
 $ idxs: NULL
 num [1:15876, 1:2] 190 11263 164 11272 181 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
Testing readCelIntensities() with 'readAll' indices...done
Testing readCelIntensities() with 'readOne' indices...
List of 1
 $ idxs: int 10
 num [1, 1:2] 143 136
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
Testing readCelIntensities() with 'readOne' indices...done
Testing readCelIntensities() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
 num [1:10, 1:2] 11053 161 11466 152 11210 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
Testing readCelIntensities() with 'readSome' indices...done
Testing readCelIntensities() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
 num [1:10, 1:2] 11053 161 11466 152 11210 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK"| __truncated__
Testing readCelIntensities() with 'readDouble' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE,      readHeader = FALSE, readStdvs = | __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE,      readHeader = FALSE, readStdvs = | __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE,      readHeader = FALSE, readStdvs = | __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.411   0.128   0.527

affxparser.Rcheck/tests/readCelRectangle.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   rotate270 <- function(x, ...) {
+     x <- t(x)
+     nc <- ncol(x)
+     if (nc < 2) return(x)
+     x[,nc:1,drop=FALSE]
+   }
+ 
+   # Search for some available CEL files
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_HG-Focus", "HG-Focus")
+   cel <- file.path(pathD, "2.Calvin", "HG-Focus-1-121502.CEL")
+ 
+   # Read CEL intensities in the upper left corner
+   range <- c(0,250)
+   data <- readCelRectangle(cel, xrange=range, yrange=range)
+ 
+   # Displaying image
+   z <- rotate270(data$intensities)
+   sub <- sprintf("Chip type: %s", data$header$chiptype)
+   image(z, col=gray.colors(256), axes=FALSE, main=basename(cel), sub=sub)
+   text(x=0, y=1, labels="(0,0)", adj=c(0,-0.7), cex=0.8, xpd=TRUE)
+   text(x=1, y=0, labels="(250,250)", adj=c(1,1.2), cex=0.8, xpd=TRUE)
+ 
+   # Read 1x1 rectangle
+   range <- c(0,0)
+   data <- readCelRectangle(cel, xrange=range, yrange=range)
+   print(data$intensities)
+   stopifnot(all(dim(data$intensities) == c(1,1)))
+ }
Loading required package: AffymetrixDataTestFiles
     [,1]
[1,] 83.3
> 
> 
> 
> proc.time()
   user  system elapsed 
  0.511   0.107   0.618

affxparser.Rcheck/tests/readCelUnits.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Find all CEL files
+   cels <- list.files(path=pathD, pattern="[.]CEL$",
+                           recursive=TRUE, full.names=TRUE)
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCelUnits(cels, cdf=cdf)
+   str(head(data))
+   stopifnot(length(data) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCelUnits() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCelUnits(cels, units=idxs, cdf=cdf), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCelUnits(cels, units=idxs, cdf=cdf)
+       str(head(data))
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(length(data) == J)
+     }
+     message(sprintf("Testing readCelUnits() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...done
Testing readCelUnits() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 1
  ..$ PA1178_oprH_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 114 119 142 139 170 ...
Testing readCelUnits() with 'readOne' indices...done
Testing readCelUnits() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readSome' indices...done
Testing readCelUnits() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readDouble' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCelUnits(cels, units = idxs, cdf = cdf)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCelUnits(cels, units = idxs, cdf = cdf)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range: 1000000000"
 $ call   : language readCdfCellIndices(cdfFile, units = units, stratifyBy = stratifyBy, verbose = FALSE)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.616   0.139   0.758

affxparser.Rcheck/tests/readPgf.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles") && packageVersion("AffymetrixDataTestFiles") >= "0.4.0") {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "HuGene-1_0-st-v1")
+ 
+   # Read PGF structure
+   pgf <- file.path(pathA, "HuGene-1_0-st-v1.r4,10_probesets.pgf")
+ 
+   # NOTE: Hard-coded
+   Jall <- 10L
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##    readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=5L,
+     readSome=1:5,
+     readDouble=as.double(1:5),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   data <- readPgf(pgf)
+   str(head(data))
+   stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+   stopifnot(length(data$probesetName) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readPgf() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readPgf(pgf, indices=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readPgf(pgf, indices=idxs)
+       str(head(data))
+       stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(length(data$probesetName) == J)
+     }
+     message(sprintf("Testing readPgf() with '%s' indices...done", name))
+   } # for (ii ...)
+ 
+ 
+   # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+   # Validate correctness of subsets
+   # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+   subsetPgf <- function(data, indices=NULL, ...) {
+     if (is.null(indices)) return(data)
+ 
+     # Atoms
+     offsets <- data$probesetStartAtom
+     natoms <- diff(c(offsets, length(data0$atomStartProbe)+1L))
+     offsets <- offsets[indices]
+     natoms <- natoms[indices]
+     # Identify atoms to keep
+     keep <- logical(length(data$atomStartProbe))
+     for (kk in seq_along(offsets)) {
+       keep[seq(from=offsets[kk], by=1L, length=natoms[kk])] <- TRUE;
+     }
+ 
+     for (ff in c("probeSequence", "probeId", "probeGcCount", "atomExonPosition", "atomId", "probeInterrogationPosition", "probeLength", "probeType")) {
+       data[[ff]] <- data[[ff]][keep]
+     }
+ 
+     data$atomStartProbe <- seq_len(sum(natoms))
+     data$probesetStartAtom <- c(1L, cumsum(natoms))[length(indices)]
+ 
+     # Probesets
+     for (ff in c("probesetName", "probesetId", "probesetType")) {
+       data[[ff]] <- data[[ff]][indices]
+     }
+ 
+     data
+   } # subsetPgf()
+ 
+   data0 <- readPgf(pgf)
+   Jall <- length(data0$probesetId)
+ 
+   for (kk in 1:10) {
+     n <- sample(Jall, size=1L)
+     idxs <- sort(sample(1:Jall, size=n, replace=FALSE))
+     data <- readPgf(pgf, indices=idxs)
+     dataS <- subsetPgf(data0, indices=idxs)
+     for (ff in c("probesetStartAtom", "atomExonPosition"))
+       data[[ff]] <- dataS[[ff]] <- NULL
+     stopifnot(all.equal(data, dataS))
+   }
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ probeSequence    : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:10] "" "" "" "" ...
 $ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
 $ probeId          : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
 $ probesetType     : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ probeSequence    : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:10] "" "" "" "" ...
 $ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
 $ probeId          : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
 $ probesetType     : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...done
Testing readPgf() with 'readOne' indices...
List of 1
 $ idxs: int 5
List of 6
 $ probeSequence    : chr [1:4] "AGATGTGTATAGAGGGTTTAACTTA" "TGTGTATAGAGGGTTTAACTTAAAT" "GTGTATAGAGGGTTTAACTTAAATA" "GATGTGTATAGAGGGTTTAACTTAA"
 $ probesetName     : chr ""
 $ probesetStartAtom: int 1
 $ probeId          : int [1:4] 611456 834021 857576 980218
 $ probesetId       : int 7892505
 $ probesetType     : chr "normgene->intron"
Testing readPgf() with 'readOne' indices...done
Testing readPgf() with 'readSome' indices...
List of 1
 $ idxs: int [1:5] 1 2 3 4 5
List of 6
 $ probeSequence    : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:5] "" "" "" "" ...
 $ probesetStartAtom: int [1:5] 1 5 9 13 17
 $ probeId          : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:5] 7892501 7892502 7892503 7892504 7892505
 $ probesetType     : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readSome' indices...done
Testing readPgf() with 'readDouble' indices...
List of 1
 $ idxs: num [1:5] 1 2 3 4 5
List of 6
 $ probeSequence    : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:5] "" "" "" "" ...
 $ probesetStartAtom: int [1:5] 1 5 9 13 17
 $ probeId          : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:5] 7892501 7892502 7892503 7892504 7892505
 $ probesetType     : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readDouble' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' contains a non-positive element"
 $ call   : language readPgfEnv(file, readBody = TRUE, indices = indices)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' contains a non-positive element"
 $ call   : language readPgfEnv(file, readBody = TRUE, indices = indices)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' contains an element out of range [1,10]: 1000000000"
 $ call   : language readPgfEnv(file, readBody = TRUE, indices = indices)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.432   0.128   0.556

affxparser.Rcheck/tests/testWriteAndReadEmptyCdf.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> systemR <- function(command="", ..., verbose=FALSE) {
+   # Locate the R executable
+   Rbin <- file.path(R.home("bin"), "R")
+   cmd <- sprintf('%s %s', shQuote(Rbin), command)
+   if (verbose) cat("Command: ", cmd, "\n", sep="")
+   system(cmd, ...)
+ } # systemR()
> 
> 
> ## Explicitly append 'affxparser' to library path
> ## Needed for covr::coverage()
> pd <- packageDescription("affxparser")
> libpath <- dirname(dirname(dirname(attr(pd, "file"))))
> cmd <- sprintf(' -e ".libPaths(\'%s\'); affxparser:::.testWriteAndReadEmptyCdf()"', libpath)
> out <- systemR(cmd, intern=TRUE, wait=TRUE, verbose=TRUE)
Command: '/Library/Frameworks/R.framework/Resources/bin/R'  -e ".libPaths('/private/tmp/Rtmp7RwQo9/RLIBS_55217cb2e1fb'); affxparser:::.testWriteAndReadEmptyCdf()"
> cat(out, sep="\n")

R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> .libPaths('/private/tmp/Rtmp7RwQo9/RLIBS_55217cb2e1fb'); affxparser:::.testWriteAndReadEmptyCdf()
Pathname: /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/affxparser/testscripts/writeAndReadEmptyCdf.R

> library("affxparser")

> hdr <- list(chiptype = "Empty2x3", nrows = 2, ncols = 3, 
+     nunits = 0, nqcunits = 0, refseq = "")

> units <- qcUnits <- list()

> pathname <- file.path(tempdir(), "Empty2x3.cdf")

> str(pathname)
 chr "/tmp/RtmpPMNQrI/Empty2x3.cdf"

> writeCdf(pathname, cdfheader = hdr, cdf = units, cdfqc = qcUnits, 
+     overwrite = TRUE)

> hdr2 <- readCdfHeader(pathname)

> str(hdr2)
List of 12
 $ ncols      : int 3
 $ nrows      : int 2
 $ nunits     : int 0
 $ nqcunits   : int 0
 $ refseq     : chr ""
 $ chiptype   : chr "Empty2x3"
 $ filename   : chr "/tmp/RtmpPMNQrI/Empty2x3.cdf"
 $ rows       : int 2
 $ cols       : int 3
 $ probesets  : int 0
 $ qcprobesets: int 0
 $ reference  : chr ""

> units2 <- readCdfUnits(pathname)

> str(units2)
 Named list()
COMPLETE
> 
> 
> res <- any(regexpr("COMPLETE", out) != -1)
> cat("Test result: ", res, "\n", sep="")
Test result: TRUE
> if (!res) {
+   stop("affxparser:::.testWriteAndReadEmptyCdf() failed.")
+ }
> 
> ############################################################################
> # HISTORY:
> # 2012-05-22
> # o ROBUSTNESS: Now launching R without assuming it is on the search path,
> #   cf. R-devel thread 'Best way to locate R executable from within R?'
> #   on May 22, 2012.
> # 2012-05-18
> # o Added because of the OSX build bug, cf.
> #   https://groups.google.com/d/topic/aroma-affymetrix/lEfDanThLEA/discussion
> # o Created.
> ############################################################################
> 
> proc.time()
   user  system elapsed 
  0.460   0.195   0.725

affxparser.Rcheck/tests/testWriteAndReadEmptyCel.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> systemR <- function(command="", ..., verbose=FALSE) {
+   # Locate the R executable
+   Rbin <- file.path(R.home("bin"), "R")
+   cmd <- sprintf('%s %s', shQuote(Rbin), command)
+   if (verbose) cat("Command: ", cmd, "\n", sep="")
+   system(cmd, ...)
+ } # systemR()
> 
> 
> ## Explicitly append 'affxparser' to library path
> ## Needed for covr::coverage()
> pd <- packageDescription("affxparser")
> libpath <- dirname(dirname(dirname(attr(pd, "file"))))
> cmd <- sprintf(' -e ".libPaths(\'%s\'); affxparser:::.testWriteAndReadEmptyCel()"', libpath)
> out <- systemR(cmd, intern=TRUE, wait=TRUE, verbose=TRUE)
Command: '/Library/Frameworks/R.framework/Resources/bin/R'  -e ".libPaths('/private/tmp/Rtmp7RwQo9/RLIBS_55217cb2e1fb'); affxparser:::.testWriteAndReadEmptyCel()"
> cat(out, sep="\n")

R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> .libPaths('/private/tmp/Rtmp7RwQo9/RLIBS_55217cb2e1fb'); affxparser:::.testWriteAndReadEmptyCel()
Pathname: /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/affxparser/testscripts/writeAndReadEmptyCel.R

> library("affxparser")

> hdr <- list(version = 4, chiptype = "Empty2x3", rows = 2, 
+     cols = 3, algorithm = "Percentile\nAlgorithm", parameters = "Percentile:75;CellMarg ..." ... [TRUNCATED] 

> hdr$header <- sprintf("Cols=%d\nRows=%d\nTotalX=%d\nTotalY=%d\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCornerLR=3565  ..." ... [TRUNCATED] 

> pathname <- file.path(tempdir(), "Empty2x3.cel")

> str(pathname)
 chr "/tmp/Rtmpf9yhnN/Empty2x3.cel"

> createCel(pathname, header = hdr, overwrite = TRUE)

> hdr2 <- readCelHeader(pathname)

> str(hdr2)
List of 14
 $ filename      : chr "/tmp/Rtmpf9yhnN/Empty2x3.cel"
 $ version       : int 4
 $ cols          : int 3
 $ rows          : int 2
 $ total         : int 6
 $ algorithm     : chr "Percentile\nAlgorithm"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:TRUE;FullFeatureWidt"| __truncated__
 $ chiptype      : chr "Empty2x3"
 $ header        : chr "Cols=3\nRows=2\nTotalX=3\nTotalY=2\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCorn"| __truncated__
 $ datheader     : chr "[13..25244]  050523MJA_SNP10K-2.0_KJ05:CLS=3666 RWS=3666 XIN=1  YIN=1  VE=30        2.0 09/26/12 10:01:02 50102"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 0
 $ nmasked       : int 0

> data2 <- readCel(pathname)

> str(data2)
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/tmp/Rtmpf9yhnN/Empty2x3.cel"
  ..$ version       : int 4
  ..$ cols          : int 3
  ..$ rows          : int 2
  ..$ total         : int 6
  ..$ algorithm     : chr "Percentile\nAlgorithm"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:TRUE;FullFeatureWidt"| __truncated__
  ..$ chiptype      : chr "Empty2x3"
  ..$ header        : chr "Cols=3\nRows=2\nTotalX=3\nTotalY=2\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCorn"| __truncated__
  ..$ datheader     : chr "[13..25244]  050523MJA_SNP10K-2.0_KJ05:CLS=3666 RWS=3666 XIN=1  YIN=1  VE=30        2.0 09/26/12 10:01:02 50102"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 0
  ..$ nmasked       : int 0
 $ intensities: num [1:6] 0 0 0 0 0 0
 $ outliers   : NULL
 $ masked     : NULL
COMPLETE
> 
> 
> res <- any(regexpr("COMPLETE", out) != -1)
> cat("Test result: ", res, "\n", sep="")
Test result: TRUE
> if (!res) {
+   stop("affxparser:::.testWriteAndReadEmptyCel() failed.")
+ }
> 
> ############################################################################
> # HISTORY:
> # 2012-09-26
> # o Created from tests/testWriteAndReadEmptyCdf.R.
> ############################################################################
> 
> proc.time()
   user  system elapsed 
  0.493   0.193   0.734

Example timings

affxparser.Rcheck/affxparser-Ex.timings

name	user	system	elapsed
applyCdfGroups	0.089	0.092	0.199
convertCdf	0.806	0.035	0.854
convertCel	0.132	0.018	0.155
createCel	0.266	0.031	0.303
findCdf	0.066	0.011	0.079
invertMap	0.564	0.043	0.611
readCdfDataFrame	0.710	0.062	0.803
readCdfHeader	0.008	0.002	0.010
readCdfNbrOfCellsPerUnitGroup	0.449	0.222	0.703
readCdfUnitNames	0	0	0
readCdfUnits	1.291	0.074	1.395
readCdfUnitsWriteMap	0.522	0.039	0.568
readCel	0.012	0.000	0.012
readCelHeader	0.001	0.001	0.001
readCelIntensities	0.000	0.001	0.000
readCelRectangle	0.256	0.029	0.294
readCelUnits	0.019	0.005	0.024
readChp	0.019	0.005	0.024
updateCel	0.828	0.213	1.056
updateCelUnits	1.585	0.276	1.892